ID: 1095576101

View in Genome Browser
Species Human (GRCh38)
Location 12:43741184-43741206
Sequence ACATTTAAGCAAAAGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 1, 2: 5, 3: 60, 4: 417}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095576101_1095576103 -10 Left 1095576101 12:43741184-43741206 CCATCCAGCTTTTGCTTAAATGT 0: 1
1: 1
2: 5
3: 60
4: 417
Right 1095576103 12:43741197-43741219 GCTTAAATGTTATGAGAAACAGG 0: 1
1: 0
2: 0
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095576101 Original CRISPR ACATTTAAGCAAAAGCTGGA TGG (reversed) Intronic
901391154 1:8947165-8947187 ACATGTGAGCCAAAGCTAGAAGG + Intronic
901409779 1:9074371-9074393 ATATTTAAAGAAAAGCTGGCTGG + Intronic
902655969 1:17868648-17868670 ACATTTAAGCAAAGACTTGAAGG + Intergenic
903090474 1:20910855-20910877 ATATTTATGTAAAAACTGGAAGG + Intronic
903681841 1:25102670-25102692 ACATTTGAGGAAAAACAGGATGG - Intergenic
903753483 1:25644884-25644906 CCATTTGAGGAAAACCTGGATGG + Intronic
904113254 1:28143296-28143318 CCATTTAAGCAAAGCCTTGAAGG + Intergenic
905205118 1:36339082-36339104 AAATTTAAGCAAAGGAAGGAAGG + Intergenic
905564071 1:38949459-38949481 ACATTTAAAAAAAATCTGGCTGG + Intergenic
905837694 1:41142326-41142348 TTATTGAGGCAAAAGCTGGAGGG + Intronic
906037776 1:42763262-42763284 ACATTTAGGGAAAAGGTGGATGG + Intronic
907379783 1:54076981-54077003 ACATTTGAGCAGAAACTTGAAGG + Intronic
907399598 1:54216702-54216724 ACACTTATGCTAAACCTGGAAGG - Intronic
908569734 1:65396557-65396579 ACATTTGAGCAAACACTTGAAGG - Intronic
908968284 1:69793529-69793551 ACATTTAAGAAAAGGCCTGAAGG - Intronic
909102152 1:71361669-71361691 ATATTCAGGCAAAAGCTGGGTGG - Intergenic
909154118 1:72049063-72049085 ACATTTAAACAGAAACTAGAAGG + Intronic
909294841 1:73934617-73934639 ACATTTGAGTAAAGACTGGAAGG + Intergenic
909396122 1:75172780-75172802 ATTTCTAAGGAAAAGCTGGAAGG - Intergenic
909624754 1:77703272-77703294 ACATTTAAGCAAAGACTTAAAGG - Intronic
910238025 1:85055881-85055903 ACATCTTAGCAAAAACTTGAAGG + Intronic
912348858 1:108991957-108991979 ACATTAAAACAAAAGCTGGCTGG - Intronic
912490910 1:110062172-110062194 AAACCTAAGCAAAAGATGGAAGG - Intronic
913153344 1:116067648-116067670 TCAGCTAAGAAAAAGCTGGAGGG - Exonic
913392613 1:118331219-118331241 AAATATGAGGAAAAGCTGGAAGG - Intergenic
914452488 1:147805084-147805106 ACATTGGAGCAAAAACTGGAGGG + Intergenic
915502692 1:156330240-156330262 ACTTTTAGGGAAAACCTGGAAGG - Intronic
915955660 1:160218080-160218102 TCATAAAGGCAAAAGCTGGAGGG - Intronic
916285829 1:163103985-163104007 ACATTTAAGGACCAGCTGGAAGG + Intergenic
916390848 1:164329290-164329312 CCACTGCAGCAAAAGCTGGATGG - Intergenic
916511305 1:165474474-165474496 ACATTTGAGCAAAAATTTGAAGG + Intergenic
916602340 1:166305341-166305363 ACCTTTCAGCAGAGGCTGGAAGG + Intergenic
918838390 1:189500607-189500629 ACATTTGAGCAAAGACAGGAAGG - Intergenic
919051892 1:192521896-192521918 ACATTTATGCCAAAATTGGAAGG + Intergenic
920036135 1:203067062-203067084 ACATTTAAGCAAAGACTTAATGG + Intronic
920674051 1:208026801-208026823 AGAATTAAACAAAAGTTGGACGG + Exonic
920938644 1:210459621-210459643 ACATTTGAGCAAAAACTTGAAGG - Intronic
921892366 1:220366252-220366274 ACATTTAAGCAGAGGCTTAAAGG + Intergenic
921912707 1:220568290-220568312 AGATTTAAGCAAAGACTTGAGGG + Intronic
922021145 1:221706028-221706050 ATATCAAAGCAAGAGCTGGAGGG + Intronic
922300448 1:224294770-224294792 ACATTTCAGAAAAGGCTTGAAGG + Intronic
922883849 1:229003225-229003247 AAATTCAGGCAAAAGCTGGGTGG + Intergenic
923739186 1:236640195-236640217 AAATTGCAGAAAAAGCTGGAGGG - Intergenic
923826987 1:237511383-237511405 AGATATAAGCAAATGCTGCAAGG + Intronic
923883360 1:238128431-238128453 ACTTTTCTGCAAAAGCAGGAAGG - Intergenic
923894551 1:238254874-238254896 ACATTCTAGGAAAAGATGGAAGG - Intergenic
924834511 1:247635446-247635468 AAATTTAGGCAAAAGCTTAAAGG + Intergenic
1063147757 10:3311387-3311409 ACCTTTAAACAAAAGCCTGAAGG - Intergenic
1064066179 10:12183764-12183786 ACGTGTAAGAAAAAGCCGGAAGG - Intronic
1064970926 10:21066068-21066090 CCATATGAGCATAAGCTGGATGG + Intronic
1065341997 10:24716377-24716399 ACCTCTAAGCAAAAGCCCGAAGG + Intronic
1065903716 10:30229942-30229964 ACATTTAGACAAAGGCTGGTTGG + Intergenic
1065982451 10:30913466-30913488 ACATTTAAGCAAAAATCTGATGG - Intronic
1067712528 10:48661398-48661420 AACTTTAAGCAAAAGATGTAGGG + Intergenic
1068966641 10:62918390-62918412 ATCTTTAAGCACAAGCTGGCTGG - Intronic
1069333269 10:67318707-67318729 ACATTTGAGCAAAGGCTTGGAGG - Intronic
1069729965 10:70604159-70604181 ACATTTTATCATTAGCTGGAAGG - Intergenic
1070015830 10:72530029-72530051 ACATTAAAACAAAAGCTGGCAGG + Intronic
1071139538 10:82491835-82491857 ACATTTAAGGAAAAGAGGAAGGG - Intronic
1072295265 10:94003313-94003335 GGATTTAAGCAAAAGATGAAAGG + Intronic
1073741341 10:106410740-106410762 AGATTTAAGCAAAAGTTGTACGG + Intergenic
1074143569 10:110697733-110697755 AGACTTGAGCAAAAGCTTGAGGG - Intronic
1074167639 10:110898636-110898658 ACAGTTAAGTAAAAGGTGGCTGG + Exonic
1074304956 10:112268441-112268463 ACATTTAAGCAAAAGTCAGGAGG + Intergenic
1075311472 10:121417484-121417506 AGAGACAAGCAAAAGCTGGAAGG + Intergenic
1075605741 10:123805944-123805966 AAAATAATGCAAAAGCTGGAGGG - Intronic
1075786751 10:125055146-125055168 ACTTTTAAGAAAAAGCAAGAAGG - Intronic
1076548435 10:131261448-131261470 AAATATCAGCAAAAGCAGGACGG + Intronic
1078970151 11:16400343-16400365 ACATTTAAGCAAAAACTTGAAGG + Intronic
1079164591 11:18027551-18027573 AAGTTCAAGCAAAAGTTGGAAGG - Intronic
1080195684 11:29605828-29605850 ACATGTGAGGAAAAGCTAGAAGG - Intergenic
1080397059 11:31899750-31899772 ACATGTAAGCAAAGACTTGAAGG - Intronic
1080933914 11:36841714-36841736 ACATTCAAGGCAAACCTGGAAGG - Intergenic
1080961610 11:37167582-37167604 ACATTAAAGTTAATGCTGGAAGG - Intergenic
1080996957 11:37615368-37615390 CCATTTAAGGAAGACCTGGAGGG + Intergenic
1081099816 11:38987287-38987309 CCACTTAACCAAAATCTGGATGG - Intergenic
1082872442 11:57955791-57955813 ACATTTAAGCAGAAAATGAAAGG - Intergenic
1082899835 11:58235592-58235614 ACATTTCATGAAAAGCTGGGAGG - Intergenic
1083853924 11:65382841-65382863 ACATTTGAGCCCCAGCTGGAGGG - Intronic
1084487283 11:69455959-69455981 ACATTTCAGCAAGATCTGAAGGG + Intergenic
1085693441 11:78683988-78684010 ACATTTTAGCAGAGCCTGGAGGG - Intronic
1085933477 11:81114577-81114599 ACATTTAAGCAAAAACCTAAAGG - Intergenic
1086911051 11:92473026-92473048 ACATTTAAGCTAAAGCTTAAAGG - Intronic
1088051347 11:105518972-105518994 AAATTTGAGCAAAACTTGGAGGG + Intergenic
1089100255 11:115957095-115957117 ACATAAAAGCAAAAAATGGATGG + Intergenic
1089367576 11:117930716-117930738 ATATTTGAGCAAAAACTGAAAGG + Intergenic
1090908655 11:131098850-131098872 ACATTTCAGCAGAGGCTTGAAGG + Intergenic
1090935425 11:131337461-131337483 ACATTTAAGCAAAACCTTGAAGG - Intergenic
1091870099 12:3882455-3882477 ACATTTAAGGAAAAACTTGGAGG + Intergenic
1092927378 12:13283810-13283832 ATATTAAAGAAAAAGCTGCAAGG - Intergenic
1093360144 12:18215845-18215867 ACATTTAATAGAAAGCTGAAAGG - Intronic
1093993059 12:25611404-25611426 ACATTTAAGCACAGGCTGTGAGG + Intronic
1095155783 12:38852001-38852023 ACATTTAAGCAGAGGCTTAAAGG - Intronic
1095308418 12:40664828-40664850 ACTTTAAATCAAAAGCTAGAAGG + Intergenic
1095576101 12:43741184-43741206 ACATTTAAGCAAAAGCTGGATGG - Intronic
1096445181 12:51683518-51683540 AGATTTCAGCAAAGACTGGAAGG - Intronic
1096850510 12:54432682-54432704 ACAAGTGAGCAACAGCTGGATGG - Intergenic
1097771092 12:63586441-63586463 AAATTTCAGCATAACCTGGAAGG + Intronic
1098094195 12:66937073-66937095 TCATATTAGCAAAAGCTTGAAGG + Intergenic
1099338498 12:81396395-81396417 ACATTTGAACAAAGACTGGATGG + Intronic
1099413193 12:82357820-82357842 AAATTAAAGCGAAGGCTGGAGGG + Intronic
1100064741 12:90628496-90628518 ACATTTAAGTAAAAACAGGAAGG - Intergenic
1100514050 12:95308618-95308640 ACATTTTAGCAAAAATTGGTTGG + Intergenic
1101072291 12:101088289-101088311 ACATTTGAACAAAGACTGGAAGG - Intronic
1101668561 12:106844444-106844466 ACACTTAAGGAAAAGCAAGAAGG + Intronic
1102588983 12:113943095-113943117 ACACTTAAGCAGAAACTGAATGG - Intronic
1105550832 13:21394313-21394335 GGATTTAAGCAAAAACTTGAAGG - Intronic
1106248558 13:27967784-27967806 CATTTCAAGCAAAAGCTGGAAGG - Intronic
1107038910 13:35928436-35928458 ACATTTGAGCAAAGACTTGAGGG - Intronic
1107646141 13:42496115-42496137 ACTTTTGAGCAAAGACTGGAAGG - Intergenic
1108281271 13:48864647-48864669 ATATTTAAACAAAAACTTGAAGG + Intergenic
1108483504 13:50900692-50900714 ACATTTGAGCAAAGACTTGAAGG - Intergenic
1109651517 13:65333491-65333513 ACATTTAAGTAAAAGCTAACAGG - Intergenic
1109880144 13:68461711-68461733 AGATAAAAGCAAAAGCTTGAAGG - Intergenic
1111545209 13:89724539-89724561 ATTTTTAAGCAAAAGCTAAATGG - Intergenic
1112052557 13:95657329-95657351 AAATCTCAGCAAAAGGTGGAAGG - Intergenic
1112373656 13:98818574-98818596 ACTGTTAAGTAAAAGCTGGTTGG + Intronic
1114576962 14:23724405-23724427 ACATTTTAGCAAAGACTTGAAGG + Intergenic
1114767201 14:25386977-25386999 ACATTTGAGCAAAGGCTTGAAGG + Intergenic
1115044086 14:28968551-28968573 ACATTTAAGCAAAACTTTGGAGG + Intergenic
1115287228 14:31728744-31728766 ACATCTCACAAAAAGCTGGAAGG - Intronic
1116578093 14:46601731-46601753 ACATTTGAGCAAAAACTTGAAGG + Intergenic
1116940038 14:50782548-50782570 ACAATTAGACAAAGGCTGGAAGG + Intronic
1117541704 14:56753139-56753161 GCCTTTAAGCAAAAGCTCAATGG + Intergenic
1117699778 14:58401168-58401190 ACACTCAAGGAAAAGCTGGAAGG - Intronic
1117899423 14:60516457-60516479 ACATTCTAGCAAAGGCTGAAGGG - Intergenic
1118178265 14:63464370-63464392 ACATTTGAGCAAATACTTGAAGG + Intronic
1118518808 14:66557721-66557743 ACATTTAAGCAGAATCCAGAGGG - Intronic
1118707452 14:68493337-68493359 CCTTTTAAGAAAAATCTGGATGG + Intronic
1119827114 14:77666441-77666463 ATATTTGAGCAAAGACTGGAAGG + Intergenic
1119861276 14:77937859-77937881 ACATTTCAGTAAAAGCTGTTTGG + Intergenic
1119913222 14:78370392-78370414 ATATTTGAGCAATATCTGGAAGG - Intronic
1120322107 14:82976794-82976816 TCATTTAAGCAAAATTTTGAAGG - Intergenic
1120906129 14:89622790-89622812 ACATTTAAGCAAAGGCTAATGGG - Intergenic
1121658003 14:95612362-95612384 AGATTTAAGCACAAACTTGAAGG - Intergenic
1122145443 14:99685882-99685904 GCATTGAAGCCAAACCTGGAAGG - Intronic
1123752412 15:23367591-23367613 ATATTTAAGAAAAAGCTAAAAGG + Intergenic
1124080728 15:26492408-26492430 ACATTTGAGCAAAGACTTGAGGG - Intergenic
1125118411 15:36122851-36122873 GCATTTAAGCAGAGGCTGAAGGG + Intergenic
1125750880 15:42027439-42027461 ACATCTGGGAAAAAGCTGGAGGG - Intronic
1126736098 15:51733566-51733588 ATATTTAAGCAAAGACTTGAAGG + Intronic
1127377287 15:58396989-58397011 GCATTTGAACAAAAGCTGAAAGG + Intronic
1128105567 15:65042189-65042211 ACATTTAAGCTGAGGCTTGAAGG + Intergenic
1129343287 15:74900268-74900290 ACCTTGTAGAAAAAGCTGGAGGG - Exonic
1130727968 15:86460733-86460755 GCATTTAAGGAAAAGCGGCAAGG - Intronic
1133626576 16:7575508-7575530 ACATTGAAGCAGAGGATGGAAGG + Intronic
1133719086 16:8477673-8477695 ATATTTAGGCAGAAGCTAGATGG + Intergenic
1134271531 16:12737247-12737269 ACATTTGAGCAACAACTTGAAGG + Intronic
1134540768 16:15063410-15063432 ACATTTAAAAAAAACCTGGCTGG + Intronic
1135142696 16:19935344-19935366 ACATTTGAGCAAAACTTTGAAGG + Intergenic
1135171939 16:20192296-20192318 ACATTTCACCAAAGCCTGGAAGG + Intergenic
1135277938 16:21129315-21129337 ACATTTGAGCCAAGGCTGGAAGG - Intronic
1136177422 16:28527185-28527207 GCATTTAAGCAAAGGCCAGAAGG - Intergenic
1137058136 16:35755049-35755071 ACATGTGAGGAAAAGCAGGAAGG - Intergenic
1139739277 16:69021354-69021376 ACATTTAAACAAAGACTGGAAGG - Intronic
1140025632 16:71288260-71288282 ACATTTGAGCAAATATTGGAAGG - Intronic
1140039506 16:71396799-71396821 ACATTTGAGCCAAGCCTGGAAGG - Intergenic
1140696171 16:77536395-77536417 ACATTTGGGGAAGAGCTGGAGGG - Intergenic
1140923142 16:79557930-79557952 ACATTTAAGCCAAGGCCTGATGG + Intergenic
1141178146 16:81734256-81734278 ACATTTGAGCAAAAACCTGAGGG + Intergenic
1141241246 16:82266984-82267006 ACATTTAAGCAACTGCTGGGGGG - Intergenic
1141289887 16:82708026-82708048 ACGTCTGAGCAACAGCTGGAAGG - Intronic
1142419140 16:89959808-89959830 ACTTTTAAGCAAAAACTTGAAGG + Intronic
1144293679 17:13853031-13853053 ACATTTGAGCAGAAACTTGAAGG + Intergenic
1146108517 17:30065003-30065025 ACAGATAAGCAAAAACTTGAGGG + Intronic
1146416003 17:32633800-32633822 ACATTTAAGCAAAGACTTGAAGG - Intronic
1146518554 17:33508574-33508596 ACATTTAAGCAAAAGGGTAAAGG + Intronic
1146944799 17:36866279-36866301 ACATTTGAGCAAAGACTTGAAGG - Intergenic
1149727616 17:58912359-58912381 ACATTTAAGCAGAGACTTGAAGG + Intronic
1149892153 17:60399736-60399758 ATATTTAAGCCAAAATTGGAAGG + Intronic
1150054182 17:61996631-61996653 ACATTTAAGCAAAGACTTGAAGG - Intronic
1152991311 18:366286-366308 ACATTTGAGCAAGAGTTTGAGGG + Intronic
1153027035 18:681371-681393 TCATGTAAGCAAAACCTGGGAGG + Intronic
1155167513 18:23243374-23243396 ACACTTAACCTAAAGCTGGCAGG - Intronic
1155391144 18:25338128-25338150 ATATTTAAGGAACAGTTGGAAGG + Intronic
1155549593 18:26950937-26950959 TCCTCTAACCAAAAGCTGGAGGG - Intronic
1155606401 18:27611295-27611317 TCATTTAAGCAAAGTCTTGAAGG + Intergenic
1155830203 18:30507449-30507471 ACATTTAAGAAAAATCAGAAAGG + Intergenic
1155969837 18:32071886-32071908 ACAATAAAGCAAAATCTGGCTGG + Exonic
1156177445 18:34563449-34563471 ACAATTAAGCAAAAACTGGTTGG - Intronic
1156446617 18:37241776-37241798 ACATTTAGGTCAAGGCTGGAAGG + Intergenic
1157599220 18:48883512-48883534 GCATTTAAGCAAAATGTTGATGG + Intergenic
1157702270 18:49769314-49769336 ACATTTGAGCAAATGCTTGAAGG - Intergenic
1158013458 18:52756001-52756023 ACTTTTAAGAAAATGTTGGATGG - Intronic
1158157186 18:54439094-54439116 ACATTTAAGCAAAGTCCTGAAGG - Intergenic
1158519614 18:58160902-58160924 ACATGTAGGCAACAGCTGGGAGG - Intronic
1158677655 18:59536385-59536407 TCATTGAAGGAAGAGCTGGAGGG - Intronic
1158758742 18:60358370-60358392 ACATCTGAGCAAAAACTTGAAGG + Intergenic
1159014549 18:63090417-63090439 ACCTTTAAGCCATAGTTGGACGG - Intergenic
1159289216 18:66395360-66395382 AAATGTAAGCAACACCTGGAAGG + Intergenic
1159708483 18:71723503-71723525 AAATTTAACCAAAAGCTAGTGGG + Intergenic
1159871797 18:73766973-73766995 ACGTTTAAACAAAGGCTGAAAGG + Intergenic
1160179368 18:76620457-76620479 ACATTTTAGCAACATCTGAAAGG - Intergenic
1160674664 19:383459-383481 ATATTTAAGGAGAATCTGGAAGG - Intergenic
1160945006 19:1637527-1637549 ACATGGAAGCAAGAGCGGGATGG - Intronic
1161875416 19:6904863-6904885 ACATTTAAGCAGAAACCTGAAGG + Intronic
1162754006 19:12846459-12846481 ACATTGAAGCAAAAATTTGAAGG + Intronic
1162819391 19:13213324-13213346 ACATGTGAGCAAAGGCTTGAAGG - Intronic
1162871631 19:13590948-13590970 ACCTTTAATCAAAGGCTGGAAGG + Intronic
1164447057 19:28326882-28326904 GGATCTAAGTAAAAGCTGGAGGG - Intergenic
1165463935 19:35960848-35960870 ACATTTGAGCAAAGGCTTGAAGG - Intergenic
1165946563 19:39446490-39446512 ACATTTGAGCAAAAACTTGTTGG + Intronic
1165954689 19:39494939-39494961 ACATTTAAGCAAAGGCCTAAAGG - Intergenic
1166219582 19:41355872-41355894 ACATTTGAGCAAATGCTAAAAGG + Intronic
1166698987 19:44871160-44871182 AGATTTAAAAAAAAGCTGGTCGG - Intronic
926669510 2:15562949-15562971 ACATTTGAGCAAAAACTTGAAGG - Intergenic
927494702 2:23544685-23544707 ACATTTGAGAAGAGGCTGGAAGG + Intronic
927595227 2:24390849-24390871 ACATTTAAACAAAAGAAGAAAGG - Intergenic
927829108 2:26333078-26333100 AGATTTAGGGAAAACCTGGAAGG - Intronic
928237461 2:29556683-29556705 ACATTTAAATGAAACCTGGATGG - Intronic
929719400 2:44352087-44352109 ACATTTGAGCAATAGCTTTAAGG - Intronic
929836418 2:45404978-45405000 ACATTTAAGAAAAGTCTTGACGG - Intronic
929997851 2:46840218-46840240 ACATTCAAGAAATATCTGGAAGG - Intronic
930662399 2:54067955-54067977 AGATTTAAGCAAAACATTGAGGG + Intronic
930781604 2:55229441-55229463 ACATTTGAGGAACAGCTAGAGGG + Intronic
930996533 2:57726122-57726144 ACATGAAAGCAGTAGCTGGAAGG - Intergenic
931569835 2:63657008-63657030 AAAGTAAAGGAAAAGCTGGAAGG + Intronic
931760642 2:65413647-65413669 ACATCTAAGCATAAGCTGCAGGG + Intronic
932947806 2:76257853-76257875 ACAACTAAGCAAAAGCAGGAGGG + Intergenic
933287590 2:80401017-80401039 ACATTTAAGCTAAGCCTGGTAGG - Intronic
933294157 2:80470915-80470937 ACATTTAAGCAAAGTCCTGAAGG + Intronic
935139571 2:100340675-100340697 ACATTTATGCCGAAGCTGAATGG - Intergenic
936606627 2:113964110-113964132 ACATTTAGCCAAGAGATGGAAGG + Intergenic
937039109 2:118807453-118807475 TCATTCAGGCAACAGCTGGAAGG + Intergenic
937638335 2:124183023-124183045 ATAAATAAGCAAAAGGTGGAGGG - Intronic
938659489 2:133471035-133471057 ACATAAAAGCAAAAGCAGGGGGG - Intronic
939206964 2:139119126-139119148 AAAATAGAGCAAAAGCTGGATGG + Intergenic
939264079 2:139849480-139849502 ACATTGAAGCCCAAGCTGCATGG + Intergenic
939621299 2:144422244-144422266 ACATTTAAGTTAAAGCCAGATGG - Intronic
940130204 2:150372476-150372498 ACAGGGAAGCAAAAGCTGAAGGG - Intergenic
940677124 2:156737849-156737871 ACATTTTAGAAAATGCTGGTGGG + Intergenic
941200488 2:162502589-162502611 ACATTTAAGCCAGATCTAGAAGG - Intronic
941224278 2:162826938-162826960 ACTTTTAAGCAAATTCTGTATGG - Intronic
941283974 2:163586055-163586077 TCATTTATGCAAAGGCTGGGAGG + Intergenic
941707088 2:168670657-168670679 ACCTTTGAGCAAAAGCCTGAAGG - Intronic
941763534 2:169270909-169270931 ATTTTTAAGCAAAAGATTGATGG - Exonic
942500125 2:176580500-176580522 ACATTTTGGCCAAAGATGGAAGG - Intergenic
942653078 2:178188951-178188973 ACACTTAAGCAAAGACTTGAAGG - Intergenic
942664439 2:178302105-178302127 TAATTAAAGCAAAAGCTGGTAGG - Intronic
943138887 2:183952492-183952514 ACATCTAAGCAGAAGCTTTAAGG - Intergenic
944199522 2:197091125-197091147 ACATTTAAGCCAACCGTGGACGG + Intronic
944482429 2:200171606-200171628 ACATTTAAGCAAAACCCTAAAGG - Intergenic
944517616 2:200527939-200527961 ACATTTTGGCAAATGCTCGAAGG + Intronic
944824566 2:203468445-203468467 ATATTTAAGCTAAAGCCTGAAGG - Intronic
945607204 2:211949747-211949769 ATATTTGAGCAAAAACTTGAAGG - Intronic
946083397 2:217147170-217147192 AGATTAAAGCACTAGCTGGATGG - Intergenic
946176383 2:217924239-217924261 ACATTTAAGCCAAAGCCAGAAGG - Intronic
946723940 2:222642310-222642332 TCATTAAATGAAAAGCTGGAAGG + Intronic
946835394 2:223767495-223767517 ATATTCAAGCAGAAGATGGATGG - Intronic
947608178 2:231503885-231503907 ATATTTAAGCTAAAACTGGATGG + Intergenic
947691980 2:232146943-232146965 ACATTTATGAAAATGCTGAAAGG - Intronic
1168730096 20:69735-69757 ACTTATTAGGAAAAGCTGGATGG + Intergenic
1168823065 20:789750-789772 ACCTTAAGGCAAAAGCTTGAGGG + Intergenic
1168857687 20:1020209-1020231 ACATTTGAGCAGAAGCCTGAAGG + Intergenic
1168903498 20:1385867-1385889 ACATTTGAGCAAAGACTTGAAGG - Intronic
1169717150 20:8632626-8632648 ACACTTAAGCAAAGACTGGAAGG + Intronic
1169992717 20:11521501-11521523 AGATTTAAGCAATATCTGGTTGG - Intergenic
1170396048 20:15926644-15926666 ACATTTAAGCAGTAACTTGAAGG + Intronic
1174441478 20:50558844-50558866 AAATTTCTGCAAAAACTGGAGGG - Intronic
1174478019 20:50811004-50811026 ATATTTGAGCAAAAGCTAGAAGG + Intronic
1174830439 20:53807266-53807288 ACATTTGAACAAAGACTGGAAGG - Intergenic
1175140036 20:56854153-56854175 ACATTTGAGCAGAAACTGGAAGG - Intergenic
1176229684 20:64025857-64025879 ACACTTAATCAAAAGCAGGCAGG - Intronic
1176876936 21:14139754-14139776 GCATTTGAGCAAAAGCTTGGAGG + Intronic
1177533146 21:22389244-22389266 TCATTTAAACAAAAACTGGGAGG - Intergenic
1177568350 21:22853163-22853185 ACATTTGATCAAAGACTGGAAGG + Intergenic
1177703194 21:24664930-24664952 GCTTTTAAGCAAATGCGGGAAGG + Intergenic
1178702038 21:34841742-34841764 ACATTTCAGCAAATACTTGAAGG - Intronic
1180879121 22:19191494-19191516 TCATTTGAGCAAAAACTGGAAGG - Intronic
1182194157 22:28497004-28497026 ATATTTAAGTAAAGGCTTGAAGG - Intronic
1183016014 22:34987770-34987792 ACATTTGAGCAAAATTTTGAAGG - Intergenic
1183135049 22:35879118-35879140 ACATTTGAGCAAAAATTTGAAGG + Intronic
1184704763 22:46203153-46203175 ACAGTTCAGTAAAACCTGGAAGG - Intronic
949202968 3:1402560-1402582 ACATTTAAGCCATAACTGGAAGG - Intronic
949659493 3:6261597-6261619 AGTTTTGAGCAAAAACTGGAAGG - Intergenic
949879481 3:8650112-8650134 ACATTTGAGCAAAGGCCTGAAGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950342667 3:12261286-12261308 ACTTTTAAGATAAAGTTGGAAGG + Intergenic
950571420 3:13802557-13802579 ACATTTAAGCAAAGACTTGCAGG + Intergenic
951481538 3:23167084-23167106 AAATATGAGCAAAGGCTGGAAGG - Intergenic
951527089 3:23663949-23663971 ACATTTAAGCATCCGTTGGATGG - Intergenic
952158674 3:30671407-30671429 ACATTTAAGCTGAAGTTTGAAGG + Intronic
952341771 3:32453065-32453087 AAACTTAAGAAAAAGCTGGCTGG - Intronic
953115848 3:39991669-39991691 ACATTTGAGCAAATACTTGAAGG - Intronic
953236042 3:41108079-41108101 TCATGCAAGCAAAAGCTGAATGG - Intergenic
954087975 3:48261293-48261315 ACATTTGAGCAAAGGCTTGAAGG + Intronic
954288359 3:49635653-49635675 ACATTCAACAAAAAGATGGATGG - Intronic
955587685 3:60499265-60499287 AGATTTAAGAAAAAGCAGAAGGG - Intronic
956066093 3:65398863-65398885 ACATTTAAACTAAATCTTGAAGG + Intronic
956382442 3:68679112-68679134 ACATTTAAGCAAAAGCCCAGAGG - Intergenic
959196359 3:103187891-103187913 ACATTTATGCAAAATATTGAAGG + Intergenic
959835076 3:110908940-110908962 ACATTTAAGGAAAAGCTGGCAGG + Intergenic
959852216 3:111101967-111101989 ACATTTAAGCTATACCTTGAAGG - Intronic
959969219 3:112390016-112390038 AAATTAAAGCAAATGGTGGAAGG + Intergenic
960976178 3:123176814-123176836 GCATTAAAGAAGAAGCTGGAGGG - Intronic
962076770 3:132090406-132090428 ATATTTGAGCAAAGGCTTGAAGG - Intronic
962768717 3:138593066-138593088 GCTTTGAAGCAAAAGCTGTAGGG + Intronic
963450539 3:145475736-145475758 ACATTAAAAGAAAAGCTGGCTGG + Intergenic
963631996 3:147745039-147745061 ACATTTGAGCAAATACTTGAGGG + Intergenic
963900660 3:150730104-150730126 ATATTTGAGCAAATGCTTGACGG - Intergenic
964003053 3:151799600-151799622 GCATCTAAGAAAAAGCTGAAAGG + Intergenic
964170707 3:153766911-153766933 ACATTTACCTAAAAGCTGGAAGG + Intergenic
964290896 3:155179089-155179111 ATATTTAAGCAAAGGCATGAAGG + Intronic
964417440 3:156462370-156462392 ACCTTCAACAAAAAGCTGGATGG - Intronic
967195642 3:187023176-187023198 ACATTTGAGCAAGGGTTGGAAGG - Intronic
968403225 4:316649-316671 ACATTTAGGCAAAGGCTTGAAGG + Intergenic
969687022 4:8681392-8681414 ACATTTGCACAAAAGCTGGGAGG - Intergenic
970041709 4:11805907-11805929 ATATTTAAGCTCAAACTGGAAGG - Intergenic
971022885 4:22556390-22556412 ATATTTAAGCAAAATATTGAAGG + Intergenic
971485907 4:27159980-27160002 ACATTTAAGGAAAGACTTGAAGG - Intergenic
972772227 4:42208226-42208248 ACATTTAGGCTAAAACTGGAGGG - Intergenic
973936943 4:55855682-55855704 ACATTTTAGCACAATCTTGAGGG + Intronic
974476713 4:62391040-62391062 TCATTTAAGCAAAGACTTGATGG - Intergenic
975688294 4:76939747-76939769 AAATCTAAGCAAAAGTTTGATGG + Intergenic
977191075 4:94001383-94001405 ACACTTATGCAAGGGCTGGAAGG - Intergenic
977980778 4:103318938-103318960 AGATATAAGCAAAAGTTGTAGGG - Intergenic
978462268 4:108969225-108969247 ACAGTCATCCAAAAGCTGGAAGG - Intronic
978553493 4:109953281-109953303 ACAATTAAGCAAAAGGCTGATGG - Intronic
978698990 4:111619504-111619526 ACATTTAAGCTGAGGCTTGAAGG - Intergenic
979488995 4:121302971-121302993 ACATTGAAGAAAAAAATGGAGGG + Intergenic
979629911 4:122888688-122888710 ACATTTGAGCAAATGCTTGAAGG - Intronic
980296595 4:130926499-130926521 AGACTCAAGCAAAAGCTGCAAGG - Intergenic
980437497 4:132797276-132797298 ATATTTTAGAAAAAACTGGAAGG - Intergenic
980665712 4:135931200-135931222 ACATTTAAGAAAATACTTGAAGG - Intergenic
981678400 4:147365877-147365899 ACATTTGAGCAAAGACTTGAAGG + Intergenic
981923232 4:150109879-150109901 AAATTAAAACAAAAGGTGGAGGG + Intronic
982081495 4:151794432-151794454 ACATTTAAGCAAAGACTTGATGG - Intergenic
982115262 4:152093738-152093760 ACATTGAAGAAAAAGGAGGAAGG + Intergenic
982514011 4:156321207-156321229 ATATTTAAGCAAATGTTTGAAGG + Intergenic
982980374 4:162126607-162126629 ACATTTAAGTAAAAGTTAAATGG - Intronic
983258944 4:165434028-165434050 ACATTTAAGCTAAAGACAGAAGG - Intronic
983346254 4:166528665-166528687 ACATTTAAGCAAAGATTGGAAGG + Intergenic
983905785 4:173181235-173181257 ACATTTAAGCAGAAGATTGCTGG + Intronic
984405433 4:179323896-179323918 GCATTTGAGCAAACTCTGGATGG - Intergenic
984602364 4:181743481-181743503 ATATTTGAGCAAAGGCTTGAAGG + Intergenic
984622873 4:181973832-181973854 ATGTTTAAGCAAAGGCTTGAAGG + Intergenic
984876069 4:184368832-184368854 AAATTTAAGCAAAAACTTGAAGG + Intergenic
986591288 5:9373530-9373552 AAACTTAAGCAAGAGCTGCATGG - Intronic
986728217 5:10615850-10615872 ACATTTATGCGAAAGCAGGTGGG + Intronic
987790157 5:22555136-22555158 ACATTTAAGACTAAACTGGATGG - Intronic
988375477 5:30429502-30429524 ACACTAAAGAAAAAGCTGGGAGG - Intergenic
988396505 5:30702598-30702620 ACATTTAAGCAAAAACTTGAAGG + Intergenic
989100546 5:37818824-37818846 ACATTTGAGCAAAGACTTGAAGG - Intronic
990582813 5:57181588-57181610 ACATTTAAAAAAAAGGTGGGGGG + Intronic
990886303 5:60598269-60598291 CCATTTGAGCAGAAGCTGGTGGG - Intronic
991398048 5:66225194-66225216 ACATTTAGGCAAAGACTTGAAGG + Intergenic
992014475 5:72561507-72561529 ATATTTCAGCAAAGGCTTGAAGG - Intergenic
992802476 5:80306067-80306089 ACACTTAAGTAAAAGCTTGAAGG - Intergenic
992904092 5:81328176-81328198 ACATTTGAGCAAAAGCCTGCAGG - Intergenic
993424625 5:87748022-87748044 ACACTTGAGCAAAGCCTGGAAGG + Intergenic
993543258 5:89178933-89178955 AGAGTTAAGAAAAAGCTAGAAGG + Intergenic
993974042 5:94455268-94455290 ACATTCAAGCAAAACCAAGAAGG + Intronic
995040495 5:107582638-107582660 ACATTTAAACATTAGCTTGAAGG - Intronic
997093138 5:130879675-130879697 ACATTTGAGCAAAAGCCTGAAGG + Intergenic
997899022 5:137746560-137746582 ACATTTGAGCAAAGACTTGAAGG - Intergenic
998373791 5:141678453-141678475 ACATTTGATCAAAAACTTGAAGG - Intronic
999424203 5:151472739-151472761 ACATCAAAGATAAAGCTGGAAGG - Intronic
999868149 5:155724129-155724151 AATTTTAAGCAAAAACTGGCAGG - Intergenic
1000599098 5:163250704-163250726 ACATGTAAAAAAAAGATGGAGGG + Intergenic
1001404170 5:171463868-171463890 ATATTTAAGCAGAAGCTGTAGGG - Intergenic
1001600341 5:172924219-172924241 ACATCTAAGCCAAGCCTGGAAGG + Intronic
1001887206 5:175303652-175303674 ACATTTAGGCAACAACTTGAAGG + Intergenic
1002028435 5:176411454-176411476 GCATTTGAGCAGAAGCTGAAGGG - Intronic
1003827088 6:9964946-9964968 ACATTTTAGCAAAATCTTCAAGG - Intronic
1004903903 6:20218787-20218809 ACATTTAATCAAAGACTGGAAGG + Intergenic
1006713713 6:36099452-36099474 TCATTTAACAAACAGCTGGAGGG - Intronic
1006835474 6:36996348-36996370 ACATTTAAGCAAAGATTTGAAGG + Intergenic
1007153334 6:39717451-39717473 ACATTTGAGCAAAGACTTGATGG - Intronic
1008523007 6:52380233-52380255 AGATTTGAGCAAAGACTGGAAGG + Intronic
1009313542 6:62188686-62188708 ACATTTAAGAAATTGCTAGAAGG + Intronic
1009907033 6:69883056-69883078 ACATTTAAGCAGAGGCATGAAGG + Intronic
1010417438 6:75629120-75629142 ATATTTATCCAAAATCTGGAAGG - Intronic
1010609972 6:77942625-77942647 ACATTTAAGGAAGAACTGGAGGG + Intergenic
1010798683 6:80148238-80148260 ACTTTTAAGCAAAAGGTGAGTGG - Intronic
1012416214 6:99016825-99016847 ACATTTGAGCAAAGACTTGAAGG - Intergenic
1012814516 6:104005208-104005230 TCATTTAAGCAAAATATGCAAGG + Intergenic
1013727699 6:113120006-113120028 TAATTTAAGCAATAGATGGAAGG - Intergenic
1014236417 6:118961190-118961212 ACATTTAATCAACAACTGCAAGG + Intronic
1015479862 6:133696830-133696852 AAATTTCAGCAAAAGTTTGAGGG - Intergenic
1015713546 6:136167100-136167122 AGATTTGAGCAAAAGCTTGAAGG - Intronic
1015810762 6:137159810-137159832 ACATTTGAGCAAAGACTTGAAGG - Intronic
1015891317 6:137972369-137972391 ACATTTAAGCAAAGACTTGAAGG - Intergenic
1015945968 6:138501494-138501516 AGATTTGAGCAAAACCTTGAAGG + Intronic
1016404995 6:143720423-143720445 ACATTGAAGGAAAGGCAGGAAGG + Intronic
1016762321 6:147751171-147751193 ACATTTAAGAAAAAACCTGAAGG - Intergenic
1017756458 6:157533455-157533477 ATATTTGAGCAAAGGCTGGGAGG + Intronic
1018503902 6:164443388-164443410 ATATTTAAGCAAAATGTTGACGG + Intergenic
1022050662 7:26666484-26666506 ACATTTAAGAAACAGTTGAATGG + Intergenic
1022836872 7:34126241-34126263 ATTTTTAAGGAAAAGCAGGAAGG + Intronic
1022846815 7:34218657-34218679 GCATTTTATCAACAGCTGGAGGG + Intergenic
1022909649 7:34888283-34888305 ATATTTAAGCAAAAACCTGAAGG + Intergenic
1022930575 7:35108707-35108729 AAATTTCAGCATAACCTGGAAGG + Intergenic
1023111296 7:36813533-36813555 ACCTTTAAGCAAAAACTTGAAGG - Intergenic
1024155242 7:46615273-46615295 ATAATTCAGCAGAAGCTGGAAGG + Intergenic
1025972707 7:66342898-66342920 ACATTTCAGCATGAGTTGGAGGG + Intronic
1026876058 7:73879738-73879760 TCACTCAAGCAAAAGCTGAAAGG - Intergenic
1029826475 7:103201218-103201240 AAATTTCAGCATAACCTGGAAGG + Intergenic
1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG + Intronic
1030072985 7:105713554-105713576 ACATTAAATAAAAAGCTGCAGGG + Intronic
1030165637 7:106552397-106552419 AAACATAAGCAAAAGCTGAATGG + Intergenic
1030309935 7:108058977-108058999 ATATTTGAGCAGAAGCTGGCAGG - Intronic
1030354039 7:108523589-108523611 ACCTTAAAGCAGAAGCTGAAGGG - Intronic
1030684417 7:112469875-112469897 GCATTGAAGCAGAGGCTGGAGGG - Intronic
1030952590 7:115810187-115810209 ACATTTAACCAAATGCTACATGG + Intergenic
1031124942 7:117762985-117763007 ACATTGAAGCCAAGGCTTGAAGG - Intronic
1031312422 7:120215432-120215454 TCATTTAAGCAAAGGCTGAAGGG + Intergenic
1031363291 7:120872825-120872847 AGATTTAAGAAAAGGCTGTAAGG - Intergenic
1031982656 7:128137565-128137587 TCATTTGAGCAGAAACTGGAAGG - Intergenic
1032787792 7:135214284-135214306 ACATTTGAGCAAATGCGTGAAGG - Intergenic
1034288496 7:149907750-149907772 ACATTAAAGCAAAAGGTGCAAGG + Intergenic
1034662576 7:152785117-152785139 ACATTAAAGCAAAAGGTGCAAGG - Intronic
1035181473 7:157092439-157092461 AAAAAGAAGCAAAAGCTGGAAGG + Intergenic
1035975482 8:4305855-4305877 ACACGTAAGCAAAGACTGGAAGG - Intronic
1036860693 8:12346056-12346078 ACATTTTGGCAAAAGATGAAAGG + Intergenic
1037058014 8:14469120-14469142 CCATTGAAGCAAAAAGTGGAGGG - Intronic
1038397306 8:27256849-27256871 GCATTCAAGCAGAAGTTGGATGG - Intronic
1039032147 8:33322169-33322191 ACATTTAGGGAAAAGTTGAAGGG - Intergenic
1039649083 8:39321121-39321143 ACATGGAAGATAAAGCTGGAGGG + Intergenic
1039773184 8:40709457-40709479 GCCTTTAAGAAAAAGATGGAAGG + Intronic
1039908537 8:41805547-41805569 ACATTTAAGAAAAAGCTCTATGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1043553667 8:81404448-81404470 ACATTTAAGCAGAAACCAGAGGG + Intergenic
1043962634 8:86434466-86434488 ACATTTGAGCAAAAACATGAAGG - Intronic
1045396557 8:101766434-101766456 ATATATAAGAAAAATCTGGAAGG - Intronic
1045528913 8:102965479-102965501 ACATTTAAGGAAAAGTGAGAAGG - Intronic
1046109337 8:109702916-109702938 ACATTTAAGGAATAAGTGGATGG - Intergenic
1046925663 8:119785269-119785291 ACATTTAAGAAAAAGTAGGTTGG + Intronic
1047834231 8:128670726-128670748 GCATTTAAGCAGAAGCTATATGG - Intergenic
1048045506 8:130768821-130768843 AAATTTAAGCAAAGACTCGAAGG - Intergenic
1048091049 8:131240575-131240597 ACATTTGAGCAAAGGCTAGTTGG + Intergenic
1048803169 8:138213654-138213676 AGATTTAAGCAAGAGAAGGATGG + Intronic
1049994191 9:1019007-1019029 ACATTTAAGCACAGACTTGAAGG + Intergenic
1050185099 9:2965011-2965033 ACATGTTAGTAAAATCTGGAAGG + Intergenic
1050594929 9:7195610-7195632 ACATTGGAGATAAAGCTGGAAGG + Intergenic
1050731535 9:8714688-8714710 ACATTTAAGCAAAGATTTGAAGG - Intronic
1050754005 9:8977569-8977591 ACATTTAAACAAAACCTCGAGGG - Intronic
1050777263 9:9280826-9280848 ATATTGAAGGAAAAGGTGGAGGG + Intronic
1050829138 9:9989705-9989727 ACATTTAAGCAATCCATGGATGG + Intronic
1051167545 9:14280402-14280424 ACATTTAAGTAAAGGCTTGAAGG - Intronic
1051180047 9:14401893-14401915 TCATATAAGCAAAAGGTGTAGGG - Intergenic
1051426537 9:16937772-16937794 ACATTTAAGAAAGAACTGGCCGG + Intergenic
1051814875 9:21093472-21093494 ACATTTAAGCACATGGTGGGTGG + Intergenic
1051869696 9:21723632-21723654 CCATTTTAGCACAAGTTGGAAGG + Intergenic
1051964907 9:22815979-22816001 ATATCTAAGCAAAATGTGGAAGG + Intergenic
1052953587 9:34233788-34233810 ACATTTGAGCAAAAACTTGAAGG + Intronic
1053337620 9:37289939-37289961 ACATTTAAGCAACAACTTAAAGG - Intronic
1053341717 9:37341732-37341754 ACATTTGAGCCAAGGCTTGAAGG + Intronic
1053816465 9:41917468-41917490 ACATTTAACCAAGAGGTAGAGGG - Intronic
1054106725 9:61061150-61061172 ACATTTAACCAAGAGGTAGAGGG - Intergenic
1054614132 9:67269975-67269997 ACATTTAACCAAGAGGTAGAGGG + Intergenic
1057789256 9:98112428-98112450 AGATTTAAGCAAATTCTAGAAGG + Intronic
1058416584 9:104795162-104795184 ACATTTTAGCTAAATCTTGAAGG + Intronic
1059154752 9:111979807-111979829 GCATTTCAACAAAAGCTGGAAGG - Intergenic
1059446495 9:114341570-114341592 AGATGTAGGCAAAGGCTGGAGGG + Exonic
1059847286 9:118294323-118294345 ACATTTGGGCAAAATCTTGAAGG - Intergenic
1059936396 9:119315613-119315635 ACTTTAAATCAAAAGCTAGAAGG + Intronic
1062507429 9:136885336-136885358 CCATTTCACCAAAGGCTGGATGG + Intronic
1203496618 Un_GL000224v1:157627-157649 ACATTTAGACCAAAGCAGGAGGG + Intergenic
1203509242 Un_KI270741v1:99549-99571 ACATTTAGACCAAAGCAGGAGGG + Intergenic
1186367207 X:8907963-8907985 ATATTTAAGCAAACACTTGAAGG - Intergenic
1186501237 X:10052400-10052422 ACACTTAAGAAAGAACTGGAAGG - Intronic
1186894484 X:13992373-13992395 ACATTTAAGAAAAGGATGCAGGG + Intergenic
1186956710 X:14689933-14689955 ACACTTAAGCAAACACTGAAGGG + Intronic
1186991590 X:15075191-15075213 ACATTTAAGCTGATGATGGAAGG + Intergenic
1188539314 X:31232005-31232027 ACATTGAAGCAAAGACTTGAAGG + Intronic
1190735784 X:53255402-53255424 ACATATAGGAAAAAACTGGAAGG - Intronic
1192191231 X:68992428-68992450 ACATATAAGCAAAGGCTCCAGGG + Intergenic
1192316021 X:70052523-70052545 GCATTTGAGCAAAGGCTTGAAGG + Intergenic
1192334097 X:70203085-70203107 ACATTTGAGCAAAGACTTGAAGG - Intronic
1194298494 X:92156379-92156401 ACATTTAAGCAAAGATTTGAAGG - Intronic
1194624394 X:96212098-96212120 ACATGGAAGGAAAAGCTGGAGGG - Intergenic
1194697641 X:97074576-97074598 CCATTTAAGAAAAAGTTGGCAGG + Intronic
1194931963 X:99900003-99900025 ACCTTTAAGCAGGACCTGGAGGG - Intergenic
1194936198 X:99951875-99951897 ACATTTAAGCTAAAACCTGAAGG + Intergenic
1195461289 X:105128182-105128204 ATATTTCAGCAAAACCTGGCAGG - Intronic
1196549784 X:117010057-117010079 AGACTTAAGCAAAGACTGGAGGG + Intergenic
1196681686 X:118475994-118476016 GCATTTGAGCAAAGGCTGGAAGG + Intergenic
1196921135 X:120586418-120586440 ACATTTGAGCAAAGACTTGAAGG + Intergenic
1197214632 X:123856623-123856645 ACAATTAAGCAAAGACTTGAAGG + Intergenic
1197308247 X:124870533-124870555 ACATTTAAGCAAAAGCTTGATGG + Intronic
1198939456 X:141936946-141936968 AGATTTAAACAAATGATGGAAGG + Intergenic
1199135888 X:144252580-144252602 ACACTTAAACAAAAAATGGAAGG + Intergenic
1200616104 Y:5381340-5381362 ACATTTAAGCAAAGATTTGAAGG - Intronic
1201426614 Y:13858388-13858410 ACATTCAAGCAAAAGCTTGATGG + Intergenic