ID: 1095578458

View in Genome Browser
Species Human (GRCh38)
Location 12:43766409-43766431
Sequence CTGCTTGATGCCCCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 225}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095578449_1095578458 26 Left 1095578449 12:43766360-43766382 CCTCCTACTCCAACCAAATCTGT 0: 1
1: 0
2: 1
3: 15
4: 211
Right 1095578458 12:43766409-43766431 CTGCTTGATGCCCCTTTTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 225
1095578450_1095578458 23 Left 1095578450 12:43766363-43766385 CCTACTCCAACCAAATCTGTCTT 0: 1
1: 0
2: 0
3: 26
4: 243
Right 1095578458 12:43766409-43766431 CTGCTTGATGCCCCTTTTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 225
1095578448_1095578458 30 Left 1095578448 12:43766356-43766378 CCAACCTCCTACTCCAACCAAAT 0: 1
1: 0
2: 2
3: 28
4: 327
Right 1095578458 12:43766409-43766431 CTGCTTGATGCCCCTTTTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 225
1095578454_1095578458 -6 Left 1095578454 12:43766392-43766414 CCTATTCCAGACTGCCTCTGCTT 0: 1
1: 0
2: 1
3: 28
4: 235
Right 1095578458 12:43766409-43766431 CTGCTTGATGCCCCTTTTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 225
1095578451_1095578458 17 Left 1095578451 12:43766369-43766391 CCAACCAAATCTGTCTTGATATC 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1095578458 12:43766409-43766431 CTGCTTGATGCCCCTTTTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 225
1095578452_1095578458 13 Left 1095578452 12:43766373-43766395 CCAAATCTGTCTTGATATCCCTA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1095578458 12:43766409-43766431 CTGCTTGATGCCCCTTTTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 225
1095578453_1095578458 -5 Left 1095578453 12:43766391-43766413 CCCTATTCCAGACTGCCTCTGCT 0: 1
1: 0
2: 4
3: 17
4: 245
Right 1095578458 12:43766409-43766431 CTGCTTGATGCCCCTTTTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095578458 Original CRISPR CTGCTTGATGCCCCTTTTCT GGG Intronic
901893516 1:12288708-12288730 CTGTTGTATGCCCGTTTTCTAGG - Intronic
903877267 1:26483768-26483790 CTGCTGGTTGCCCATTTTTTTGG + Intergenic
904719464 1:32497071-32497093 CTGCTTGCTGCCTGTTTTTTTGG + Intronic
905327846 1:37170502-37170524 CTGCTTTAGGCCCCGTTTCGAGG + Intergenic
905387945 1:37617141-37617163 CTGGTTGAGACCCCTGTTCTAGG - Intronic
907593712 1:55700519-55700541 CAGCTTGATTGCCATTTTCTTGG + Intergenic
911847662 1:102774893-102774915 CTGCTGGTTGCCCCTTTTTATGG + Intergenic
912762751 1:112383536-112383558 GTGCTGGATGCCTCTGTTCTGGG - Intergenic
915147058 1:153801522-153801544 CTGCCTGCTGCCCATTTTCAGGG + Intergenic
916532800 1:165674221-165674243 CTGCTGGTTGCCCCTTTTTGTGG - Intronic
919136525 1:193515391-193515413 CTTCTTGATGCTCCATTTATTGG + Intergenic
919608782 1:199719420-199719442 CTGCTTGATGTACTTATTCTAGG - Intergenic
920613823 1:207469606-207469628 CTGCTTGATACCACTATCCTAGG - Intronic
924214997 1:241811752-241811774 CTGCCTGTTCCCCCTTTCCTAGG + Intergenic
924748465 1:246861160-246861182 TTTCTTGATGCTCCTTTTCAGGG + Exonic
1063410010 10:5830361-5830383 CTTCTTTCTGCCCCTTTCCTTGG + Intronic
1063916581 10:10889003-10889025 CTGGTTGGTGTCCCTTCTCTGGG - Intergenic
1064699852 10:18007604-18007626 CTGCTGGTTGCCCATTTTCATGG + Intronic
1066640543 10:37550591-37550613 CTGCTGGTTGCCCATTTTCATGG - Intergenic
1069811481 10:71163233-71163255 CTGTTTGGTTCCCCTTTGCTGGG - Intergenic
1069867313 10:71511831-71511853 CTGCTTGCGGCCCCTCTCCTGGG + Intronic
1074456905 10:113603335-113603357 CTGCTTGGTGCCCCTGCTCAGGG + Intronic
1077758737 11:5066583-5066605 CTCCTTGATGGCTCCTTTCTTGG + Intergenic
1079256257 11:18834078-18834100 ATGCTTGATTCTCATTTTCTGGG + Intergenic
1081427275 11:42939138-42939160 CTGCTAAATCCCCATTTTCTAGG + Intergenic
1081632055 11:44695904-44695926 CTGCTTGACCCCGCTTTGCTGGG - Intergenic
1083271032 11:61572717-61572739 CTCCTAGCTGCCCCTTCTCTGGG + Intronic
1083589228 11:63883149-63883171 CTGTTTCATGGACCTTTTCTGGG + Intronic
1083909722 11:65699224-65699246 ATCCTTGTTGCCCCTTCTCTTGG - Intergenic
1085506027 11:77059901-77059923 CTGCTTAATGCTCCATTGCTTGG + Intergenic
1085963751 11:81496001-81496023 CTGCTTGTTGCCCATTTTTATGG - Intergenic
1086958770 11:92961013-92961035 ATGCTTGATGCTGATTTTCTTGG - Intergenic
1087203289 11:95367461-95367483 CTTCTTAATGCCCTGTTTCTTGG - Intergenic
1087203688 11:95371937-95371959 CTGCTTGAGCCCACATTTCTTGG - Intergenic
1087430145 11:98043437-98043459 CTGCTTTTTTCCCCTTTTCATGG + Intergenic
1087663519 11:101015195-101015217 CTGCTTGTTGCCCATTTTTATGG - Intergenic
1088746374 11:112808127-112808149 CTGCTCACAGCCCCTTTTCTTGG - Intergenic
1089020448 11:115208794-115208816 CTGCTTGATGTGGCTTGTCTGGG - Intronic
1089105102 11:115996324-115996346 CTGCTTCAAGGGCCTTTTCTCGG - Intergenic
1089784856 11:120900661-120900683 CTGCTCAATGCTCCCTTTCTCGG - Intronic
1090634861 11:128684635-128684657 CTTCTTGATCCACTTTTTCTAGG - Intergenic
1090789967 11:130083555-130083577 CTGCATGATTCCCCTTATATGGG - Intronic
1093703409 12:22248291-22248313 ATGCTTGATTCCTCTTTCCTTGG + Intronic
1093906090 12:24693338-24693360 TTCCTTGATGCCCCGTTTCCTGG - Intergenic
1094011609 12:25815857-25815879 CTTCTTAATGCACCTTTTGTTGG + Intergenic
1095115824 12:38350952-38350974 CAGCTTGATGCCTGTATTCTAGG - Intergenic
1095578458 12:43766409-43766431 CTGCTTGATGCCCCTTTTCTGGG + Intronic
1100152767 12:91760997-91761019 CTGCTAGATGCCAACTTTCTTGG + Intergenic
1100688385 12:97011548-97011570 TTGCTTTCTGACCCTTTTCTTGG - Intergenic
1100889172 12:99104820-99104842 TTGCTTGATGCCCCTGCACTGGG + Intronic
1103758589 12:123231942-123231964 CTGCTAGATTCCCACTTTCTAGG + Intronic
1107105410 13:36637398-36637420 CTGCATTGTGCCCCTTCTCTAGG - Intergenic
1109063330 13:57649786-57649808 GATCTTGATACCCCTTTTCTTGG - Intronic
1112616149 13:101007434-101007456 CTTCTTAATGTCCCTCTTCTGGG + Intergenic
1114764575 14:25356341-25356363 CTGCTGGTTGCCCCTTTTTATGG - Intergenic
1115791960 14:36889932-36889954 ATGCTTTATCTCCCTTTTCTAGG + Intronic
1118006392 14:61567915-61567937 CCGCTTGCTGCCCCTGTGCTGGG + Intronic
1118608340 14:67519651-67519673 CTGCTTGCTTCCCCTTGTCCTGG - Intronic
1121841427 14:97137500-97137522 CTGCTTGATTCCCATTTTAGAGG - Intergenic
1123112648 14:105880426-105880448 CTGCATGATGCCCCTATCTTGGG + Intergenic
1123899260 15:24859741-24859763 CTGCTGGATTCCCATTTTCATGG + Intronic
1127994623 15:64145997-64146019 CTGCCTGTTGCCCCAGTTCTTGG + Intronic
1128720502 15:69944151-69944173 CTGCTTAATGCCACCTCTCTAGG + Intergenic
1129751457 15:78067673-78067695 CTTCTTTCTGCCCCTTTCCTAGG - Intronic
1131635185 15:94225485-94225507 CTGCTGGCTGCCCATGTTCTAGG - Intergenic
1131643484 15:94317157-94317179 CTGCTTGCTGCTCTATTTCTTGG + Intronic
1133426485 16:5694763-5694785 CTGCTTGATTTTCCTTTTTTGGG + Intergenic
1134394406 16:13849954-13849976 CTACTTGATGACCCTCATCTGGG + Intergenic
1139301727 16:65950633-65950655 TTGCTTTATGCCCATTTTCCAGG - Intergenic
1140820405 16:78657736-78657758 CTGCTTGAGGCTCCCTCTCTTGG + Intronic
1141379578 16:83564333-83564355 CTCCTTACTGCCCCTTGTCTGGG - Intronic
1141917575 16:87110290-87110312 CTGCTTGTTGCCCATTTTTATGG + Intronic
1142743944 17:1945809-1945831 CTGCTGGATGCCAGTGTTCTGGG - Intronic
1147316209 17:39621634-39621656 CTGCAAGATGCCCAGTTTCTGGG + Intergenic
1148053673 17:44781184-44781206 CTGCTTGAGCCCCTGTTTCTGGG + Exonic
1149106377 17:52972535-52972557 CTGCTTGTTGCCCATTTTTATGG + Intergenic
1149653522 17:58295022-58295044 GTGCTTGTTGCCCCACTTCTGGG - Intergenic
1149728116 17:58917567-58917589 CAGCTTGATGCCACTACTCTTGG + Intronic
1150872558 17:68929647-68929669 CTTCATTATGGCCCTTTTCTTGG - Exonic
1151277428 17:73046173-73046195 TAGCTTCATGCCTCTTTTCTTGG + Intronic
1151826837 17:76528493-76528515 CTCCTTGACGCTCCATTTCTGGG - Exonic
1155469589 18:26177045-26177067 CTGCCACATGCCCCTTTCCTAGG - Intronic
1156762691 18:40612583-40612605 CTGCCTGATGCTTCTGTTCTTGG + Intergenic
1157017145 18:43729191-43729213 CTTCTTTACGCACCTTTTCTGGG - Intergenic
1157224046 18:45846796-45846818 CTGCTGGTTGCCCTTTTTTTTGG + Intergenic
1157578763 18:48761193-48761215 CTCCTTGTTGCCTTTTTTCTTGG - Intronic
1158560427 18:58508679-58508701 CTGCTGGTTGCCCCTTTTTATGG - Intronic
1161028228 19:2046410-2046432 CTTCTTCTTGCCCCTCTTCTTGG + Exonic
1162209875 19:9082858-9082880 CTGCTGGTTGCCCATTTTCATGG - Intergenic
1162928995 19:13946619-13946641 CTGTTTTATGGCCCTTTTCCAGG + Intronic
1164475222 19:28570431-28570453 CTGCCTGATGCCCCTATCTTGGG - Intergenic
1164900537 19:31917468-31917490 CTGCTTGTTGCCCATTTTTATGG + Intergenic
1165435089 19:35790981-35791003 CTGCCTGCTGCCCCTTGACTCGG - Intergenic
1166574880 19:43827949-43827971 CTCCTAGAGGCCCCTCTTCTAGG - Intronic
1166903177 19:46082544-46082566 CGGCTTGATCCCACTTATCTTGG - Intergenic
925459565 2:4048865-4048887 CTGCTTCTTGCCCCTTATCAGGG + Intergenic
925539710 2:4953305-4953327 CTGCATTATGCCCCTGCTCTAGG - Intergenic
925747928 2:7060191-7060213 CTTCTTTCTGCCCCTTCTCTTGG + Intronic
930047577 2:47186679-47186701 CTGCTTTGTGCCGCCTTTCTGGG + Intergenic
930659687 2:54041302-54041324 CTGCATCATGCCCATATTCTGGG - Intronic
933335152 2:80948715-80948737 CTGATTATTGCTCCTTTTCTGGG - Intergenic
933761929 2:85678567-85678589 GTGCTTCAGGCCCCTCTTCTTGG + Intergenic
934888594 2:98046525-98046547 CTGCTGGTTGCCCATTTTTTTGG - Intergenic
934912231 2:98269668-98269690 CTCCTTCATGCAGCTTTTCTTGG + Intronic
935095499 2:99940668-99940690 CTGCTGGTTGCCCATTTTTTTGG - Intronic
935597044 2:104886998-104887020 CTGCTGGTTGCCCATTTTTTTGG + Intergenic
935598298 2:104896949-104896971 CTGTTGGATGCCCTTTTTCAGGG + Intergenic
936756655 2:115722012-115722034 CTGCATGATTCCCCTTTTATGGG + Intronic
937060864 2:118979544-118979566 CTGGCTGAGGCCCCTTCTCTGGG - Intronic
937319003 2:120949554-120949576 CTCCCTGAAGCCCCTTCTCTTGG - Intronic
938395558 2:130945174-130945196 CTGCTTGAGACCCCTCCTCTTGG + Intronic
939564811 2:143774582-143774604 CTGTTTGATGGCCCTTGTTTAGG - Intergenic
941118726 2:161503809-161503831 TTTCTTGATGCTCCTTTTCAGGG + Intronic
941133720 2:161686837-161686859 CTGCTGGTTGCCCATTTTTTTGG + Intronic
942194341 2:173502782-173502804 CTGCTGGATGCCCATTTTTATGG - Intergenic
944398333 2:199295859-199295881 TTGCTTGATCTCCCATTTCTAGG + Intronic
946642642 2:221801016-221801038 TTGATTTTTGCCCCTTTTCTGGG + Intergenic
946718279 2:222576662-222576684 ATGTTTTATTCCCCTTTTCTGGG - Intronic
946938114 2:224742814-224742836 CTGATTAATGCCTTTTTTCTTGG + Intergenic
947115388 2:226764681-226764703 CTGCTTTAACTCCCTTTTCTAGG - Intronic
947321708 2:228926414-228926436 CTGTTTCAGGCCCCTTTCCTTGG - Intronic
947739943 2:232480458-232480480 CCGCTTGATGCACCAGTTCTGGG + Exonic
1170855715 20:20052236-20052258 CTGAGGGATGCCCCTTTCCTAGG + Intronic
1172585804 20:36083629-36083651 CTGCTTGTTGCCCATTTTTATGG - Intergenic
1172691903 20:36796005-36796027 CTGGTTGAAGCTCCTTTTATCGG + Intronic
1172815475 20:37682707-37682729 CTGCTCGATAACCCTTTTCCTGG - Intergenic
1173261542 20:41440703-41440725 CTTTTTGAGGCCCCTCTTCTGGG - Intronic
1173614612 20:44394650-44394672 CTGCTTGTTCCCCCTGTGCTGGG - Intronic
1175159469 20:56997120-56997142 CAGCTTCATGCCCCACTTCTTGG - Intergenic
1177402523 21:20624023-20624045 CTGCATTATGCCCCTGCTCTAGG - Intergenic
1182521454 22:30886995-30887017 CTGCTTGTTGCCCATTTTTATGG + Intronic
1182917990 22:34053022-34053044 TTGCTTGATTTCCCTTTTCAGGG - Intergenic
1183113776 22:35673812-35673834 CTGCTTGTTGCCCATTTTTATGG - Intergenic
1184903515 22:47463344-47463366 CTGCTTTTTGCTCCTTTTTTGGG + Exonic
1185360277 22:50402537-50402559 CTAGTTGATGCCCCTTCTGTGGG + Intronic
949128369 3:472616-472638 CTGCTTGCTGCCCCTTCATTTGG + Intergenic
949786298 3:7745457-7745479 ATGATAGATGCCCCTTGTCTTGG - Intergenic
950504554 3:13386598-13386620 CTGGGTAATGCCCTTTTTCTGGG - Intronic
951001311 3:17563250-17563272 CTATTTGATGTCGCTTTTCTTGG - Intronic
951391362 3:22107956-22107978 CTGCTTGAAGCCTCTTTATTAGG - Intronic
955454616 3:59105988-59106010 CTGCTGGATGCCCATTTTTATGG - Intergenic
955954822 3:64278016-64278038 AATCTTGATGCCTCTTTTCTTGG + Intronic
956340471 3:68217496-68217518 CTGTTTTATTCCCCTGTTCTAGG - Intronic
956553710 3:70493072-70493094 ATGCTTAATGCTGCTTTTCTAGG + Intergenic
956858059 3:73295146-73295168 GTGCTTGATGAGCGTTTTCTTGG - Intergenic
958441584 3:94162430-94162452 ATGCTTGAGGCAACTTTTCTGGG - Intergenic
959884212 3:111479906-111479928 CTGCTGGCTGCCCATTTTCATGG + Intronic
960514619 3:118590008-118590030 CTGCTGGTTGCCCATTTTCATGG - Intergenic
962258650 3:133888876-133888898 CTGCTTGGAGCCCCATTTCCTGG + Intronic
962344895 3:134611608-134611630 GTGCTTGATGCCCCTTTGATGGG + Intronic
962749784 3:138425363-138425385 CTGCTAGATGCCCATTTTTGTGG + Intergenic
962876955 3:139542398-139542420 CTGGTTTGTGCCCCTCTTCTGGG + Intergenic
964261187 3:154839217-154839239 TTGATTGATGCCCCATTTATTGG - Intergenic
966348134 3:179001320-179001342 CTGCTGGATGGCCCAATTCTAGG - Intergenic
966489370 3:180510073-180510095 CTGCTTGTTGCCCATTTTTGTGG - Intergenic
968475959 4:808617-808639 CTGCCTGATGCCTGTTTTATGGG - Intronic
968611712 4:1560150-1560172 CTTCTTGATCCTCCTTTTCTAGG + Intergenic
969542916 4:7804855-7804877 CTTCTTGATGCCCCTCTTGCAGG - Intronic
969614319 4:8243468-8243490 CTGCTGGTTGCCCATTTTCATGG - Intergenic
973958908 4:56090288-56090310 CTGCCTGGCACCCCTTTTCTAGG + Intergenic
974077561 4:57181337-57181359 CTGCTTGATCTACCTTCTCTGGG + Intergenic
977673841 4:99726288-99726310 CTGCTTGTTGCCCATTTTTATGG + Intergenic
977674743 4:99734534-99734556 CTGCTTGTTGCCCATTTTTATGG + Intergenic
978324630 4:107538422-107538444 CTGCTTGAAGTGCCTTTTATAGG + Intergenic
980087138 4:128403359-128403381 GTGATTGTTGCCTCTTTTCTGGG + Intergenic
980344739 4:131598829-131598851 CTGCTTAATTTCCCTTTACTAGG + Intergenic
981341196 4:143623534-143623556 CTGCTTGCTGCCCCTTTTTTTGG - Intronic
982265806 4:153537449-153537471 CTGCTGGTTGCCCATTTTCATGG + Intronic
983861871 4:172717389-172717411 CCACTTGATGCCCATTCTCTGGG - Intronic
984636228 4:182112601-182112623 CTACTTAATGCAGCTTTTCTAGG + Intergenic
984860758 4:184235870-184235892 GAGCTTGATGCCCCCTTTGTGGG - Intergenic
985570116 5:640170-640192 CCCCTGGTTGCCCCTTTTCTTGG + Intronic
986140174 5:5022283-5022305 CTTCAAGATTCCCCTTTTCTGGG - Intergenic
989207674 5:38827704-38827726 CTGCTTTATGCCTTCTTTCTAGG - Intergenic
991604030 5:68382390-68382412 CTTCTTGAGGCCTCTCTTCTGGG + Intergenic
992946586 5:81817341-81817363 GTGCTTGATTGCCCTTTTCTTGG - Intergenic
998682908 5:144490071-144490093 CTACTTTATGCCTCTTTTATAGG - Intergenic
999302318 5:150498854-150498876 CTGCTTCATGCCTCCTTTTTGGG + Intronic
1000676831 5:164131886-164131908 CTGCATTGTGCCCCTGTTCTGGG + Intergenic
1001853184 5:174987274-174987296 CTCTCTGATCCCCCTTTTCTTGG - Intergenic
1001958357 5:175863873-175863895 CTTCTTTTTACCCCTTTTCTTGG - Intronic
1002512530 5:179732503-179732525 CTGCCAGATTCCCCTTTTCTCGG + Intergenic
1005690285 6:28298241-28298263 CTGCTTGATTACCCTTCCCTGGG + Intronic
1005830501 6:29667368-29667390 CTGCTCTTCGCCCCTTTTCTTGG - Intronic
1006143775 6:31946248-31946270 CTGCCTGATGCCCTTTATCTTGG + Exonic
1006736124 6:36273874-36273896 CTGCTTGATGTCCTTTTTACAGG - Intronic
1007095595 6:39210833-39210855 CTGCTTCATGCTCCATTGCTTGG - Intronic
1011043625 6:83058144-83058166 CTGCTTGCTGCTGTTTTTCTGGG - Intronic
1011798354 6:90982484-90982506 CTGTTTGCTGCCCATTTCCTGGG + Intergenic
1014723841 6:124952211-124952233 ATGCTTTATGTGCCTTTTCTTGG - Intergenic
1018078480 6:160238035-160238057 CTGCTTGTTGCCCATTTTTATGG - Intronic
1018357255 6:163030669-163030691 CTGCTTGTTGCCCATTTTTATGG + Intronic
1018435864 6:163758420-163758442 CTGCTGGATGCCCATTTTTATGG - Intergenic
1019209117 6:170390769-170390791 CTGCTTGGTGTTCTTTTTCTGGG + Intronic
1022469268 7:30672158-30672180 CTAATTCATGCCCCTTTTCAAGG + Intronic
1024223787 7:47309143-47309165 CTGCCTGATGCCCATTGGCTTGG + Intronic
1024589641 7:50870237-50870259 CTGTTTGCTGTCCCTGTTCTAGG - Intergenic
1026126580 7:67584874-67584896 CTGCTGGTTGCCCATTTTCATGG - Intergenic
1026240266 7:68567765-68567787 CAGCTTCATGCCCCCTTTCTAGG + Intergenic
1026276001 7:68877119-68877141 CTGCTTTATACCCTTTTTCCTGG - Intergenic
1028176030 7:87659265-87659287 CTGTTTGTTCCCCCTGTTCTTGG + Intronic
1033289516 7:140071440-140071462 CTGCTTTAAGCCCAATTTCTAGG + Intergenic
1034211557 7:149367830-149367852 CTCCTTGAAGCTCCTTTACTAGG + Intergenic
1039686435 8:39807123-39807145 TGGCTTGATGCCCCTTTTCCAGG - Intronic
1040104030 8:43529834-43529856 CTGCTTTGTGCCCATTTTATAGG + Intergenic
1040773955 8:51016061-51016083 CTGCTTGCTGCCCAATTTCCCGG - Intergenic
1042013100 8:64272392-64272414 TTCCTTGATGTCGCTTTTCTTGG - Intergenic
1043427213 8:80159371-80159393 CTGCTTGGTGCTCCTTTCCATGG + Intronic
1043816813 8:84812253-84812275 CTGATTGTTGTCCCTCTTCTGGG + Intronic
1044426256 8:92054344-92054366 ATGCTTGATGCACATTGTCTAGG - Intronic
1044492265 8:92833521-92833543 CTCATTGTTGCCCCTTTTCCTGG - Intergenic
1044554247 8:93544834-93544856 CTTCTTCATGCCTTTTTTCTAGG - Intergenic
1048312354 8:133335315-133335337 CTGCATGGTGCCCCTGCTCTAGG - Intergenic
1048786677 8:138057940-138057962 CTGCTTTATGTTCCTTTTATAGG + Intergenic
1049501013 8:142966004-142966026 CTGCTGGCTGCCCATTTTCATGG - Intergenic
1052004463 9:23329791-23329813 CTGCATTATGCCCCTGCTCTAGG + Intergenic
1053458878 9:38253099-38253121 CTGCTGGATGCCCATTTTTATGG - Intergenic
1054876849 9:70106423-70106445 CTGCTTGAAGTCCCTTCTTTTGG + Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1060036311 9:120258966-120258988 CTGTCTGATGCCCCTGGTCTTGG - Intergenic
1060242145 9:121913086-121913108 CTTCTTGCTTCCCCTTGTCTAGG - Intronic
1060730346 9:126033234-126033256 CTCCTTGATGGCTCTTTTCTTGG + Intergenic
1061645143 9:131995005-131995027 CTGCTTGAAGCCCTACTTCTTGG - Intronic
1061800281 9:133109827-133109849 CTGTGTGCTGGCCCTTTTCTAGG - Intronic
1061843010 9:133370906-133370928 CTGCTTGATGGCGCGGTTCTCGG - Intronic
1062053827 9:134460546-134460568 CTGCTGGACGCCACTTTGCTGGG + Intergenic
1062483634 9:136763662-136763684 GTGCTGGATGCCGCTTCTCTGGG - Intronic
1188962445 X:36508630-36508652 CTGCATTATGCCCCTGTTCCAGG - Intergenic
1189431497 X:40951127-40951149 CTGCATTGTGCCCCTGTTCTAGG - Intergenic
1192437582 X:71152424-71152446 CTGCATCATGCCACCTTTCTGGG - Intronic
1192936909 X:75870057-75870079 CTGCATTGTGCCCCTTCTCTAGG + Intergenic
1194865592 X:99062024-99062046 CTGCTTGATGTCCTTTCTCCTGG - Intergenic
1196508454 X:116476897-116476919 CTTCATGAGGCCCCTTTTCCAGG - Intergenic
1198301182 X:135335343-135335365 CTCCTGAATGCCCCTTCTCTGGG + Intronic
1198659148 X:138947980-138948002 CTTTTTGAGGCCCCTTTCCTTGG - Intronic
1200757559 Y:7004396-7004418 CTGGTTGATGCCCATTTTCACGG + Intronic
1202024666 Y:20508117-20508139 CTGCCTGCTGACCCTTGTCTTGG - Intergenic