ID: 1095587382

View in Genome Browser
Species Human (GRCh38)
Location 12:43863930-43863952
Sequence TCTAGCTGGCCCGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 13, 2: 14, 3: 14, 4: 57}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095587382_1095587393 15 Left 1095587382 12:43863930-43863952 CCGGCGCTTGCGGGCCAGCTAGA 0: 1
1: 13
2: 14
3: 14
4: 57
Right 1095587393 12:43863968-43863990 GGGCTTGGCGGCCCCACACTCGG 0: 7
1: 43
2: 83
3: 102
4: 192
1095587382_1095587392 3 Left 1095587382 12:43863930-43863952 CCGGCGCTTGCGGGCCAGCTAGA 0: 1
1: 13
2: 14
3: 14
4: 57
Right 1095587392 12:43863956-43863978 CCGGGTGGGCATGGGCTTGGCGG 0: 57
1: 514
2: 500
3: 384
4: 588
1095587382_1095587394 24 Left 1095587382 12:43863930-43863952 CCGGCGCTTGCGGGCCAGCTAGA 0: 1
1: 13
2: 14
3: 14
4: 57
Right 1095587394 12:43863977-43863999 GGCCCCACACTCGGAGCTGCCGG 0: 1
1: 61
2: 377
3: 487
4: 521
1095587382_1095587389 -5 Left 1095587382 12:43863930-43863952 CCGGCGCTTGCGGGCCAGCTAGA 0: 1
1: 13
2: 14
3: 14
4: 57
Right 1095587389 12:43863948-43863970 CTAGAGTTCCGGGTGGGCATGGG 0: 7
1: 93
2: 590
3: 609
4: 491
1095587382_1095587388 -6 Left 1095587382 12:43863930-43863952 CCGGCGCTTGCGGGCCAGCTAGA 0: 1
1: 13
2: 14
3: 14
4: 57
Right 1095587388 12:43863947-43863969 GCTAGAGTTCCGGGTGGGCATGG 0: 7
1: 104
2: 621
3: 625
4: 591
1095587382_1095587390 0 Left 1095587382 12:43863930-43863952 CCGGCGCTTGCGGGCCAGCTAGA 0: 1
1: 13
2: 14
3: 14
4: 57
Right 1095587390 12:43863953-43863975 GTTCCGGGTGGGCATGGGCTTGG 0: 72
1: 732
2: 627
3: 324
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095587382 Original CRISPR TCTAGCTGGCCCGCAAGCGC CGG (reversed) Intronic
904315572 1:29658081-29658103 TCTAGCTGACCCACAAGTCCAGG - Intergenic
910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG + Intergenic
912831328 1:112956351-112956373 TCTAGCTCGCCCGCGCGCGCCGG + Intronic
914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
922170679 1:223151824-223151846 TCTAGCAGGCTCTCAAGCTCAGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1067183151 10:44005611-44005633 TCTCGCTGACCCGCATGCCCCGG + Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG + Intergenic
1073472633 10:103732550-103732572 ACTGGCTGGCCAGCAAGGGCAGG + Intronic
1077764561 11:5144445-5144467 TCGCGCTGGTCAGCAAGCGCTGG - Intergenic
1083886600 11:65576240-65576262 TCCCGCTGGCCCGCCACCGCTGG - Exonic
1084401198 11:68944397-68944419 TCTACATGTCCCGTAAGCGCAGG - Intergenic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1090657169 11:128854928-128854950 TCTAGCTGGAGCGCACGTGCAGG + Intronic
1093381535 12:18500177-18500199 TCCAGCCGGCCGGCAAGCACTGG - Intronic
1095234333 12:39778365-39778387 TACAGCTGGCCCCCAAGAGCTGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1105467602 13:20660648-20660670 TCTAAATGGCCAGCAAGTGCTGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1120163561 14:81170414-81170436 TGTGGCTGGTGCGCAAGCGCGGG + Intergenic
1125320348 15:38480482-38480504 TCTACCTGACCCCCAAGCACAGG - Intronic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1131912560 15:97224278-97224300 TCGCGCTGGCCCGCCAGCGCCGG - Intergenic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1139664486 16:68446988-68447010 TCTAGCGGGCCCGCGCGAGCCGG - Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1152303391 17:79508171-79508193 TCTAGAAGGCCAGCGAGCGCAGG - Intronic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1160904191 19:1444919-1444941 GGCAGCTGACCCGCAAGCGCCGG - Intergenic
1162490946 19:10991289-10991311 TCGAGCAGGAGCGCAAGCGCCGG + Exonic
1162584781 19:11552087-11552109 TTGAGCTGGCCCGGAAGCCCTGG - Intronic
1163496572 19:17649404-17649426 CCTAGCTGGCCCCCAACCCCAGG + Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
930104919 2:47632134-47632156 TCAAGCAGGCCTGCAAGGGCGGG + Intergenic
933465147 2:82641933-82641955 TCTAGCTGGCCAGCAGCAGCAGG + Intergenic
940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG + Intronic
941178861 2:162234890-162234912 TCTAGCTGGCCGGCAAGCGTGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
944229198 2:197376269-197376291 TCTAGGTGACCCGCAGGCCCGGG + Intergenic
944909055 2:204291373-204291395 TCTACCTGGCCAGTAAGAGCTGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1169204754 20:3733264-3733286 TCAAGCTGGCCCGGAAGACCAGG - Intronic
1177318696 21:19493628-19493650 TCGCGCTGGCCGGCAAGCGCCGG - Intergenic
1178584030 21:33858134-33858156 TGTAGCGGGCCTGCAAGTGCTGG + Intronic
1180868752 22:19134372-19134394 TGTAGCTGGCCCGCAGGGCCCGG + Exonic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG + Intronic
957074055 3:75587830-75587852 TCCAGCTGGCAGGGAAGCGCCGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960868602 3:122227440-122227462 GCTGGCTGGCCCGCAAGCCCCGG - Intronic
961465054 3:127076504-127076526 GCTGGCTGGCCCACAAGCCCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964037510 3:152217334-152217356 TCCAGTTGGCCTGCAAGTGCAGG - Intergenic
970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG + Intergenic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995112385 5:108442301-108442323 GCCAGCCGGCCCGCAAGCCCCGG - Intergenic
997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG + Intronic
1000889327 5:166784760-166784782 GCTGGCAGGCCCGCAAGCCCAGG - Intergenic
1001524427 5:172418581-172418603 TGTTGCAGGCCCGCAAGGGCTGG + Intronic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG + Intergenic
1010569905 6:77463872-77463894 TCTCGCTGGCCTGCAAGCTTTGG - Intergenic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1019102514 6:169642654-169642676 TCTAGCAGGCCCCCAAGGGCAGG - Intronic
1020418244 7:7969560-7969582 GCTGGCTGCCCCGCAAGAGCTGG - Exonic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035822130 8:2604619-2604641 TCTTGCTGCCCCGCAAACTCAGG + Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1043705726 8:83347571-83347593 GCTAGCTGGCCTCCAAGCCCTGG + Intergenic
1044853550 8:96452364-96452386 TCTTGCTGGCCAGCAAGCGCCGG - Intergenic
1044895126 8:96883605-96883627 TCTAGCTGGCCTGGAACCGCAGG + Intronic
1045352251 8:101352601-101352623 TCTAGCAAGCCGGCAAGAGCTGG - Intergenic
1046181486 8:110655311-110655333 TCTGGGTGGCCAGCAAGTGCAGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1053015314 9:34658572-34658594 TCCAGCTGGCTCGCAGGCGTCGG - Exonic
1059334852 9:113562661-113562683 TCTAGGTGGCCCACAGGCCCAGG - Intronic
1062425082 9:136502373-136502395 TGCTGCTGTCCCGCAAGCGCCGG - Exonic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG + Intergenic
1201468312 Y:14309318-14309340 TCATGCTGGCCTGCAAGCACCGG - Intergenic
1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202293334 Y:23334590-23334612 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202445100 Y:24950249-24950271 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic