ID: 1095587804

View in Genome Browser
Species Human (GRCh38)
Location 12:43867426-43867448
Sequence AAGAGTATACAGATGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095587799_1095587804 8 Left 1095587799 12:43867395-43867417 CCAAAAGAAGGCAGGAAAAGAGG 0: 1
1: 22
2: 99
3: 276
4: 890
Right 1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG 0: 1
1: 0
2: 1
3: 14
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095587804 Original CRISPR AAGAGTATACAGATGGGACA AGG Intronic
903087780 1:20878700-20878722 AAGAGAAAACAGATGATACATGG + Intronic
903476354 1:23621617-23621639 AAGACTATGCAACTGGGACAAGG - Intronic
904441076 1:30531588-30531610 AACAGTGTTCAGATGGGAAAAGG - Intergenic
905495078 1:38378478-38378500 AAGAGTATACAGGCAGGGCACGG + Intergenic
909508970 1:76429267-76429289 TAGATCATACAGATAGGACATGG - Intronic
914998829 1:152568621-152568643 AACAGTATACAGAAGGGGGAGGG - Intronic
915661170 1:157406668-157406690 AACAGTATGCAGACAGGACATGG + Intergenic
915947746 1:160166487-160166509 GAGAGAATACACATGGGAGATGG - Intronic
916495280 1:165340818-165340840 AAGATGATCCAGAAGGGACAAGG - Intronic
918689015 1:187457099-187457121 ATGAATATACATATGGTACAAGG - Intergenic
920972845 1:210757328-210757350 AGGAGTACACAGAAGGGACTGGG + Intronic
921137386 1:212273713-212273735 ATCAGTATACAGATAGGAGATGG - Intergenic
922094567 1:222432019-222432041 AGGAGTCTTCAGATGGGGCAGGG - Intergenic
923329940 1:232913819-232913841 AAGAGTCTACAGGTGTGACTGGG - Intergenic
1063055902 10:2503909-2503931 AACAGTACACAGGTGAGACATGG + Intergenic
1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG + Intronic
1067237781 10:44466213-44466235 GAGAGGATACAGAGGGGACCCGG - Intergenic
1069351552 10:67532702-67532724 AGGAGAAGAAAGATGGGACAGGG + Intronic
1069802134 10:71088357-71088379 AACAGTGTGCAGAGGGGACACGG + Intergenic
1070448960 10:76538227-76538249 AAGGGGATATGGATGGGACAGGG - Intronic
1070992460 10:80744483-80744505 AAGAGAACACAGAAGGGAAATGG + Intergenic
1072694192 10:97590851-97590873 AAGAGAAGACAGATGGGAGCAGG + Exonic
1073390033 10:103167311-103167333 AATAGTATACATATGGGACTGGG - Intronic
1074180260 10:111055952-111055974 AAGAAAATACAGGTAGGACATGG - Intergenic
1076272063 10:129162410-129162432 AAGATTATACAGATGGGTAAAGG - Intergenic
1078633639 11:13029196-13029218 AAGAATGGACAAATGGGACAAGG - Intergenic
1080317656 11:30968249-30968271 AAGAGTCAACAGAGAGGACATGG + Intronic
1083792793 11:64996763-64996785 CAGAGTATAGAGCTGGGACTAGG + Intronic
1086264140 11:84977901-84977923 AAGAGTATTCAAATGGGTCTTGG - Intronic
1087248129 11:95864262-95864284 AAGAGTATACAGGAGGGAAAAGG + Intronic
1087468039 11:98535219-98535241 AAGAGGATAAATATGGAACAGGG + Intergenic
1087999656 11:104861638-104861660 AAAAGCATACAAATTGGACAAGG + Intergenic
1088074939 11:105836481-105836503 AAGAATATACAGAGGGCAGATGG - Intronic
1088584227 11:111346609-111346631 AAAAGTACACAGGTGAGACAAGG + Intergenic
1090317870 11:125812070-125812092 AAGAGTATACACTGGGGAAAAGG - Intergenic
1090521317 11:127482624-127482646 AAGAGTACACAGATGGAAAGAGG - Intergenic
1091055391 11:132413451-132413473 ATGAGTATAGAGATGGAAAAAGG + Intergenic
1092083819 12:5739354-5739376 AAGAGGCTACAGATGCGACTGGG - Exonic
1093094066 12:14952672-14952694 AAGACTAATCAGATGAGACAGGG + Intronic
1095238752 12:39832015-39832037 AAGAGTTTACAGGAGGGAGAAGG - Intronic
1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG + Intronic
1097381974 12:58906107-58906129 CAGAGTATAAGGATGGGATATGG + Intronic
1100574955 12:95882427-95882449 AACAGCTTACAGATGGGATAAGG + Intronic
1102883448 12:116503930-116503952 AAAAGTATACAGGTGGGGCTGGG - Intergenic
1102947109 12:116999560-116999582 AAGAGTATAAAGGTGGGGAAAGG - Intronic
1103812928 12:123630296-123630318 AAGAGCAAACTGAGGGGACAGGG + Intronic
1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG + Intronic
1104578241 12:129988230-129988252 AAGAGCAAAGAGATGTGACAAGG - Intergenic
1105562129 13:21502606-21502628 AAGAGTATAAAAATGTGAAAGGG - Intronic
1107045011 13:35984705-35984727 AGGGGAATACAGATGGGAAAAGG - Intronic
1107211368 13:37859112-37859134 ATCAGTTTACAGATAGGACATGG + Intronic
1110637790 13:77786663-77786685 AAAAGTATACAGTTGGGACAGGG - Intergenic
1111141438 13:84124814-84124836 AAGAGTATATAGGTCGGGCATGG - Intergenic
1112619773 13:101042914-101042936 AAGAGTATTCAGATAGGAAGAGG - Intergenic
1113047947 13:106176105-106176127 AATAGTATACACATTGGACTTGG + Intergenic
1114743155 14:25118993-25119015 AAGAGTATACACATGTGAAGAGG - Intergenic
1114758928 14:25290109-25290131 AAGATTATACAGCTAGTACAGGG + Intergenic
1115136604 14:30116842-30116864 AAGAGCAAACAGAGGGGACAAGG + Intronic
1115446154 14:33492615-33492637 AATAGGATACACATTGGACATGG + Intronic
1115891263 14:38031572-38031594 AAGAATATAAAGTTAGGACATGG - Intronic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1118105878 14:62658851-62658873 AAAAGTTGACAGATGGGACTTGG + Intergenic
1120511995 14:85426536-85426558 AGGATTATACAGGTGGGACTGGG - Intergenic
1121214855 14:92239906-92239928 AAGAGTCTAGAGCTGGAACAGGG - Intergenic
1126432207 15:48598156-48598178 AAGAGTAAACACATGGGCTATGG + Intronic
1126935127 15:53698223-53698245 AAGGGTATCCCGATGGGAAAAGG + Intronic
1127280590 15:57487868-57487890 TCGAGTATACAGAGGGTACAAGG + Intronic
1128729779 15:70013507-70013529 AAGATTTTACAGATGAGAGAGGG + Intergenic
1129802928 15:78430114-78430136 AAGAATATCCTGATGGGACTGGG + Intergenic
1130420125 15:83737254-83737276 AGGAGTAGAAAGATGAGACAAGG + Intronic
1130751833 15:86720685-86720707 GTGAGTATACCGATGGGCCATGG + Intronic
1131481717 15:92787917-92787939 ATGAGAACAGAGATGGGACAGGG + Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133882346 16:9794741-9794763 AAAAGCATCCAGATGGGCCAGGG - Intronic
1133970149 16:10561545-10561567 AAGACTAGAAAAATGGGACAAGG + Intronic
1134124279 16:11605584-11605606 AAAAGAATTGAGATGGGACAAGG + Intronic
1138568822 16:57854330-57854352 AAAAGTATAAAGATGGGGCCAGG + Intronic
1138764506 16:59585675-59585697 AAGAAAATACAGGTGGGACGTGG + Intergenic
1139255481 16:65537538-65537560 AATAGGTTACAGATGGGGCATGG + Intergenic
1139758540 16:69165366-69165388 AACAGTATACAGATTGGAGCCGG + Exonic
1139959817 16:70711054-70711076 ATGAGGACACTGATGGGACAGGG - Intronic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1141742361 16:85902304-85902326 AAGAGAATTCAGATGCTACACGG - Intronic
1142899342 17:3002669-3002691 AAGAGTATAAAGGAGGGACAGGG + Intronic
1143733111 17:8892426-8892448 AAGAGCTTACAGTTGGGAGATGG - Intronic
1145754179 17:27378825-27378847 CAGAGTTTACAGATGGGATCTGG + Intergenic
1147780657 17:42939069-42939091 AAGAGCATACAAATGGTACATGG - Intergenic
1149373435 17:56019671-56019693 ATGAGTACACTTATGGGACAAGG - Intergenic
1149450120 17:56743548-56743570 GACAGTATATGGATGGGACACGG + Intergenic
1150028743 17:61708349-61708371 AAGAGTATACAGCATGGACATGG - Intronic
1150310224 17:64122225-64122247 CAGAGCAGACAGATGGGAAAAGG - Intronic
1154316099 18:13304381-13304403 AAGAGTGCAGAGATGGGAGATGG + Intronic
1156934717 18:42689782-42689804 AACAGTATACAGATGGACCCTGG - Intergenic
1157497919 18:48169709-48169731 AAGAGAAAACAGATGTGAAATGG - Intronic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1158753828 18:60298752-60298774 AAGAATAGAGAGATGGGAAAAGG + Intergenic
1158795531 18:60841257-60841279 AACAGTATATAAATGGGACTTGG - Intergenic
1159701041 18:71627607-71627629 AAAAGTATCCAGATTGGAAATGG + Intergenic
1165653082 19:37508086-37508108 AAGAGTTTTCAGATGGGCCTTGG - Intronic
1167634918 19:50648891-50648913 GAGAGGATAGAGATGGGGCAAGG + Intronic
925893249 2:8452824-8452846 AAGATTCTAGAGATGGGAGAAGG - Intergenic
926000130 2:9323937-9323959 ACGTGTATACAAATGGCACATGG + Intronic
930033698 2:47072872-47072894 AAGAGGATGTAGAGGGGACAAGG + Intronic
930575488 2:53141942-53141964 ACAAGTTTAGAGATGGGACAGGG - Intergenic
931433871 2:62230959-62230981 AAGTGTACACAGATGGGCAAAGG - Intergenic
932067186 2:68577293-68577315 ATGAGAATACACATGGCACAGGG - Intronic
932344636 2:70987611-70987633 AAGAGTGCACAGACGGGCCAGGG + Exonic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933195035 2:79379484-79379506 AAGTGTATACAGGTGAGAAAGGG - Intronic
933349094 2:81129947-81129969 AACAGCATAAAGATGGGAGAGGG - Intergenic
936118601 2:109722416-109722438 AACAGTACAGAGATGGGAGAGGG - Intergenic
936592425 2:113816809-113816831 AAAAGTGTACAGCTGGGACAAGG + Intergenic
937524329 2:122748539-122748561 AAGAGTAAACAGAGAGAACAAGG - Intergenic
938670985 2:133586624-133586646 AAGAGAAGACAAATTGGACATGG - Intergenic
939846281 2:147250088-147250110 AAGAGCATACAACTGGTACATGG + Intergenic
941704229 2:168640915-168640937 AAGAGAATACAGACAAGACATGG - Intronic
944308771 2:198208456-198208478 GAGTGTTTACAGATGGTACATGG + Intronic
944832324 2:203545384-203545406 AAGATTGGACAGATTGGACAAGG + Intergenic
1169050745 20:2575906-2575928 AAAAGAATACAGATGAGATATGG - Intronic
1169662286 20:7993203-7993225 AAGATTATAAAGATGGAAGAAGG - Intronic
1170072863 20:12387732-12387754 GAGCGTAGACAGATGGGCCAAGG + Intergenic
1172299640 20:33840041-33840063 AAGAGTATACAGTTATGGCATGG - Intronic
1172566633 20:35935667-35935689 ATGAGGATTCAGAAGGGACAAGG - Intronic
1173472160 20:43332518-43332540 AAAAGTCTACAGTTGGGAGAAGG + Intergenic
1173742149 20:45408396-45408418 AAGAGAAGACAGAGGGGACCTGG - Exonic
1174114135 20:48215332-48215354 GAGTGTGTACAGGTGGGACAGGG - Intergenic
1175618760 20:60425224-60425246 AAGAGTAAAGATTTGGGACATGG - Intergenic
1183153653 22:36057271-36057293 AAGTGTATACTGAAGGGAAAGGG + Intergenic
1183566047 22:38616094-38616116 AAGAGTAGACTGACAGGACAGGG + Intronic
949093355 3:56103-56125 AAGAGTAAACAGGGAGGACATGG + Intergenic
950841338 3:15970768-15970790 CAGAGTGTCCAAATGGGACATGG - Intergenic
951052861 3:18114114-18114136 AAGGGTAGTGAGATGGGACAGGG - Intronic
951192278 3:19785001-19785023 AAAAGTATAGAGTTGGGAAATGG + Intergenic
953015271 3:39069129-39069151 AAAATTAGCCAGATGGGACAAGG - Intronic
954832302 3:53432426-53432448 TACAGTATACAGCAGGGACAGGG - Intergenic
955707686 3:61745598-61745620 AAGAGGTAACAGAAGGGACAGGG - Intronic
956285069 3:67599648-67599670 CAGAGGAAACAGATGGGACGTGG - Intronic
956481360 3:69677004-69677026 AAGATTATACAGCTGGTGCAGGG - Intergenic
957482398 3:80815781-80815803 AAGAACATACAGTTGGGCCATGG + Intergenic
958878300 3:99640324-99640346 AAGAGTACAGGTATGGGACAAGG + Intronic
959413628 3:106057474-106057496 AACAGCCTACAGATGTGACATGG + Intergenic
963265106 3:143232163-143232185 AAGACAATACAGCAGGGACATGG - Intergenic
965028497 3:163333116-163333138 AAGAGTATAGAGAGGAAACATGG + Intergenic
969325945 4:6443942-6443964 AAGAGGCTACACATGGGCCAGGG - Intronic
969471038 4:7389462-7389484 ACGAGTACACAGATGGGGCGGGG + Intronic
970024827 4:11612054-11612076 AAGAGAGTACATATGGGAAATGG - Intergenic
970673851 4:18425922-18425944 ATAAGTATACAGATTGTACAGGG - Intergenic
971267506 4:25108333-25108355 AAGAGTCAACAGATGGTTCATGG - Intergenic
972904972 4:43734565-43734587 AAGAGTATACAAATTGAAAAGGG + Intergenic
973014069 4:45114181-45114203 CAGAGTAGAGAGATGGGTCATGG - Intergenic
974771606 4:66421949-66421971 AATAGAATAAAGATGGGAGAGGG - Intergenic
974800485 4:66811718-66811740 AAGATTATACAGATAGGGCCGGG + Intergenic
977310831 4:95384958-95384980 GAGAATGTACAGATAGGACAGGG + Intronic
977609421 4:99016935-99016957 AAGAAAATACAGAAGGGAGATGG - Intronic
978311008 4:107385004-107385026 AAGAGAATGCAGAAGGGAAATGG + Intergenic
979423045 4:120530225-120530247 AAGAGTAAACATAGAGGACAAGG - Intergenic
981450152 4:144887560-144887582 AAAAGTATAGAAATGGGACTAGG - Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
983827271 4:172278949-172278971 AAGAGTATTCAGTGGGGAAAAGG + Intronic
984661412 4:182379388-182379410 AAGAGCATAAAAATGGGGCAGGG + Intronic
987514043 5:18882865-18882887 AAGTGTAGAAAGATGAGACAAGG + Intergenic
988494762 5:31735477-31735499 CAGAGTTTACAAATGGGTCATGG - Intronic
989136767 5:38163574-38163596 AAGAAAATACAGAAGGGAGAGGG - Intergenic
989260203 5:39411010-39411032 CAGAGTAAGCAGATGGGATAAGG + Intronic
990583750 5:57190074-57190096 AACAGTAAACAAATGAGACAAGG - Intronic
991185242 5:63799151-63799173 AAGATCATACAGTTGGGATATGG - Intergenic
993180342 5:84544473-84544495 AAGTGTATATATATGGGAGAAGG - Intergenic
993448070 5:88039445-88039467 AAGAGCATCCAGATTGGAAAAGG - Intergenic
996196525 5:120613126-120613148 ATGAGTTTACACATGGAACATGG + Intronic
997058519 5:130473359-130473381 AAGAGCATCCAGATTGGAAAAGG - Intergenic
999276486 5:150334059-150334081 AAGGCTATACACATGGGTCATGG - Intronic
1000673730 5:164094290-164094312 AACAGGATACAAATTGGACATGG + Intergenic
1002255288 5:177953862-177953884 AAGAGTAAAAAGATGGGGCCGGG + Intergenic
1002693290 5:181065866-181065888 AAGTGTATACAAATAGCACATGG + Intergenic
1005105982 6:22224610-22224632 AAGAGAATAGAGATGGCACATGG - Intergenic
1005467689 6:26131209-26131231 CAGAGAGTACAGATGGGATAGGG - Intronic
1006833208 6:36981431-36981453 AAGCGTGTACAGAGAGGACATGG - Intronic
1007492345 6:42233214-42233236 TAAAGTATACAGAAGGGAAATGG - Intronic
1008676082 6:53820262-53820284 AAGAGTATACAGCTAGCAAATGG - Intronic
1011622148 6:89253032-89253054 AAGACTGAACAGATGTGACAAGG - Intergenic
1012132114 6:95509472-95509494 AATAGTGTACATATGGGAAAAGG + Intergenic
1014952966 6:127580446-127580468 AAGAGTATAAAGAAGGAACCTGG - Exonic
1015661706 6:135582428-135582450 AAGGATATAAGGATGGGACAAGG + Intergenic
1015890397 6:137964653-137964675 AAGAGGCAACAGATGGGACAGGG - Intergenic
1017427020 6:154332665-154332687 AAGTCTGCACAGATGGGACAGGG - Intronic
1017594936 6:156018147-156018169 AAGAGAATTCAGATGAGACGAGG + Intergenic
1017695063 6:157006299-157006321 AAGAGTAACCTGATGTGACATGG + Intronic
1018441559 6:163818541-163818563 AAGATTTTACAGAGGGGAGAAGG - Intergenic
1020955771 7:14739027-14739049 AAGAGCATACACTTGGGACTTGG - Intronic
1024358528 7:48443845-48443867 AAGAGGATGCAGGTGGGAGAGGG - Intronic
1026765643 7:73157825-73157847 AAAAGTAAACAGGTGGCACAGGG - Intergenic
1026900696 7:74035577-74035599 AAGAGCATACAGGCTGGACATGG + Intronic
1027042117 7:74967518-74967540 AAAAGTAAACAGGTGGCACAGGG - Intronic
1027081525 7:75234836-75234858 AAAAGTAAACAGGTGGCACAGGG + Intergenic
1028480537 7:91299981-91300003 AAGACAATACAGATGGGAGGAGG - Intergenic
1028707036 7:93861547-93861569 AATAGTATATAGTTGGGTCATGG - Intronic
1029221779 7:98995809-98995831 AAGAGTAAGTAGATGGGACGCGG - Intronic
1029390111 7:100269421-100269443 AAAAGTAAACAGGTGGCACAGGG + Intronic
1030139651 7:106291784-106291806 AAGAAAATACAGATGGGAGGTGG - Intergenic
1030468561 7:109934335-109934357 AAAAATATAAAGATGGAACATGG - Intergenic
1033993004 7:147311151-147311173 GAGAGTAAACAGATGGGCCTAGG + Intronic
1034033292 7:147791582-147791604 GAGAGTATAAGGAAGGGACAAGG + Intronic
1034831033 7:154307530-154307552 AAGATAAGCCAGATGGGACAGGG + Intronic
1036571098 8:9980353-9980375 AAGAGTCCACGGATGGGTCAGGG + Intergenic
1038291683 8:26255455-26255477 TAGAGTATAAGGATGTGACAGGG + Intergenic
1040011537 8:42665085-42665107 AAGACTATAAAGATGAGTCAGGG - Intergenic
1040582803 8:48711118-48711140 AAGGATAGACAGCTGGGACATGG - Intronic
1041624991 8:60015318-60015340 AAGAGATTACTGAGGGGACATGG + Intergenic
1042712449 8:71733633-71733655 AGGCGGATACAGATGGGACATGG + Intergenic
1044484557 8:92736144-92736166 AAGAGTAGAGAGATGAGACTTGG - Intergenic
1044865423 8:96566029-96566051 AACATTTTACAGATGGGAAAAGG - Intronic
1045138516 8:99251136-99251158 AAAGGTATACAGATGGGAAATGG - Intronic
1046772853 8:118134192-118134214 AAAATTATACAGATGAGACCCGG - Intergenic
1047059953 8:121214142-121214164 AAGAGTATAAGATTGGGACAAGG + Intergenic
1047077956 8:121425482-121425504 AAATGCATACAGATGGGAAAGGG + Intergenic
1047145749 8:122197410-122197432 AAACATATACAGCTGGGACATGG + Intergenic
1047301295 8:123615560-123615582 AACAGTCTCCAGATGGTACAGGG - Intergenic
1048506833 8:135029419-135029441 AGGAGGATCCACATGGGACAAGG - Intergenic
1049129238 8:140822018-140822040 CAGAGCATGCAGATTGGACATGG + Intronic
1050480680 9:6084288-6084310 AAGAGAACACAGAAGGGAAATGG + Intergenic
1051104819 9:13567225-13567247 AAAAGTACACACATGGGGCAGGG - Intergenic
1051349612 9:16186575-16186597 AAGAGAACACAGTTGGGGCAGGG + Intergenic
1051429505 9:16967491-16967513 AAGAGTATACACCTAGGAAAAGG - Intergenic
1051571080 9:18559974-18559996 AAGGGTATACAAATAGGAAAAGG - Intronic
1051768345 9:20548647-20548669 AAGAGATTACACCTGGGACAGGG - Intronic
1053503951 9:38624288-38624310 AAAGGTATACAGATTGGAAAGGG - Intergenic
1055173014 9:73284076-73284098 AGGACTTGACAGATGGGACAGGG + Intergenic
1055944923 9:81684934-81684956 AAGAGTATTGAGCTGGAACAAGG - Intronic
1056203844 9:84301404-84301426 AAGAGTGTTCAGAAGGGTCATGG + Intronic
1058066374 9:100553062-100553084 AAGAGTACACAGAAGCTACAAGG + Intronic
1058951872 9:109911538-109911560 CTAAGTATACAGCTGGGACATGG - Intronic
1059354504 9:113688197-113688219 AAGAGGAAACAGATCGGAGAGGG - Intergenic
1059610256 9:115884596-115884618 AAGATTATAGAGGTGGAACAGGG + Intergenic
1060546379 9:124463744-124463766 TAGAGTCTACAGATGTGAAAAGG - Intronic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1188837441 X:34976483-34976505 AAGACTTTACAGATGGGAAAGGG - Intergenic
1188852064 X:35144231-35144253 AAGAGTATACAGTTTGTACATGG - Intergenic
1189248625 X:39582474-39582496 GAGAGGATACATGTGGGACAAGG - Intergenic
1191708774 X:64124465-64124487 AAGAATATACATATAGGAAAAGG + Intergenic
1192193545 X:69013741-69013763 CAGACTATATAGATGGGAAATGG + Intergenic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1194090597 X:89579331-89579353 AAGAGTTTATAGAGGGGAAAAGG - Intergenic
1194932890 X:99910063-99910085 CAGACTATAGAGATGGGAGAAGG - Intergenic
1199351029 X:146800756-146800778 AGAAGTTTCCAGATGGGACACGG + Intergenic
1199922863 X:152428157-152428179 GAGATTATACAAATGAGACAGGG - Intronic
1200443250 Y:3235391-3235413 AAGAGTTTATAGAGGGGAAAAGG - Intergenic