ID: 1095593715

View in Genome Browser
Species Human (GRCh38)
Location 12:43935900-43935922
Sequence CTCATGCTGAACCCTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 986
Summary {0: 1, 1: 2, 2: 22, 3: 168, 4: 793}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095593715_1095593718 27 Left 1095593715 12:43935900-43935922 CCAGGCAGAGGGTTCAGCATGAG 0: 1
1: 2
2: 22
3: 168
4: 793
Right 1095593718 12:43935950-43935972 ATGGAAACAGAGTGAAAGGATGG 0: 1
1: 0
2: 7
3: 107
4: 1048
1095593715_1095593719 28 Left 1095593715 12:43935900-43935922 CCAGGCAGAGGGTTCAGCATGAG 0: 1
1: 2
2: 22
3: 168
4: 793
Right 1095593719 12:43935951-43935973 TGGAAACAGAGTGAAAGGATGGG 0: 1
1: 0
2: 6
3: 43
4: 450
1095593715_1095593717 23 Left 1095593715 12:43935900-43935922 CCAGGCAGAGGGTTCAGCATGAG 0: 1
1: 2
2: 22
3: 168
4: 793
Right 1095593717 12:43935946-43935968 GTTCATGGAAACAGAGTGAAAGG 0: 1
1: 1
2: 1
3: 24
4: 314
1095593715_1095593716 8 Left 1095593715 12:43935900-43935922 CCAGGCAGAGGGTTCAGCATGAG 0: 1
1: 2
2: 22
3: 168
4: 793
Right 1095593716 12:43935931-43935953 ATGCAACTGCTTAGTGTTCATGG 0: 1
1: 0
2: 0
3: 8
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095593715 Original CRISPR CTCATGCTGAACCCTCTGCC TGG (reversed) Intronic
900590126 1:3455687-3455709 CTCTTGCTGGACCCCCAGCCAGG - Intronic
900836635 1:5009928-5009950 CTCCTGCTGAACTCCCTTCCTGG + Intergenic
900918736 1:5657457-5657479 CTTCTGCTGAACCCACTGCCTGG - Intergenic
901031128 1:6307612-6307634 CTGTTGCTGTTCCCTCTGCCAGG - Intronic
901252935 1:7795555-7795577 CGCCTGCTGCTCCCTCTGCCTGG - Intronic
901668972 1:10843041-10843063 CCCAGGCTGCTCCCTCTGCCTGG + Intergenic
901751461 1:11412541-11412563 CCCATCCTGATCCCTCTGCCAGG - Intergenic
901787465 1:11634255-11634277 CACGAGCTGAGCCCTCTGCCTGG - Intergenic
901802311 1:11715308-11715330 CCCATGATCCACCCTCTGCCAGG - Intronic
902130065 1:14252505-14252527 CTCATGTTGTTCCCTCTGCCTGG + Intergenic
902155213 1:14479535-14479557 CCTATGCTGTTCCCTCTGCCTGG + Intergenic
902205615 1:14866139-14866161 CACCTGCTGTTCCCTCTGCCTGG + Intronic
902302270 1:15510668-15510690 CTCATGCCGGGGCCTCTGCCTGG - Intronic
902529912 1:17084330-17084352 CTCTTGCTTAACCCTCTACCAGG - Intronic
902675481 1:18005768-18005790 CTCATGTTGCACCCTCTCCCTGG - Intergenic
902695879 1:18140615-18140637 CTCCTGCTGTGCCCTCTGCCTGG + Intronic
902784893 1:18726594-18726616 CTAAGGCCCAACCCTCTGCCTGG - Intronic
902826661 1:18979238-18979260 GTCTTGCTGTTCCCTCTGCCTGG - Intergenic
902919182 1:19656425-19656447 CACATGCTGTTCCCTTTGCCTGG - Intronic
903068823 1:20716615-20716637 CTCAAGCTGACCCCTCAGCCTGG - Intronic
903146518 1:21376232-21376254 CTCATGGAGAACCCTTTGCTAGG + Intergenic
903219528 1:21861323-21861345 CTTATGCTGTTCCCTCTGCATGG - Intronic
903261333 1:22133283-22133305 CCCATCCTGAGCACTCTGCCAGG - Intronic
903376493 1:22869693-22869715 CACATGCTGTTCCCTCTGCCTGG + Intronic
903386146 1:22928211-22928233 CTCCTGCTGTCCCCTCTGTCTGG - Intergenic
903453573 1:23471207-23471229 CTCATGCTGCTCCCTCTGCCTGG + Intronic
903682303 1:25105092-25105114 CACATGCTGTTCCCTCTGCCTGG + Intergenic
903765152 1:25729244-25729266 CACATGCTGTGCTCTCTGCCTGG + Intronic
903772536 1:25772901-25772923 CACTTGCTGTCCCCTCTGCCTGG + Intronic
903833717 1:26189680-26189702 CCCGAGCTGACCCCTCTGCCTGG + Exonic
904078450 1:27857199-27857221 CTCATGGTGGCCCCTCTGCTGGG - Intergenic
904424746 1:30416056-30416078 CTCACTCTGAACCCTCTGCTAGG - Intergenic
904454012 1:30636115-30636137 CCCATGTTGTTCCCTCTGCCTGG - Intergenic
904532390 1:31177783-31177805 CTCATGCTGTTGCCTCTGCTGGG + Intergenic
904584435 1:31572116-31572138 CTCATGCTGATCCGGCTTCCTGG + Intergenic
904590528 1:31612806-31612828 CTCATGCTGTCCCCTCTACCCGG + Intergenic
904609579 1:31717943-31717965 CTTATGAGGCACCCTCTGCCTGG + Intergenic
904822207 1:33253145-33253167 CTCATGCTGTTCCCTCTGTCTGG - Intergenic
904822261 1:33253452-33253474 CATATGCTGTTCCCTCTGCCTGG - Intergenic
904917757 1:33982698-33982720 CACCTGCTGCTCCCTCTGCCAGG - Intronic
905451744 1:38061460-38061482 CACTTGCTGTTCCCTCTGCCAGG - Intergenic
905471346 1:38194408-38194430 CGCCTGCAAAACCCTCTGCCAGG + Intergenic
905508523 1:38500044-38500066 CCCATGCTGTGTCCTCTGCCTGG + Intergenic
905546849 1:38807063-38807085 CACATGCTGTTCCCTCTGCCTGG - Intergenic
905804553 1:40866344-40866366 CTCTTGCTGTGCCCTCTGCCTGG + Intergenic
905867127 1:41382427-41382449 CTCCTGCTGGACGCTCTGCCGGG + Exonic
906286452 1:44590917-44590939 ACCATGCTGTTCCCTCTGCCTGG - Intronic
906694767 1:47816528-47816550 CACATGCTGGTCCTTCTGCCCGG + Intronic
906718190 1:47985923-47985945 CTCATGTTGTTCCCTCTACCTGG - Intronic
906787777 1:48630861-48630883 CACATGCTGTTTCCTCTGCCTGG + Intronic
906788715 1:48639754-48639776 CACATGCTATACCCTTTGCCTGG - Intronic
906791402 1:48661335-48661357 CACCTGCTGCTCCCTCTGCCTGG - Intronic
906816539 1:48885974-48885996 CTCATGCAGAAGCCTCTGCCAGG + Intronic
907114441 1:51956626-51956648 CTCATGCTGCACCCTCTGCCTGG + Intronic
907299175 1:53475820-53475842 CTCACGCAGCACCCTCTGCCTGG + Intergenic
907372702 1:54013617-54013639 CACATGCTGTTCCCTGTGCCTGG + Intronic
907386298 1:54127739-54127761 CACATGCTGTTCCCTATGCCTGG + Intergenic
907459678 1:54598027-54598049 CTCTTGCTGTTCCCTCTACCAGG + Intronic
907480923 1:54745091-54745113 CCTATGCTGAGCCCTCTGCCAGG - Intergenic
907570345 1:55477465-55477487 CACATACTGTTCCCTCTGCCTGG + Intergenic
908204913 1:61836746-61836768 CTTTTGCTAAACCCTTTGCCTGG - Intronic
908262603 1:62350527-62350549 CTCCTGCTGAACCCATGGCCTGG + Intergenic
908338706 1:63154266-63154288 CTCATGATGTTACCTCTGCCTGG - Intergenic
908700105 1:66889797-66889819 CTCATGTTTTACCCTCTGCCTGG + Intronic
908967059 1:69778092-69778114 TTCATGCTGTTTCCTCTGCCTGG + Intronic
910171265 1:84379509-84379531 TTCATGCTGAAGACTATGCCGGG - Intronic
910202357 1:84712975-84712997 CCCTTGCTGTACCCTCTACCTGG - Intergenic
910226565 1:84942051-84942073 CACATGCTGATCTGTCTGCCTGG + Intronic
910662478 1:89688601-89688623 CTCTTGCTGTTCCCTCTGCCTGG - Intronic
910844004 1:91588001-91588023 CCCATGCTCACCCCTCTCCCTGG + Intergenic
912248322 1:107984424-107984446 CTCATTCTGGTCCCACTGCCTGG + Intergenic
912468136 1:109888004-109888026 CGCATGCTGGTCCCTCTGCCTGG - Intergenic
912469689 1:109898035-109898057 CTTTTGCTGCTCCCTCTGCCTGG + Intergenic
912471405 1:109909717-109909739 CTCAGACTGGTCCCTCTGCCTGG - Intergenic
912853515 1:113147309-113147331 CCCATGCAGAGCCCCCTGCCAGG - Intergenic
914223782 1:145703652-145703674 CTCCTGCTGTTCCTTCTGCCTGG - Intronic
915270127 1:154747887-154747909 CTCATGCTGGCCCCTCTGCCCGG + Intronic
916183979 1:162113189-162113211 CTCATGCTCCACCTCCTGCCAGG - Intronic
916676065 1:167065340-167065362 CACATGCTGTTCACTCTGCCTGG - Intronic
916952060 1:169790554-169790576 CACTTGCTGGACCCTCTCCCTGG + Intronic
917508708 1:175651309-175651331 AACATGCTGAACCCTCTGCCTGG - Intronic
917845306 1:179015390-179015412 TTCATACTGATCCCTCTGCCTGG + Intergenic
917923547 1:179770644-179770666 AACATGCTGCCCCCTCTGCCTGG + Intronic
918487458 1:185045219-185045241 CTCGTGCTCAACCTTCTGCTTGG - Intergenic
919317562 1:195992741-195992763 ATTATGCTGTTCCCTCTGCCAGG + Intergenic
919516574 1:198532751-198532773 CACTTGCTGTTCCCTCTGCCTGG - Intronic
919564198 1:199163065-199163087 CTCATGTTGTTCCCTCTGCTTGG + Intergenic
919836077 1:201574419-201574441 TTCATGCTGCTCCTTCTGCCTGG - Intergenic
919954605 1:202400556-202400578 CACATGCTGTTTCCTCTGCCTGG - Intronic
920088374 1:203434455-203434477 CACATGCTGGTCCCTCTACCTGG + Intergenic
920390202 1:205595309-205595331 CACGTGGTGAACCCTCTGCCTGG + Intronic
920544827 1:206807472-206807494 CTCATGCTGTTCCCTCAACCTGG + Intronic
920558315 1:206920496-206920518 CCCATGCTGTGCCTTCTGCCAGG - Intronic
920729856 1:208473320-208473342 CTCATGCTGCTCCCCCTTCCTGG - Intergenic
920975350 1:210780691-210780713 CTCATGCTGATCCCTCTGCCTGG - Intronic
921007502 1:211109206-211109228 CCCATGCTGGATCCTCTGCCTGG - Intronic
921649528 1:217660094-217660116 CAAATGCTGTTCCCTCTGCCTGG + Intronic
922217800 1:223534705-223534727 CTCATGCTGTTCCCTCTGTCTGG + Intergenic
922559789 1:226560974-226560996 CTCCTGCTATACCCTCTTCCTGG + Intronic
923367243 1:233274703-233274725 CTCATGCTGTTTCCTCTGCCTGG - Intronic
1063168914 10:3488290-3488312 CTCATGCAGAAGCCAATGCCAGG + Intergenic
1063680122 10:8179217-8179239 CTCATGCTGATTCTTCTGCTGGG + Intergenic
1065510973 10:26478232-26478254 CTCATGCTTTTCTCTCTGCCTGG - Intronic
1066463453 10:35632955-35632977 CTCATGCTGCAGGCTGTGCCCGG - Intergenic
1066732666 10:38449340-38449362 CTCATGCTGACCTCTCAGCGTGG - Intergenic
1067024863 10:42836189-42836211 CACATGCAGTTCCCTCTGCCTGG + Intergenic
1067509783 10:46885197-46885219 TTCATGCTGTTCCTTCTGCCTGG - Intergenic
1067652471 10:48166661-48166683 TTCATGCTGTTCCTTCTGCCTGG + Intronic
1067794816 10:49313295-49313317 CTCATGGTGTTCCCTCTGCCTGG - Intronic
1068013870 10:51489292-51489314 CTCATGCTAATTCCTCTACCTGG - Intronic
1068130894 10:52893970-52893992 CTCTTGCTGCTCCCTCTGCCTGG - Intergenic
1068842015 10:61626096-61626118 CACATTCTGTTCCCTCTGCCTGG + Intergenic
1069614615 10:69799043-69799065 CTCCTGCTAGACCCTCTGCCAGG - Intergenic
1069991356 10:72318539-72318561 CTCATGCTGTTCCTTCTGCCCGG - Intergenic
1070161740 10:73870993-73871015 CACATTCTGACCCCTCTGGCTGG + Intronic
1070241847 10:74689934-74689956 CTGTTGCTGGACCCTCTCCCAGG + Intronic
1070345750 10:75540263-75540285 CACTTGCTGTTCCCTCTGCCAGG - Intronic
1070350986 10:75592086-75592108 GTCATGCTGTCCCCTCTGCCTGG - Intronic
1070661097 10:78305796-78305818 CCCAAGCTGTACTCTCTGCCTGG + Intergenic
1070771203 10:79083318-79083340 CACATGCTGTTCCCACTGCCTGG - Intronic
1070785795 10:79161480-79161502 CATATGCTGTTCCCTCTGCCTGG + Intronic
1070829560 10:79410102-79410124 CACTTGCTGTTCCCTCTGCCAGG + Intronic
1070853364 10:79585316-79585338 CACCTGCTGTTCCCTCTGCCTGG + Intergenic
1072185394 10:93032934-93032956 CTCTTGCTCTTCCCTCTGCCAGG - Intronic
1072242371 10:93508671-93508693 CTCTTTCTGTTCCCTCTGCCTGG + Intronic
1072510988 10:96124644-96124666 CTCAGGCTGAAGCAACTGCCAGG - Intergenic
1074009669 10:109465162-109465184 CACATGCTGTGCCCTCTGCCTGG - Intergenic
1074039002 10:109769698-109769720 AACATGCTGATCCCTCAGCCTGG - Intergenic
1074112059 10:110429705-110429727 CTCATGCTGCATTCTCTGCCTGG + Intergenic
1074124173 10:110515113-110515135 CACATGCTGGTCCCTCTGACTGG + Intergenic
1074385220 10:113011245-113011267 TTCATGCTGATTCCTCTACCTGG - Intronic
1075067415 10:119298806-119298828 CACATGCTGTTCCCTCTGCCAGG + Intronic
1075069638 10:119312391-119312413 CTCCAGCTGCTCCCTCTGCCTGG - Intronic
1075575850 10:123576967-123576989 CTCATTCTGTTCACTCTGCCAGG - Intergenic
1075588972 10:123677778-123677800 CTCATGCTGTCCCTTCTCCCTGG - Intronic
1076625363 10:131818533-131818555 CATATGCTGTTCCCTCTGCCTGG - Intergenic
1076923246 10:133466370-133466392 CTCACGCTTACCCCTCTGCATGG - Intergenic
1077143313 11:1034358-1034380 CTCATGCTGGGCCCTGAGCCTGG + Intronic
1077591940 11:3499183-3499205 CGCATGCTCTTCCCTCTGCCTGG + Intergenic
1078532679 11:12149141-12149163 CTGATGCTGATCCCTCTGTCTGG - Intronic
1079122732 11:17696845-17696867 CACCTGCTGTTCCCTCTGCCTGG + Intergenic
1079293433 11:19209794-19209816 CTCATGCTCCCTCCTCTGCCTGG + Intronic
1079317157 11:19418534-19418556 CACATGCTGATCGCTCTGTCTGG - Intronic
1080634335 11:34110319-34110341 CTCATGCTGTCTCCTCTGCTTGG + Intronic
1080667462 11:34348488-34348510 CTCACACTGTTCCCTCTGCCTGG + Intronic
1080859687 11:36142558-36142580 TGCATGCTGAACCCACTGTCTGG + Intronic
1081163792 11:39784934-39784956 CTCATTCTGACAACTCTGCCTGG + Intergenic
1081477198 11:43446187-43446209 CACATGCTATTCCCTCTGCCTGG + Intronic
1081634809 11:44714062-44714084 CACCTGCTGCTCCCTCTGCCTGG - Intergenic
1081686467 11:45046750-45046772 GTCAGGCTGTTCCCTCTGCCTGG - Intergenic
1081732699 11:45382728-45382750 CTCCTGCACTACCCTCTGCCTGG - Intergenic
1081736067 11:45405170-45405192 CTGATGCTGTACCCTCTGCCTGG - Intergenic
1081751951 11:45517636-45517658 CTCATGCAGAACCCTCTTCCTGG - Intergenic
1081796039 11:45820636-45820658 CACCTGCTGATCCCTCTTCCTGG - Intergenic
1083215232 11:61214547-61214569 CACATGCTGTTCCCTTTGCCAGG + Intergenic
1083218116 11:61233376-61233398 CACATGCTGTTCCCTTTGCCAGG + Intergenic
1083221097 11:61253123-61253145 CACATGCTGTTCCCTTTGCCTGG + Intergenic
1083285605 11:61656686-61656708 CCCATGCTGTTCCCTCTGTCTGG - Intergenic
1083935059 11:65865722-65865744 CCCATGCTGACCCCTCTGCCTGG + Intronic
1084247780 11:67871919-67871941 CACATGCTCTTCCCTCTGCCTGG + Intergenic
1084317102 11:68351912-68351934 CACTGGCTGATCCCTCTGCCTGG - Intronic
1084398469 11:68930089-68930111 CTCCAGATGAACCCTCTGCATGG + Intronic
1084825042 11:71723574-71723596 CACATGCTCTTCCCTCTGCCTGG - Intergenic
1085041242 11:73327623-73327645 CACATGCTGGTCTCTCTGCCAGG - Intronic
1085083819 11:73653696-73653718 CACATGCTGATCCCTCTGCCTGG - Intronic
1085306437 11:75488601-75488623 CTCAGGTTGGGCCCTCTGCCAGG + Intronic
1085321411 11:75576374-75576396 CCCATGCTGTCTCCTCTGCCTGG + Intergenic
1086343885 11:85875477-85875499 CTCATGCTGTTTCCTCTTCCTGG + Intronic
1086994440 11:93340302-93340324 CTTTTGCTGATTCCTCTGCCTGG - Intronic
1087354828 11:97079333-97079355 CTCATTATGAAACTTCTGCCTGG - Intergenic
1087775338 11:102251692-102251714 CTCATTCTGTTCCCTCTGCCTGG + Intergenic
1087783717 11:102330198-102330220 CATATGCTGTTCCCTCTGCCTGG - Intronic
1088134464 11:106537455-106537477 CTCATACTGTTCCCTCTGCATGG + Intergenic
1089133754 11:116233012-116233034 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1089174978 11:116541838-116541860 GCCATGCTGTCCCCTCTGCCTGG - Intergenic
1089291814 11:117441817-117441839 TTCATGTGGACCCCTCTGCCGGG - Intronic
1089310449 11:117555037-117555059 CTCATGCTGGGCCCCCTGCATGG + Intronic
1089312007 11:117564550-117564572 CTCTTGCTGGTCCCTCTGCTGGG + Intronic
1089753742 11:120670555-120670577 CACCTGCTGTGCCCTCTGCCTGG + Intronic
1089964953 11:122648092-122648114 TTTATGCTGTTCCCTCTGCCTGG - Intergenic
1089976393 11:122735737-122735759 CACATGCTGGGCCCTCTGCCTGG - Intronic
1090431239 11:126648372-126648394 CTTATGCAGTTCCCTCTGCCTGG + Intronic
1091020279 11:132093290-132093312 CACATGCTGTTTCCTCTGCCTGG + Intronic
1091206802 11:133827109-133827131 CACATACTGTTCCCTCTGCCTGG + Intergenic
1091217171 11:133909165-133909187 CTCGTCCTGACCCCTTTGCCCGG - Exonic
1091777152 12:3191996-3192018 CTCTTCCTGGACCCACTGCCTGG - Intronic
1091777157 12:3192022-3192044 CCCATGCTGTTCCCTCTGCTTGG - Intronic
1091873510 12:3914836-3914858 CACACGCTGTTCCCTCTGCCTGG - Intergenic
1091989092 12:4940168-4940190 CACTTGCTGTGCCCTCTGCCTGG - Intergenic
1092418062 12:8307314-8307336 CACATGCTCTTCCCTCTGCCTGG + Intergenic
1093230142 12:16533911-16533933 CCTATGCTGTTCCCTCTGCCTGG - Intronic
1093412930 12:18888111-18888133 ATCATGCTGGACCCCCTGCCTGG + Intergenic
1093889089 12:24498045-24498067 CTCCTGCTGCACCCTCAGACAGG - Intergenic
1093929106 12:24937289-24937311 CACTTGCTGATGCCTCTGCCTGG - Intronic
1095578437 12:43766290-43766312 CCCATGCTATTCCCTCTGCCTGG + Intronic
1095593715 12:43935900-43935922 CTCATGCTGAACCCTCTGCCTGG - Intronic
1095614460 12:44171901-44171923 CACATGCTGTTCCCTATGCCTGG - Intronic
1096120505 12:49086245-49086267 CTCATGATGTTCCTTCTGCCTGG + Intergenic
1096201113 12:49683889-49683911 CTCATGCTGTCCTCTCTACCTGG + Intronic
1096215884 12:49797140-49797162 CTCAGCCTGAACCCTCACCCTGG - Exonic
1097580598 12:61452337-61452359 CTCACACTGAAGCATCTGCCTGG - Intergenic
1097798602 12:63889082-63889104 CACATGCTGTTCCCTCTCCCTGG + Intronic
1098073403 12:66700200-66700222 CTGATGCTTTTCCCTCTGCCTGG - Intronic
1098110420 12:67115657-67115679 CTCATGCTGTTCCCTGTGTCAGG - Intergenic
1099143372 12:79008227-79008249 CACATGCTGAATCCTCTGCTTGG - Intronic
1099257628 12:80333839-80333861 CACTTGCTGGTCCCTCTGCCTGG - Intronic
1100126625 12:91435141-91435163 CACATGCTGTTCCCTCTGACTGG - Intergenic
1100398016 12:94201709-94201731 CACATGCTGTTCCTTCTGCCTGG + Intronic
1100895048 12:99172113-99172135 CACATGCTGTTCCCTCTGCCTGG - Intronic
1101000830 12:100355978-100356000 CTCAAGCTATGCCCTCTGCCTGG - Intergenic
1101049024 12:100841645-100841667 CACTTGCTGTTCCCTCTGCCTGG - Intronic
1101205792 12:102486107-102486129 CTCATGCTGTTCCCTCTGCCTGG - Intergenic
1101250485 12:102929426-102929448 CTCATGCTATTCCTTCTGCCTGG - Intronic
1101343476 12:103863790-103863812 CTCATGCTCTTCCCTCTACCAGG + Intergenic
1101360372 12:104020763-104020785 CACTTGCTGTTCCCTCTGCCTGG - Intronic
1101421404 12:104554313-104554335 CACATGCTGTTCCCTCTGCCTGG - Intronic
1101519182 12:105465878-105465900 CTCATGCTGTTTCCTCTACCAGG + Intergenic
1101586716 12:106091492-106091514 CTCATGCTGACCCTTCTACCTGG - Intronic
1101642715 12:106600253-106600275 CACATGCTGTTCCTTCTGCCAGG + Intronic
1101730109 12:107419869-107419891 TTCATGCTGCTCCCTCTGCTAGG - Intronic
1101838586 12:108311948-108311970 CTCTTGCAGGTCCCTCTGCCTGG + Intronic
1101849601 12:108391710-108391732 CACATGCTGTTCCCTTTGCCAGG - Intergenic
1102027553 12:109722140-109722162 CTCATGCTGTTCCCTCCACCCGG - Intronic
1102209309 12:111113077-111113099 TTCATGCTGTTCCCTCTGCCTGG - Intronic
1102236944 12:111299359-111299381 CTCCTGCTGAGCCTTCTACCTGG - Intronic
1102248610 12:111370495-111370517 CACTTGCTGTTCCCTCTGCCTGG - Intergenic
1102257200 12:111423039-111423061 CCCATGCTGTTCCCTCTGCCTGG - Intronic
1102457768 12:113081648-113081670 TTCATGCTGTTCCCTCTGCATGG - Intronic
1102636791 12:114331585-114331607 CACATGCTGTCCCCTCTACCTGG + Intergenic
1102866953 12:116382216-116382238 CCCCTGCTGACCCCCCTGCCAGG + Intergenic
1103003918 12:117406828-117406850 CACATGCTGTTCCCCCTGCCTGG + Intronic
1103004976 12:117413882-117413904 CACATGCTGTTCCCTCTGCCTGG + Intronic
1103239821 12:119403782-119403804 CAAATGCTGTCCCCTCTGCCTGG + Intronic
1103248240 12:119476838-119476860 CACATGCTGTTCCCTCTGGCTGG + Intronic
1103256202 12:119543564-119543586 CACATGCTGTTCCTTCTGCCTGG - Intergenic
1103394718 12:120598859-120598881 CTTTTGCTGTTCCCTCTGCCTGG + Intergenic
1103405962 12:120675456-120675478 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1103433241 12:120905150-120905172 CCCTTGCTGTTCCCTCTGCCAGG - Intergenic
1103540701 12:121664422-121664444 CTCATGCAGTTCCCTGTGCCTGG - Intronic
1103570767 12:121843350-121843372 CCCTTGCTGATCCCTCTGCCAGG + Intronic
1104051329 12:125195799-125195821 CACCTGCTGTTCCCTCTGCCTGG - Intronic
1104238002 12:126958502-126958524 TTCATGCAAAACCCTCTGCTGGG + Intergenic
1104241174 12:126991156-126991178 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1104657180 12:130581994-130582016 CACCTGCTGCTCCCTCTGCCTGG + Intronic
1104734983 12:131131124-131131146 GTTGTGCTGAAGCCTCTGCCGGG + Intronic
1105282903 13:18979471-18979493 CACATGCTGTGTCCTCTGCCTGG + Intergenic
1105704673 13:22961594-22961616 TTCATAATGAACCCTGTGCCCGG - Intergenic
1105775267 13:23653921-23653943 CTCCTGCAGAACCAGCTGCCAGG - Intronic
1106355289 13:28976270-28976292 CTCATGCTGTGCCTTCTTCCTGG - Intronic
1106406664 13:29480569-29480591 CACTTGCTGTGCCCTCTGCCTGG + Intronic
1106688168 13:32084429-32084451 TGCATGCTGACCCCTCTTCCTGG + Intronic
1107061995 13:36169729-36169751 CATATGCTGACCCATCTGCCAGG + Intronic
1107113804 13:36725331-36725353 CACAGGCTGTTCCCTCTGCCTGG - Intergenic
1107378837 13:39833833-39833855 CACATGCTGTCCCTTCTGCCAGG - Intergenic
1107750887 13:43565216-43565238 TTCTTGCTGTTCCCTCTGCCAGG - Intronic
1108041808 13:46346298-46346320 CTCCTGCGGCATCCTCTGCCTGG + Intronic
1108550327 13:51537606-51537628 CATATGCTGTTCCCTCTGCCTGG + Intergenic
1109247368 13:59971831-59971853 TACATGCTGGTCCCTCTGCCTGG + Intronic
1109826829 13:67732496-67732518 CTCTAGCTGGCCCCTCTGCCTGG + Intergenic
1109826848 13:67732623-67732645 CTCTAGCTGGCCCCTCTGCCTGG + Intergenic
1112005401 13:95249401-95249423 CCCATGGGGAACCCACTGCCTGG + Intronic
1112236325 13:97641185-97641207 CACATACTGTTCCCTCTGCCTGG + Intergenic
1113583644 13:111448068-111448090 CACATGCTTTTCCCTCTGCCTGG - Intergenic
1117211586 14:53506509-53506531 CTCATCCTGTGCCTTCTGCCTGG + Intergenic
1117520021 14:56542151-56542173 CTCCTGCTGAACCCTATGCATGG - Intronic
1117875212 14:60245149-60245171 CCCATGCTGACCCCTCTACCTGG + Intergenic
1118138958 14:63058810-63058832 GTCATGCTGCTTCCTCTGCCTGG - Intronic
1118249184 14:64142436-64142458 TACATGCTGCACCCTCTACCTGG + Intronic
1118355292 14:65008652-65008674 CACATGCTGTTCCCTCTGCCTGG - Intronic
1119044399 14:71305129-71305151 CTCATGTTGCTCTCTCTGCCTGG - Intergenic
1119142978 14:72284607-72284629 CTCATGGAGAACCCTTTGCTAGG + Intronic
1119557589 14:75565567-75565589 CACATGCTGTTCCCTGTGCCCGG + Intergenic
1119852746 14:77877657-77877679 CACATGCTGTTCCCTTTGCCTGG + Intronic
1120801141 14:88690065-88690087 CACTTGCTGCTCCCTCTGCCTGG - Intronic
1120927373 14:89811122-89811144 CACATGCTGTTCCCTCTGCTTGG - Intronic
1121035366 14:90698995-90699017 CTCCTGCTGAACCTCCTTCCAGG + Intronic
1121111233 14:91314530-91314552 CACATGCTGATCCCTCTGCCTGG + Intronic
1121390855 14:93573184-93573206 TTCATGCTGTTCCCTCAGCCTGG + Intronic
1121426792 14:93857961-93857983 CACAAGCTGTCCCCTCTGCCTGG - Intergenic
1121427342 14:93861879-93861901 CTCTTGCTGCTCCATCTGCCAGG - Intergenic
1121665588 14:95669739-95669761 CGTATGCTGTTCCCTCTGCCTGG + Intergenic
1121739040 14:96238677-96238699 CTCAGGCTGTTCCCCCTGCCTGG + Intronic
1122217346 14:100213031-100213053 CACATGCTGTTCCCTCTGCTGGG - Intergenic
1122256916 14:100485124-100485146 CACCTGCTGCTCCCTCTGCCTGG + Intronic
1122269608 14:100562677-100562699 CACCTGCTGCTCCCTCTGCCTGG + Intronic
1122325516 14:100879035-100879057 GACATGCTGACCCCTCTTCCTGG - Intergenic
1122408665 14:101514884-101514906 CTCATGCTGTCCCCTGTGACCGG + Intergenic
1122425364 14:101602412-101602434 GCCATGCTGAGCCTTCTGCCTGG - Intergenic
1122487393 14:102090171-102090193 CAAATGCTGTTCCCTCTGCCTGG + Intronic
1122517754 14:102320262-102320284 CTCACGCTGGGCCCTGTGCCTGG + Intronic
1123976055 15:25555706-25555728 CTCATGGTGCACCCTCTGCCCGG - Intergenic
1125296727 15:38211383-38211405 CACATGCTAATCTCTCTGCCTGG - Intergenic
1125426792 15:39556864-39556886 CTCATGCTGGACCCTGTGTGTGG - Intergenic
1126547046 15:49885236-49885258 CACTGGCTGTACCCTCTGCCTGG + Intronic
1127976898 15:64004485-64004507 CTCATGCTGATACCTTTGCCTGG + Intronic
1128314202 15:66650068-66650090 CTCCTGCAGTGCCCTCTGCCAGG + Intronic
1128318232 15:66674799-66674821 CATATGTTGACCCCTCTGCCTGG + Intronic
1128360122 15:66956104-66956126 CCCATGCTGTTCCCTGTGCCTGG + Intergenic
1128369865 15:67032784-67032806 CACTTGCTGTTCCCTCTGCCTGG + Intergenic
1128713271 15:69887880-69887902 CTCCTGCTGGTCCCTCTGCCTGG - Intergenic
1128745625 15:70112057-70112079 CCCATGCTGCTCCCTCTACCTGG + Intergenic
1129061721 15:72865767-72865789 CACATGCTGTACCTCCTGCCTGG + Intergenic
1129072851 15:72965516-72965538 ATCAGGCTGTCCCCTCTGCCTGG + Intergenic
1129163620 15:73762262-73762284 CACATGCTGTTTCCTCTGCCTGG + Intergenic
1129317279 15:74752548-74752570 CTAACGCTGAACCTTCTGCCTGG + Intronic
1129321092 15:74775451-74775473 CTCCTGTTGCCCCCTCTGCCAGG + Intergenic
1129322157 15:74781506-74781528 TGCATGCTGTTCCCTCTGCCTGG + Intergenic
1129410759 15:75349077-75349099 CTGATACTGAGCCCTCTGCCTGG + Exonic
1129599554 15:76990451-76990473 CACATGATCACCCCTCTGCCTGG - Intergenic
1129816704 15:78561729-78561751 CACATGCTGTTCCCTCTGCCTGG - Intergenic
1129991177 15:79964889-79964911 CACTTGCTGCTCCCTCTGCCTGG - Intronic
1130673505 15:85932908-85932930 CTCATGCTGTCCCCTCTTCCTGG + Intergenic
1130919964 15:88335592-88335614 TTCATGCTGTTCCCTCTCCCAGG - Intergenic
1131077994 15:89510331-89510353 CACATGCTGATCCCTCCTCCTGG - Intergenic
1131118731 15:89809919-89809941 CTCATTCTGTTCCCACTGCCAGG + Intronic
1131779380 15:95840149-95840171 TGCATGCTGAAATCTCTGCCTGG + Intergenic
1132137765 15:99360233-99360255 CACATGCTGTTCCCTCTGCTTGG + Intronic
1133357419 16:5146915-5146937 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1134013053 16:10869347-10869369 CACATGCCGTTCCCTCTGCCTGG + Intergenic
1134165362 16:11925393-11925415 CCCACACTGTACCCTCTGCCTGG - Intergenic
1134450343 16:14359543-14359565 CTCATGCTGTTCCCTCTGCTTGG + Intergenic
1134489941 16:14689049-14689071 CCCACACTGTACCCTCTGCCTGG + Intronic
1134495322 16:14728166-14728188 CCCACACTGTACCCTCTGCCTGG + Intronic
1134500710 16:14767289-14767311 CCCACACTGTACCCTCTGCCTGG + Intronic
1134527247 16:14953894-14953916 CCCACACTGTACCCTCTGCCTGG + Intergenic
1134545152 16:15102443-15102465 CCCACACTGTACCCTCTGCCTGG - Intronic
1134579872 16:15361760-15361782 CCCACACTGTACCCTCTGCCTGG - Intergenic
1134626447 16:15726045-15726067 CACACGCTGTTCCCTCTGCCTGG + Exonic
1134714836 16:16352438-16352460 CCCACACTGTACCCTCTGCCTGG + Intergenic
1134722713 16:16395800-16395822 CCCACACTGTACCCTCTGCCTGG + Intergenic
1134944715 16:18316071-18316093 CCCACACTGTACCCTCTGCCTGG - Intergenic
1134951979 16:18356221-18356243 CCCACACTGTACCCTCTGCCTGG - Intergenic
1135065386 16:19305281-19305303 CCCATGCTGTTCCCTCTACCTGG - Intronic
1135106651 16:19655576-19655598 CTCCTGTTGAACCCTCAGGCAGG + Intronic
1135310321 16:21400289-21400311 CCCACACTGTACCCTCTGCCTGG - Intergenic
1135363269 16:21832706-21832728 CCCACACTGTACCCTCTGCCTGG - Intergenic
1135395425 16:22128029-22128051 CTCATGCTGTTGCCTCTACCTGG - Intronic
1135420562 16:22303115-22303137 CCCTTGCTGTTCCCTCTGCCTGG + Intronic
1135448521 16:22538354-22538376 CCCACACTGTACCCTCTGCCTGG + Intergenic
1135468109 16:22704534-22704556 CTCTTGCTGTTCCCTCTGCCTGG - Intergenic
1135658287 16:24270908-24270930 CGCTTGCTGATCCATCTGCCTGG - Intronic
1135889578 16:26345147-26345169 CGCAAGCTGTTCCCTCTGCCTGG - Intergenic
1135932632 16:26751555-26751577 CACATGCTGTTTCCTCTGCCTGG + Intergenic
1135940465 16:26817604-26817626 CACATGCTGTTCCCTCTGACTGG + Intergenic
1136008896 16:27349511-27349533 ATCATGCAGTTCCCTCTGCCTGG - Intronic
1136149906 16:28340623-28340645 CCCACACTGTACCCTCTGCCTGG - Intergenic
1136166140 16:28454427-28454449 CCCACACTGTACCCTCTGCCTGG - Intergenic
1136196831 16:28660593-28660615 CCCACACTGTACCCTCTGCCTGG + Intergenic
1136213171 16:28774716-28774738 CCCACACTGTACCCTCTGCCTGG + Intergenic
1136252149 16:29012394-29012416 CACTTGCTGTTCCCTCTGCCTGG + Intergenic
1136257902 16:29054633-29054655 CCCACACTGTACCCTCTGCCTGG + Intergenic
1136307067 16:29379433-29379455 CCCACACTGTACCCTCTGCCTGG - Intergenic
1136320591 16:29481676-29481698 CCCACACTGTACCCTCTGCCTGG - Intergenic
1136393533 16:29980025-29980047 CACATGCTGTTCTCTCTGCCTGG - Intronic
1136406619 16:30051875-30051897 CAGTTGCTGATCCCTCTGCCTGG - Intronic
1136435164 16:30221016-30221038 CCCACACTGTACCCTCTGCCTGG - Intergenic
1137508876 16:49080816-49080838 CACATGCTGTTCCCTTTGCCTGG - Intergenic
1138443721 16:57050306-57050328 CTCATGTTGGAGCCTCTGCCAGG - Intronic
1138444208 16:57053298-57053320 CACATGCCGTTCCCTCTGCCTGG - Intronic
1138448337 16:57078352-57078374 CTCCTGCGAAGCCCTCTGCCAGG - Intronic
1138455431 16:57117982-57118004 CACTTGCTGTTCCCTCTGCCTGG + Intronic
1138464489 16:57178203-57178225 CTCAGGCTGTTCCCTCTGCCAGG + Intronic
1138529197 16:57625877-57625899 CCAATGCTGTTCCCTCTGCCTGG + Intronic
1138639575 16:58373602-58373624 TTCATGCAGTTCCCTCTGCCTGG - Intronic
1138645997 16:58425400-58425422 CACATGCTATTCCCTCTGCCTGG - Intergenic
1139206224 16:65031555-65031577 CTCCTGCTGTTCCCTCTGCCTGG - Intronic
1139328370 16:66169048-66169070 CACATGCTAAGCCCTCTGCCAGG + Intergenic
1139367997 16:66445625-66445647 CTGATTCAGAATCCTCTGCCTGG - Intronic
1139657251 16:68396464-68396486 CACATGCTGTACCCTGTGTCTGG + Intronic
1139701088 16:68708439-68708461 CACTTGCTGTGCCCTCTGCCTGG + Intronic
1139855195 16:69974414-69974436 CCCACACTGTACCCTCTGCCTGG - Intergenic
1139884913 16:70201547-70201569 CCCACACTGTACCCTCTGCCTGG - Intergenic
1140367604 16:74393978-74394000 CCCACACTGTACCCTCTGCCTGG + Intergenic
1140412949 16:74752490-74752512 CACCTGCTGTTCCCTCTGCCTGG + Intronic
1140832554 16:78765206-78765228 CTCGTGCTGGATCCTCTGCCAGG - Intronic
1140949654 16:79804579-79804601 CTCAGGCTGAACACAGTGCCTGG - Intergenic
1140992835 16:80230952-80230974 CATATGCTGTTCCCTCTGCCTGG + Intergenic
1141076580 16:81011173-81011195 CACATGCTGTTCCTTCTGCCTGG + Intronic
1141376435 16:83535169-83535191 CACATGCTGTGCCCTCTGCCTGG - Intronic
1141473682 16:84257433-84257455 CTCATGCTGTTCCCACTGCTTGG + Intergenic
1141479482 16:84296821-84296843 CTCATGCTGAGCCTTCTTCCAGG - Intronic
1141986700 16:87585054-87585076 GTGATGCTGATCCCTCAGCCTGG - Intergenic
1142499569 17:324596-324618 CTCATGCTGCACCCTTCACCTGG + Intronic
1142499716 17:325491-325513 CACATGCTGTTCCTTCTGCCTGG + Intronic
1142557514 17:789923-789945 CCGAGGCTGACCCCTCTGCCTGG - Intronic
1142743810 17:1945086-1945108 CACGTGCTGTTCCCTCTGCCTGG + Intronic
1142744673 17:1949921-1949943 CACCTGCTGTGCCCTCTGCCTGG - Intronic
1142824383 17:2498954-2498976 CACATGCTGCTGCCTCTGCCTGG + Intronic
1142858039 17:2743656-2743678 TACATGCTGTCCCCTCTGCCAGG + Intergenic
1143301339 17:5912700-5912722 CTCATGCTGTTCCATCTGCCTGG - Intronic
1143695095 17:8608755-8608777 CCTATGCTGACCACTCTGCCTGG + Intronic
1144320439 17:14112755-14112777 CTCATGATGCTCCCTCTGTCTGG - Intronic
1144713708 17:17420121-17420143 CACATGCTCATCCCTCTGCCTGG - Intergenic
1144771541 17:17762299-17762321 CACATGCTGTTCCCTCCGCCTGG - Intronic
1144832181 17:18137926-18137948 GTCCTGCTGCTCCCTCTGCCTGG - Intronic
1144958570 17:19032194-19032216 CTCATGCTGTTTCCTGTGCCTGG + Intronic
1144976590 17:19142330-19142352 CTCATGCTGTTCCCTGTGCCTGG - Intronic
1145205522 17:20983202-20983224 CTCATGCTGTCCTCTCTTCCAGG - Intergenic
1145254195 17:21313877-21313899 CCCATGCTGGACCTTCTGCTTGG - Intronic
1145322405 17:21774085-21774107 CCCATGCTGGACCTTCTGCTTGG + Intergenic
1145783845 17:27581503-27581525 ATTATGCTGTTCCCTCTGCCTGG + Intronic
1145861743 17:28216931-28216953 CTCCTCCTCAACCCCCTGCCTGG - Intergenic
1145974953 17:28978546-28978568 CACATGCTGGTCCCTCTGCCTGG - Intronic
1146254842 17:31385786-31385808 CATATGCTGTTCCCTCTGCCTGG - Intergenic
1146423802 17:32716171-32716193 CACATGCTGTTCCCACTGCCCGG + Intronic
1146461136 17:33046861-33046883 CTCATTCTGACGACTCTGCCCGG - Intronic
1146480327 17:33200028-33200050 CACATGCTGTTCCCTCTTCCTGG + Intronic
1146681208 17:34809718-34809740 CTCATGCTAAATCCTTTGCTGGG + Intergenic
1146944597 17:36865036-36865058 CGCATGCTGTTCCCTCTGCCTGG + Intergenic
1147131217 17:38410424-38410446 CTCATGGTTCACCCTGTGCCTGG + Intergenic
1147684407 17:42278091-42278113 CACATGCTATTCCCTCTGCCTGG + Intergenic
1148125670 17:45235399-45235421 TTCATGCTGTTCCTTCTGCCTGG - Intronic
1149424284 17:56540059-56540081 CACATACTGTTCCCTCTGCCTGG - Intergenic
1149445394 17:56709278-56709300 CACACGCTGTTCCCTCTGCCAGG + Intergenic
1150018817 17:61589574-61589596 CACATGCTGTTCCCTCTACCTGG - Intergenic
1150228243 17:63535304-63535326 CTCATGCTGCTCCCTGAGCCAGG + Intronic
1150458946 17:65330870-65330892 CCTCTGCTGATCCCTCTGCCTGG + Intergenic
1150492949 17:65586941-65586963 CTCATGCTGTTCCATCTTCCAGG - Intronic
1151151747 17:72094148-72094170 CACATGCTGTTCCCTCTACCTGG + Intergenic
1151449881 17:74192201-74192223 TTAATGCTGTTCCCTCTGCCAGG + Intergenic
1152101350 17:78303650-78303672 CCCATGCTGCAGCCTGTGCCTGG + Intergenic
1152997009 18:416920-416942 CCCATGCTAGACCCTCTGCCTGG - Intronic
1153243831 18:3054431-3054453 CACTTGCTGTGCCCTCTGCCTGG + Intergenic
1153263377 18:3245708-3245730 GGCATGCTGCTCCCTCTGCCTGG + Intergenic
1153464425 18:5373637-5373659 TTCATGCTGCTCCCTCTGCCTGG - Intergenic
1154116620 18:11617398-11617420 CCCACACTGTACCCTCTGCCTGG - Intergenic
1155042317 18:22075076-22075098 CTCTTGCTGCCTCCTCTGCCTGG + Intergenic
1155232045 18:23783476-23783498 CTCAGGCCAATCCCTCTGCCTGG - Intronic
1155381340 18:25225733-25225755 CTTTCGCTGCACCCTCTGCCAGG - Exonic
1155683202 18:28515162-28515184 CTTATGCTATTCCCTCTGCCAGG + Intergenic
1156268610 18:35510898-35510920 CTCATGCTGTTCCCTTGGCCTGG + Intergenic
1156345008 18:36249204-36249226 CACTTGCTGTTCCCTCTGCCTGG + Intronic
1157489246 18:48110807-48110829 CTCATCCTGAACCCCCTCCTGGG - Intronic
1157604484 18:48917299-48917321 CTCAGGCTACACCCTCTCCCTGG - Intergenic
1157877267 18:51285489-51285511 CTCATGCTGCCCCCTCAGCGTGG - Intergenic
1158327914 18:56330078-56330100 CTCATGCAGAATCATCTGACTGG - Intergenic
1158618540 18:59010074-59010096 CACAAGGTCAACCCTCTGCCAGG - Intergenic
1159605696 18:70472265-70472287 CTCATACTGTTCTCTCTGCCAGG - Intergenic
1160059486 18:75516290-75516312 CACTTGCTGTTCCCTCTGCCGGG - Intergenic
1160203031 18:76810769-76810791 CTCATCCTCCACCCTCCGCCAGG + Intronic
1160409899 18:78668153-78668175 CTCTTGCTGGACCCTCTGAGGGG - Intergenic
1160665470 19:326067-326089 GTCCTGCTGAGCCCTCTCCCTGG - Intronic
1160916820 19:1500723-1500745 CACAGGCTGTGCCCTCTGCCTGG - Intergenic
1161207581 19:3049404-3049426 CACATGCTGTTCCCTCTGCCTGG - Intergenic
1161246109 19:3252976-3252998 CACATGCTGTTCCTTCTGCCTGG - Intronic
1161492572 19:4570313-4570335 CTCAGGCTGTCCCCTCTGCTGGG + Intergenic
1161546467 19:4883726-4883748 CACAGGCTGTTCCCTCTGCCTGG + Intergenic
1161590381 19:5126749-5126771 CCCGTGCTGAACCCGCAGCCGGG - Intronic
1161605233 19:5211140-5211162 CACATGTGGCACCCTCTGCCAGG + Intronic
1161618741 19:5287168-5287190 CTTCTGCTGTGCCCTCTGCCTGG + Intronic
1161646077 19:5454288-5454310 CAAATGCTGTTCCCTCTGCCTGG - Intergenic
1162105785 19:8368880-8368902 CACATGCTGTTCCCCCTGCCTGG - Intronic
1162153633 19:8662436-8662458 CACAGGCTGTTCCCTCTGCCAGG - Intergenic
1162181622 19:8873029-8873051 CTCATGCTGTTCTCCCTGCCTGG + Intronic
1162360706 19:10218521-10218543 CACCTGCTGTTCCCTCTGCCTGG - Intronic
1162441153 19:10692908-10692930 CTCAAGCTATTCCCTCTGCCTGG - Intergenic
1162554834 19:11380427-11380449 CCCATGCTGTTCCCTCTGCCTGG - Intronic
1162833224 19:13299706-13299728 CCTATGCTGTTCCCTCTGCCTGG + Intronic
1162850979 19:13430936-13430958 CACAGGCTGTTCCCTCTGCCTGG - Intronic
1162856506 19:13472592-13472614 CACATGCTGTTCCCTCTGCCTGG + Intronic
1163479187 19:17544579-17544601 CACATGCTGTGCCCTCTGCCTGG - Intronic
1163526617 19:17825283-17825305 GGCATGCTGTTCCCTCTGCCAGG + Exonic
1163552403 19:17972952-17972974 CACAGGCTGTGCCCTCTGCCTGG - Intronic
1163576183 19:18112109-18112131 CACATGCAGTACCCACTGCCTGG - Intronic
1163578566 19:18124564-18124586 CACATGCTGTTCCCTCTGCCTGG - Intronic
1163588458 19:18176830-18176852 CACAGGCTGATCCCTCTGCCAGG - Intronic
1163670878 19:18627768-18627790 CACATGCAGTCCCCTCTGCCAGG + Intergenic
1163703507 19:18798981-18799003 CCCCTGCTGTGCCCTCTGCCTGG - Intergenic
1164472816 19:28550273-28550295 ACCATGCTGACCCCTCTGCTTGG - Intergenic
1164472886 19:28550566-28550588 ACCATGCTGACCCCTCTGCTTGG - Intergenic
1164472904 19:28550633-28550655 ACCATGCTGACCCCTCTGCTTGG - Intergenic
1164716384 19:30393649-30393671 CACTTGCTGTTCCCTCTGCCTGG - Intronic
1165344797 19:35238219-35238241 CACATGGTCATCCCTCTGCCTGG - Intergenic
1165734875 19:38169833-38169855 CTGACCCTGACCCCTCTGCCTGG - Intronic
1165769147 19:38368279-38368301 CACAAGCTGAAGTCTCTGCCTGG + Intronic
1165893855 19:39130137-39130159 CCCACCCTGACCCCTCTGCCTGG - Intronic
1165893881 19:39130207-39130229 CCCACCCTGATCCCTCTGCCTGG - Intronic
1165921914 19:39304359-39304381 CACATGCTGTTCCCTTTGCCAGG + Intergenic
1165978612 19:39699936-39699958 CTCTTGCTGAACTCTCTGGCTGG - Intergenic
1166006916 19:39914400-39914422 CACTTGCTGTTCCCTCTGCCTGG + Intronic
1166053311 19:40274032-40274054 CACATGCTGTACCCCTTGCCTGG + Intronic
1166083801 19:40461861-40461883 CACGTGCTGTGCCCTCTGCCTGG + Intronic
1166569161 19:43782847-43782869 CTCATGCACACCCCTCTGCAAGG + Intergenic
1166673177 19:44723665-44723687 CACAGGCTGTTCCCTCTGCCAGG - Intergenic
1166701663 19:44885847-44885869 CACATGCTGTTCCCTCTACCTGG - Intronic
1167266637 19:48486014-48486036 CACATGCTGTTCCCGCTGCCTGG + Intronic
1167338765 19:48902767-48902789 CTCATGCTGTTCCCTCTGCCTGG - Intronic
1167396756 19:49234649-49234671 CACATGCAGTTCCCTCTGCCTGG - Intergenic
1167490670 19:49791140-49791162 CACAGGCTGTTCCCTCTGCCTGG + Intronic
1167537684 19:50065533-50065555 CACATGCTGTTCCCTCTGTCTGG - Intergenic
1167553057 19:50174303-50174325 CACATGCTGACTCTTCTGCCTGG + Intergenic
1167562224 19:50232770-50232792 CACAGGCTGTTCCCTCTGCCAGG - Intronic
1168486626 19:56768079-56768101 CTCATGCTGTTTCCTCTGCCCGG + Intergenic
924997537 2:376245-376267 CTTAGCCTGAACCCTCTGGCTGG - Intergenic
925259102 2:2514510-2514532 CTCATGCTAAACATTCTGCTAGG + Intergenic
925984041 2:9200794-9200816 CTCATGGGGACTCCTCTGCCTGG - Intergenic
926036427 2:9639446-9639468 CTGATGCTGAAACCTCGGCCTGG + Intergenic
926163283 2:10502711-10502733 CACAGGCTGCACTCTCTGCCTGG + Intergenic
926207465 2:10844254-10844276 CTCCTGCTGTATCCTCTGCCAGG - Intergenic
926295205 2:11564066-11564088 CACATGCTGTTCCCTCTGTCTGG - Intronic
926683212 2:15679691-15679713 CTCATACTGTTTCCTCTGCCTGG + Intergenic
926884782 2:17586885-17586907 CTCATGCTTAGACTTCTGCCTGG - Intronic
926917816 2:17909723-17909745 CAGTGGCTGAACCCTCTGCCTGG - Intronic
927096503 2:19751313-19751335 CTCATGCTGTTCCCTTGGCCTGG - Intergenic
927172350 2:20380818-20380840 CTCATGCAGGACCCTCTCCCTGG + Intergenic
927254913 2:21032641-21032663 CTCATGGTGTGTCCTCTGCCAGG + Intronic
927699039 2:25256341-25256363 CTCATGCTGTTCCTTCTTCCTGG + Intronic
927902591 2:26831542-26831564 CTCATGCTGAACTTCCTGGCTGG - Intergenic
928072023 2:28226733-28226755 CTCCTGCTGTTCTCTCTGCCTGG - Intronic
929876497 2:45801039-45801061 CTTATGCTGTTCCCCCTGCCTGG - Intronic
930114623 2:47707950-47707972 CTCAAGCTGTTCCCACTGCCTGG - Intronic
930688427 2:54333390-54333412 CACATGCTGTTCGCTCTGCCTGG - Intronic
930845278 2:55896987-55897009 CAAATGCTGCTCCCTCTGCCTGG + Intronic
931705350 2:64942362-64942384 TACATGCTGCTCCCTCTGCCTGG + Intergenic
932003986 2:67909639-67909661 CTCATGCTGTTCCCTGTGACTGG + Intergenic
932172521 2:69570253-69570275 CACATGCTGTTTCCTCTGCCTGG + Intronic
932623450 2:73280586-73280608 CTCATGCTGGTCCCTCTTCCTGG + Intronic
932697448 2:73968610-73968632 CTCATGCTGTGCGCTCTCCCTGG + Intergenic
932714970 2:74094270-74094292 CACACGCTGGTCCCTCTGCCTGG - Intronic
932996088 2:76855104-76855126 CTCTTGCAGTCCCCTCTGCCTGG - Intronic
933699440 2:85244084-85244106 CACCTGCTGTTCCCTCTGCCTGG - Intronic
934120020 2:88829378-88829400 CACATGCTGTTCCCTCTGCATGG - Intergenic
934991221 2:98922833-98922855 CTAATGCTGAAAGCTCTACCAGG + Intronic
935005141 2:99067146-99067168 CTCATGTTGTTCCCACTGCCTGG + Intronic
935040080 2:99417618-99417640 CTCTTTCTGAAGCCTCTGCTTGG - Intronic
935064133 2:99633483-99633505 CACATGCTGGACCTTCTCCCTGG - Intronic
935568544 2:104635147-104635169 CACATGCTGGTCCTTCTGCCTGG + Intergenic
935742388 2:106161113-106161135 CACATGCTGAGCCAGCTGCCTGG + Intronic
935790943 2:106589587-106589609 CACTTGCTTTACCCTCTGCCTGG - Intergenic
936512486 2:113159387-113159409 CACTTGCTGTTCCCTCTGCCTGG - Intronic
937225399 2:120366029-120366051 CACATGCTGTCCCCTCTGTCTGG - Intergenic
937236039 2:120432453-120432475 CACCTGCTGTTCCCTCTGCCTGG + Intergenic
937337938 2:121073101-121073123 CACATGCTGTTCCCTCTGCCAGG + Intergenic
937499402 2:122461991-122462013 CACATGCTGTCCCCTCTACCAGG - Intergenic
940720865 2:157280333-157280355 CTCTGGGTGAAACCTCTGCCTGG - Intronic
940923612 2:159338731-159338753 CTCATGCTGTTCCCACTTCCTGG + Intronic
941999019 2:171627708-171627730 CTCATTCTGCCCACTCTGCCTGG - Intergenic
942232741 2:173875015-173875037 ATCATGCTTCACCCTTTGCCTGG - Intergenic
942315697 2:174694553-174694575 CTCATGCTGTTCCTTCTGCTTGG + Intergenic
943797363 2:192013316-192013338 CACTTGCTGTTCCCTCTGCCTGG + Intronic
944657449 2:201890320-201890342 CTCATGCTGATCCCTCAACCGGG + Intronic
944966326 2:204938375-204938397 CACATGCTGTTCCCTCTGCGTGG + Intronic
945495271 2:210500884-210500906 CTCATGGAGAACCCTCTGCTAGG - Intronic
945773547 2:214076991-214077013 CTCATGCTGCACACTCCTCCAGG - Intronic
945929776 2:215843112-215843134 CTCCAGCTGCTCCCTCTGCCTGG + Intergenic
945939050 2:215930126-215930148 CACTTGCTGTTCCCTCTGCCTGG + Intergenic
946393950 2:219434206-219434228 TTCATGCCGTTCCCTCTGCCTGG + Intergenic
946952505 2:224892611-224892633 CTCTTGCAGCTCCCTCTGCCAGG - Intronic
947329115 2:229009679-229009701 CACATGTTGTCCCCTCTGCCTGG - Intronic
947364300 2:229378400-229378422 CCCATGCTGTTCCCTATGCCTGG - Intronic
947844430 2:233232557-233232579 CTCTAGCTGATCCCTCTGCCTGG + Intronic
947846177 2:233245588-233245610 GTCATGTTGAATCCTCTGGCCGG + Intronic
948076398 2:235168293-235168315 CTCATGCTGTTTCCTCTGCTGGG - Intergenic
948596483 2:239082682-239082704 CTCCTGCCGAACGCCCTGCCTGG - Intronic
948733780 2:239984839-239984861 CTGCTGCTGAAAGCTCTGCCGGG - Intronic
948880242 2:240853125-240853147 GTCATGCTGCACCCTCTGCCCGG + Intergenic
1168800282 20:640302-640324 CATATGCTGTTCCCTCTGCCTGG + Intergenic
1168845403 20:941122-941144 CACTTGCTGTTCCCTCTGCCAGG - Intergenic
1168860244 20:1041001-1041023 CACACGCTGTTCCCTCTGCCTGG + Intergenic
1168889403 20:1284675-1284697 CACATGCTGTTCCTTCTGCCTGG - Intronic
1168978256 20:1983926-1983948 CACATGCTGTTCCCTCCGCCTGG + Intronic
1169206697 20:3744829-3744851 CACATGCTGTTCCCTCTGCCTGG + Intronic
1169276120 20:4234827-4234849 CACATGCTCTTCCCTCTGCCTGG - Intronic
1169489734 20:6061367-6061389 CACATACTGGGCCCTCTGCCTGG - Intergenic
1169965808 20:11215985-11216007 CACCTGCTGTAGCCTCTGCCTGG + Intergenic
1170175212 20:13461116-13461138 CACATGCTGTTCCCTCTGTCTGG + Intronic
1170457193 20:16544248-16544270 CTCATGCTGGTCCTTCTGCCTGG + Intronic
1170502719 20:16991165-16991187 CACATGCTGTTCCCTCTGCTTGG - Intergenic
1170778653 20:19403721-19403743 CGCATGCTGTTCCCTCTACCTGG - Intronic
1171129285 20:22634136-22634158 CACATGCTGTTCCCTCTGCCTGG - Intergenic
1171355011 20:24537175-24537197 CCTATGCTGTTCCCTCTGCCTGG + Intronic
1171446025 20:25205540-25205562 ATCATGTTGCAGCCTCTGCCTGG - Intronic
1171933893 20:31255414-31255436 CTCTTGCTGTTCTCTCTGCCTGG + Intergenic
1172036151 20:32012056-32012078 CACATGCTGTGCCCTCTGCTTGG + Intronic
1172038681 20:32028728-32028750 CACCTGCTGGTCCCTCTGCCTGG - Intronic
1172060634 20:32184936-32184958 CTCATGTTGTTCGCTCTGCCAGG + Intergenic
1172067844 20:32234211-32234233 CTTGTGCTGTTCCCTCTGCCTGG - Intronic
1172187443 20:33039949-33039971 CACATGCTGGAACCTCTGCCTGG - Intronic
1172192099 20:33068388-33068410 CACTTGCTGCTCCCTCTGCCTGG - Intronic
1172197015 20:33098919-33098941 CAGATGCTGTTCCCTCTGCCTGG + Intronic
1172281547 20:33711367-33711389 CACGTGCTGAGCCCTCTGCCTGG - Intronic
1172472724 20:35212241-35212263 GACATGCTGCATCCTCTGCCTGG - Intergenic
1172621596 20:36321241-36321263 CACGTGCTGTTCCCTCTGCCAGG - Intronic
1172633479 20:36394058-36394080 CACATGCTGTCCCCTGTGCCTGG + Intronic
1172813966 20:37671838-37671860 TTCATGCTATTCCCTCTGCCTGG - Intergenic
1172816345 20:37690152-37690174 CTCATGCTGTTCCCTCTGCCTGG + Intergenic
1172845762 20:37929222-37929244 CACCTGCTGATTCCTCTGCCTGG - Intronic
1172847982 20:37941374-37941396 CGCGTGCTGGGCCCTCTGCCTGG - Intronic
1172881553 20:38203091-38203113 CCCATGCTGTACCCTCCTCCTGG - Intergenic
1172892893 20:38279518-38279540 CTCATGCTGATCCTCCTGCCTGG - Intronic
1173185947 20:40840407-40840429 CACGTGCTGTTCCCTCTGCCAGG - Intergenic
1173288640 20:41694944-41694966 CACTTGCTGATCCCTCTGCCTGG - Intergenic
1173526668 20:43738192-43738214 CTCATGCTGGTCCACCTGCCAGG - Intergenic
1173550447 20:43929530-43929552 CACATGCTGTTCCCTTTGCCTGG + Intronic
1173552720 20:43944465-43944487 TTCATGCTGTTCCCTCTGCCTGG - Intronic
1173646879 20:44638916-44638938 CACATGCTGTTCCTTCTGCCTGG - Intronic
1173905678 20:46626857-46626879 CACCTGCTGTTCCCTCTGCCTGG + Intronic
1173949393 20:46978455-46978477 TACATGCTGTTCCCTCTGCCTGG - Intronic
1174201058 20:48806773-48806795 CTGATGCTGAGCCCAGTGCCTGG - Intronic
1174273953 20:49390011-49390033 CACTTGCTGTTCCCTCTGCCTGG - Intronic
1174503022 20:50999523-50999545 CACTTGCTGTACCCTCTGCCTGG - Intergenic
1174545568 20:51322579-51322601 CTCCTGCTGTGTCCTCTGCCGGG + Intergenic
1174592754 20:51659070-51659092 CACTTGCTGTGCCCTCTGCCTGG + Intronic
1174634673 20:51988732-51988754 CTCTGGCTGTTCCCTCTGCCCGG - Intergenic
1174692977 20:52527471-52527493 GTCATGCTGCTCCCTCTACCTGG - Intergenic
1174715292 20:52751073-52751095 TTGAGGCTGAACCCTCAGCCAGG + Intergenic
1174930093 20:54804303-54804325 CTCATGCTGATTTCTCTGTCTGG - Intergenic
1175283582 20:57821439-57821461 CACCTGCTGTCCCCTCTGCCTGG + Intergenic
1175498052 20:59428821-59428843 CCCCTGTTGTACCCTCTGCCTGG - Intergenic
1175520580 20:59600127-59600149 CTCAGGCTGTTCCCTCTGCCCGG + Intronic
1178319990 21:31597886-31597908 CGCCGGCTGCACCCTCTGCCGGG - Intergenic
1178361308 21:31950481-31950503 CATATGCTGTTCCCTCTGCCTGG - Intronic
1178578641 21:33817333-33817355 CCCATGCTGCGCCCTCGGCCTGG + Intronic
1178744167 21:35231626-35231648 CAAATGCTTAACCCTGTGCCTGG - Intronic
1178829667 21:36045324-36045346 CTCGTGCTGCATCCTCTGTCCGG - Intronic
1178876140 21:36415590-36415612 CTCCTGCTGAACCCACTCCCTGG - Intronic
1180597607 22:16988873-16988895 CTTATGCTGTTCCTTCTGCCTGG + Intronic
1180913928 22:19472277-19472299 CTCAGGCTGCCACCTCTGCCTGG - Intronic
1181036054 22:20170217-20170239 CTCATGCAGAACCCTTGTCCAGG + Intergenic
1181148632 22:20866707-20866729 CACAAGCTGCACCCTCTGCCTGG + Intronic
1181761991 22:25065060-25065082 CTCAGGCAGTGCCCTCTGCCAGG - Intronic
1181763181 22:25072087-25072109 CACATGCTGTTCCCTCTGCCTGG - Intronic
1181771237 22:25127306-25127328 CACAAGCTGTTCCCTCTGCCTGG + Intronic
1181807332 22:25383111-25383133 CACTGGCTGATCCCTCTGCCTGG + Intronic
1182028812 22:27141288-27141310 TCCATGCTGCTCCCTCTGCCTGG - Intergenic
1182091365 22:27597129-27597151 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1182103122 22:27671290-27671312 CACATGCTGTTCCCTCTGCCGGG + Intergenic
1182127307 22:27825397-27825419 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1182280272 22:29214393-29214415 CTGGTGCTGGGCCCTCTGCCTGG - Intronic
1182418407 22:30236171-30236193 CTCAAGCTGAGGCCTCTGCTAGG + Intergenic
1182423706 22:30260894-30260916 CTTATGCTGTTCCCTCTGCCTGG - Intergenic
1182425086 22:30267440-30267462 CCCATCGTGCACCCTCTGCCAGG + Intergenic
1183016969 22:34996743-34996765 TTCATGCTTTCCCCTCTGCCTGG - Intergenic
1183023034 22:35042741-35042763 CACTTGCTGTTCCCTCTGCCAGG - Intergenic
1183242452 22:36668122-36668144 CGCATCCTGATGCCTCTGCCGGG + Intronic
1183315339 22:37133906-37133928 CACATGCTGTTTCCTCTGCCTGG + Intronic
1183316282 22:37138794-37138816 CACATGCCGATCCCACTGCCTGG - Intronic
1183345058 22:37302999-37303021 CTCCTGCTGGATCCCCTGCCAGG - Intronic
1183352576 22:37342431-37342453 CACAGGATGATCCCTCTGCCTGG - Intergenic
1183477741 22:38045226-38045248 CATATGCTGTTCCCTCTGCCTGG + Intergenic
1184088045 22:42277524-42277546 CCCATGCCGTGCCCTCTGCCTGG - Intronic
1184095836 22:42315792-42315814 CTCCTGCTGTTCCCTCTGCCTGG - Intronic
1184150738 22:42636930-42636952 CTCACGCTGCCCCCTCTGCCAGG + Intronic
1184196420 22:42932223-42932245 CACATGCTGTTCCCTCTGCCAGG + Intronic
1184262450 22:43326809-43326831 CTCATGCTGTTCCCTCTGCCTGG + Intronic
1184403053 22:44285030-44285052 CTCATGCTGAAAAATCTGGCTGG + Intronic
1184424639 22:44402362-44402384 CACATGCTGTTCCCTCTGCCAGG - Intergenic
1184474078 22:44711323-44711345 ATCCTGCTGTTCCCTCTGCCTGG - Intronic
1184763179 22:46557168-46557190 CACGTGCTGTTCCCTCTGCCTGG - Intergenic
1184911800 22:47540230-47540252 CTCCTGCTGCACCCTGTGGCTGG - Intergenic
1184935779 22:47719400-47719422 CTCATGCTGTAGCCTCTGCCAGG + Intergenic
949265397 3:2151393-2151415 CCCATGCTGTTCCTTCTGCCTGG - Intronic
949529047 3:4935548-4935570 CTCCTGCTGGTCCCTCTGCTGGG + Intergenic
949939562 3:9144389-9144411 CTGATGCAGATTCCTCTGCCTGG + Intronic
950100564 3:10354053-10354075 CTCATTCTGTCCCCTCTGCCTGG + Intronic
950159446 3:10748890-10748912 TTCATGCTACTCCCTCTGCCTGG + Intergenic
950395207 3:12728740-12728762 CCCATGCTGTGACCTCTGCCTGG + Intergenic
950451129 3:13066526-13066548 CCCATGCTGGCTCCTCTGCCGGG - Intronic
950457201 3:13099846-13099868 CACATGCCGTGCCCTCTGCCAGG - Intergenic
950485164 3:13269066-13269088 TTCATGCTGTTCCCGCTGCCTGG - Intergenic
950538468 3:13595346-13595368 CTCAGGCAGAGCCCGCTGCCTGG + Intronic
950549507 3:13657731-13657753 CTCCTGCAGGTCCCTCTGCCTGG - Intergenic
950905113 3:16530872-16530894 CACATGCTGGTCCCTCTGCCAGG - Intergenic
951137929 3:19125970-19125992 CCCATGCTCCACCCTCTGGCAGG - Intergenic
953091617 3:39732673-39732695 TTCATGCTGTTTCCTCTGCCTGG - Intergenic
953366745 3:42351734-42351756 CTTATGCTGCTCCCTCTGTCTGG - Intergenic
953368374 3:42366486-42366508 CTCAAGCTGTTCCCACTGCCTGG + Intergenic
954387220 3:50250475-50250497 CTCATGCTGTTCTCTTTGCCGGG - Intronic
954687269 3:52377681-52377703 CCCTTGCTGTCCCCTCTGCCTGG + Intronic
954692492 3:52403084-52403106 CTCAGGCCTTACCCTCTGCCAGG + Intronic
954793768 3:53150972-53150994 CTCAGGCTGTTCCTTCTGCCTGG + Intergenic
954798212 3:53172227-53172249 CTCTTGCTGAGCCCACTTCCTGG + Intronic
955126418 3:56116659-56116681 CTCATGCTGTGCCCTCAACCTGG + Intronic
955905615 3:63804493-63804515 CACATGCTGCTCCCTCTGCCTGG + Intergenic
956012378 3:64845352-64845374 CACATGCTCTTCCCTCTGCCTGG + Intergenic
956067472 3:65412232-65412254 CTCTGGCTGCTCCCTCTGCCTGG + Intronic
956221248 3:66906188-66906210 CACATGCTGTTCCCTCTGCCTGG + Intergenic
956365488 3:68497548-68497570 CTCAGGCTGATTCTTCTGCCAGG - Intronic
956471062 3:69567250-69567272 CTTATGCTGCTTCCTCTGCCTGG + Intergenic
956718253 3:72097185-72097207 CACTTGCTGTTCCCTCTGCCTGG - Intergenic
957061989 3:75489744-75489766 CACATGCTGTTCCCTCTGCCTGG + Intergenic
959149673 3:102593180-102593202 CTCATGTTGTTCTCTCTGCCTGG + Intergenic
959892437 3:111571123-111571145 CACATGCTGTTCCCTCTACCTGG + Intronic
959967315 3:112371744-112371766 CATATGCTGATCTCTCTGCCTGG - Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960130460 3:114050598-114050620 CTCACGTTGATCCCTCAGCCTGG - Intronic
960173779 3:114493597-114493619 TTCATGCTGTTCCCTCTGCCTGG + Intronic
961219399 3:125187768-125187790 CTCATGCTGATTCCCCTGCCTGG + Intronic
961291414 3:125849657-125849679 CACATGCTGTTCCCTCTGCCTGG - Intergenic
961517327 3:127446072-127446094 ATCCTGCTGTTCCCTCTGCCTGG - Intergenic
961533060 3:127551612-127551634 CCCTTGCTGTCCCCTCTGCCTGG + Intergenic
961653871 3:128430872-128430894 CTCTTGCTGTTCCCTCCGCCTGG - Intergenic
961744752 3:129057388-129057410 CACTTGCTGTTCCCTCTGCCTGG - Intergenic
961895761 3:130166691-130166713 CACATGCTCTTCCCTCTGCCTGG + Intergenic
962041273 3:131709808-131709830 CTCTTGCTCTTCCCTCTGCCTGG + Intronic
962446966 3:135474534-135474556 CTCATGCTGTTCCCTTTGCTGGG - Intergenic
962902525 3:139773835-139773857 CACATGTTGTTCCCTCTGCCTGG - Intergenic
963007611 3:140740712-140740734 ATCATGCTGCACTCTGTGCCTGG - Intergenic
964409190 3:156380558-156380580 CACAGGCTGATCCCTCTACCTGG - Intronic
964588532 3:158335314-158335336 CTCATGCCAAACCCTCTACTTGG - Intronic
965656230 3:170988601-170988623 TTCAGGCTGTTCCCTCTGCCAGG - Intergenic
965666067 3:171094655-171094677 CACATGCTGTTCCCTCTGCCTGG + Intronic
965681785 3:171259397-171259419 CTATTCCTGAACACTCTGCCTGG + Intronic
965734062 3:171802502-171802524 ATCATGCTATTCCCTCTGCCTGG - Intronic
966734150 3:183175692-183175714 CTCATGCTATTCCCTCTGCCAGG + Intergenic
967135870 3:186512158-186512180 CTCTTGCTGTTCCCTCTGCCAGG - Intergenic
967172146 3:186830067-186830089 CTCATGCTATTCCCTCCGCCAGG - Intergenic
967210303 3:187162384-187162406 CTCAAGATGATCCCTCTCCCTGG - Intronic
967282895 3:187839542-187839564 CTCAGGCTGTTCCCTCTGCTTGG - Intergenic
967299152 3:187995360-187995382 TTCATGCTGTTCCCTCTGCTGGG - Intergenic
967629725 3:191731458-191731480 CCTATACTCAACCCTCTGCCAGG + Intergenic
967702593 3:192610820-192610842 CTCTTGCTGTGCCCTCAGCCTGG + Intronic
967713649 3:192738652-192738674 TTAATGCTGAAACCTCTGTCAGG - Intronic
969005883 4:4019835-4019857 CACATGCTGTTCCCTCTGCCTGG + Intergenic
969152940 4:5185979-5186001 CTCAGGCTGTGCCCTCTGCCTGG + Intronic
969260707 4:6031528-6031550 CACATGCCGTTCCCTCTGCCTGG - Intronic
969286691 4:6206937-6206959 CACATGCTGGTCCCTCTGCATGG - Intergenic
969293146 4:6253237-6253259 CACTTGCTGTTCCCTCTGCCTGG - Intergenic
969300072 4:6292375-6292397 CTCATGCTGTTCCCTCTGCCCGG - Intronic
969363506 4:6680559-6680581 CCCATGCTGAATCCCCTGACTGG + Intergenic
969807066 4:9617455-9617477 CACATGCTGTTCCCTCTGCCTGG - Intergenic
971268819 4:25118206-25118228 CTCAAGCTAGTCCCTCTGCCTGG - Intergenic
971791094 4:31170643-31170665 TTCAGCCTGAACCATCTGCCAGG + Intergenic
972501541 4:39682654-39682676 CTTATGCTGTTCTCTCTGCCTGG - Intergenic
972573163 4:40328965-40328987 CTCCTTCTGTTCCCTCTGCCTGG - Intergenic
975558340 4:75686527-75686549 CTCTTGCTGTTCCTTCTGCCAGG - Intronic
976116948 4:81738059-81738081 CACAAGCTGCTCCCTCTGCCTGG + Intronic
976782269 4:88774088-88774110 AGCATGCTGCTCCCTCTGCCTGG + Intronic
976786591 4:88828038-88828060 CTCATGCTGTTCCCTCTGTCTGG + Intronic
977407837 4:96622395-96622417 CTCATGTGGAACACTCTGGCTGG + Intergenic
979449613 4:120854860-120854882 CACTTGCTGTACCCTCTGCTTGG - Intronic
980387449 4:132104636-132104658 CTCCTGCTTCACCTTCTGCCAGG + Intergenic
981416196 4:144496677-144496699 ATCATGCTAAATCCACTGCCTGG + Intergenic
981831051 4:149002261-149002283 CGCATGATGGACCCTCTGTCTGG + Intergenic
982178768 4:152730865-152730887 CACATGCTGTTCCCTCTGCATGG - Intronic
982731218 4:158957388-158957410 CTCATGCTTTTCTCTCTGCCAGG + Intronic
983566493 4:169158330-169158352 CTGGTGCTGACCCCTCTGCCTGG - Intronic
984157596 4:176210621-176210643 CAAATGCTGTTCCCTCTGCCTGG - Intergenic
984597653 4:181689139-181689161 CACATGCAGAACCCCCTGCCTGG + Intergenic
986243795 5:5986331-5986353 CTCATGCAGACCAATCTGCCTGG + Intergenic
986311105 5:6551741-6551763 CCCAGGCTGTGCCCTCTGCCTGG + Intergenic
987122856 5:14784029-14784051 CTGATGCTGCAGCCTCTACCAGG - Intronic
987360916 5:17105709-17105731 CACTTGCTGTTCCCTCTGCCTGG - Intronic
987856058 5:23422356-23422378 CTCTTGCTGCTCCCACTGCCTGG - Intergenic
988439878 5:31220840-31220862 CCCATGCTGACCCCTCTTCCTGG - Intronic
988998642 5:36738600-36738622 CTCATTCTGTTCCTTCTGCCTGG + Intergenic
990596134 5:57314313-57314335 CACATGCAGATCCATCTGCCTGG + Intergenic
990599655 5:57344899-57344921 CACATGCTGCTCACTCTGCCAGG + Intergenic
990716724 5:58645804-58645826 CTCATTCTGCTCCCTCTGCCTGG - Intronic
990844955 5:60127114-60127136 CTCATGCTGTTCTCTCTGCCAGG - Intronic
991406476 5:66305392-66305414 CACATGCTGTTCCCTCTGACTGG - Intergenic
991533909 5:67645538-67645560 CACTTGCTGCTCCCTCTGCCTGG - Intergenic
992331904 5:75725654-75725676 CTCATGCTGATTCCTCTGTGAGG + Intergenic
992885875 5:81159942-81159964 CTCTTTTTGAACCCTCTCCCAGG + Intronic
992986892 5:82239579-82239601 CACATGCTGTTCTCTCTGCCTGG - Intronic
993705264 5:91162396-91162418 CTTATGCTGGCACCTCTGCCTGG - Intronic
993721578 5:91326237-91326259 CACATGCTGTTCCGTCTGCCTGG + Intergenic
993866544 5:93203293-93203315 TTCATGCTGCTCCCTCTGCCTGG - Intergenic
994112777 5:96025815-96025837 CACATGCTGTTCCCACTGCCTGG - Intergenic
995247119 5:109946840-109946862 CACATGCTAAAGCCTCTGCCTGG + Intergenic
995380993 5:111533049-111533071 CTCTTGCTGCTGCCTCTGCCTGG + Intergenic
995397514 5:111702957-111702979 CTCCTGGTAGACCCTCTGCCTGG - Intronic
996395057 5:123005303-123005325 CACTTGCTGTTCCCTCTGCCAGG + Intronic
997047941 5:130342346-130342368 CACATGCTGTTCCATCTGCCTGG - Intergenic
997211293 5:132078529-132078551 CCCATGCTGATCCCTGTGCATGG - Intergenic
997675210 5:135707575-135707597 CACCTGCTGTTCCCTCTGCCTGG + Intergenic
997786404 5:136717847-136717869 CACATGCTGTTCCCTCTCCCAGG - Intergenic
998082827 5:139291180-139291202 CACATTCTGATCCCTCTGCCTGG + Intronic
998396095 5:141819121-141819143 CACTTGCTGTGCCCTCTGCCTGG + Intergenic
998458532 5:142292431-142292453 CACATGCTGCTCCCTCTGCCTGG - Intergenic
998663048 5:144262238-144262260 CTTTTGCTGTTCCCTCTGCCTGG - Intronic
998715004 5:144873079-144873101 CTGATTCTAAACCCTCTCCCTGG - Intergenic
999466770 5:151814624-151814646 CTCATACTGTTCCCTCTGCCTGG + Intergenic
1000166509 5:158654509-158654531 CACATACTGTTCCCTCTGCCTGG - Intergenic
1000223010 5:159232438-159232460 CTCATGCTCTTCCCTCTGCCTGG - Intergenic
1000341382 5:160279685-160279707 CACATGCTGTTCCCTCTACCTGG - Intronic
1000621471 5:163491374-163491396 CTCATTCTGAACCCTTTCGCTGG + Exonic
1001197002 5:169682351-169682373 CACCTGCTGTGCCCTCTGCCTGG - Intronic
1001315327 5:170637604-170637626 CTCAGGCTGTTCCCACTGCCTGG + Intronic
1001402147 5:171451794-171451816 TCCATGCTGTGCCCTCTGCCGGG + Intronic
1001407491 5:171486152-171486174 ATCATGCTGAGCCCTGGGCCTGG - Intergenic
1001434094 5:171685989-171686011 CCCATGCTTTCCCCTCTGCCTGG + Intergenic
1001449388 5:171812532-171812554 CTCAAGCTCTCCCCTCTGCCTGG + Intergenic
1001554239 5:172625372-172625394 CTCATGCAGTCCCCTCTGCCTGG + Intergenic
1001875190 5:175194271-175194293 CCCATGCTGTATCCTTTGCCTGG - Intergenic
1001883873 5:175270895-175270917 CACATGCTGTACCCTCTGCCTGG - Intergenic
1001905862 5:175472537-175472559 CATATGCTGTTCCCTCTGCCTGG - Intergenic
1002132841 5:177092009-177092031 CTCGGGCTGCGCCCTCTGCCTGG - Intronic
1002403406 5:179007715-179007737 CACTTGCTGTCCCCTCTGCCTGG - Intergenic
1002719385 5:181248484-181248506 CCTACGCTGATCCCTCTGCCTGG - Intergenic
1002967765 6:1984213-1984235 CTCATTCTCCACCCTCTGACAGG - Intronic
1004039422 6:11961073-11961095 CTAACCCTGCACCCTCTGCCTGG + Intergenic
1004187726 6:13435301-13435323 CACATGCTGTACCCTCTGCCGGG + Intronic
1004631657 6:17427166-17427188 CTCTTGCTGTTCCCTCTGTCTGG - Intronic
1006444220 6:34069830-34069852 CACATGCTGCTCCCTCTGCCAGG + Intronic
1006471324 6:34230772-34230794 CACTTGCTGTGCCCTCTGCCTGG - Intergenic
1006535370 6:34695645-34695667 CCCCAGATGAACCCTCTGCCAGG + Intronic
1006548963 6:34804519-34804541 TTCATGCGGCTCCCTCTGCCTGG - Intronic
1006793768 6:36719755-36719777 CACCTGCTGTTCCCTCTGCCTGG - Intronic
1007152982 6:39713134-39713156 CTCTTGCTGTTCCCTCTGCCCGG - Intronic
1007228191 6:40329291-40329313 CTCATGCTGATCCCACTCCCGGG - Intergenic
1007305498 6:40900845-40900867 CTCGTGCTGTGCCCTCTGCCAGG - Intergenic
1007386027 6:41520764-41520786 CTCAGGCAGAACCCTCAGCCAGG + Intergenic
1007416072 6:41691958-41691980 CACTTGCTGTTCCCTCTGCCTGG + Intronic
1007973192 6:46073802-46073824 CTTCTGCTGAGCCCACTGCCTGG + Intronic
1008062061 6:47009033-47009055 CTCATTCTGACCCCTCTGCTAGG - Exonic
1008535947 6:52506208-52506230 CTCAGGCTGTCCCCTGTGCCTGG + Intronic
1009437130 6:63631805-63631827 CTCATGCTGCTCCTTCTGACAGG - Intergenic
1009744656 6:67797422-67797444 CTAATGCTACTCCCTCTGCCTGG - Intergenic
1010285666 6:74074707-74074729 GTCATGCTGAACCTTGTGCTTGG - Intergenic
1010369689 6:75092970-75092992 TTCATGCTGTTTCCTCTGCCTGG + Intronic
1011246294 6:85324539-85324561 CACATGCTTATCTCTCTGCCTGG - Intergenic
1011672709 6:89698914-89698936 CTAATGTGGAACCCTTTGCCTGG - Exonic
1012141871 6:95635519-95635541 CTCATGCTGCCCTCTCAGCCTGG + Intergenic
1012414157 6:98994301-98994323 CATATGCTGTACCATCTGCCAGG + Intergenic
1012417723 6:99027697-99027719 CTCTTGCTGTGCCCTCTGCCTGG - Intergenic
1012496967 6:99844285-99844307 CACTTGCTGAACCCTCTGCCAGG - Intergenic
1013071306 6:106731819-106731841 CACGTGCTGCTCCCTCTGCCTGG + Intergenic
1013630789 6:111984132-111984154 CACATGCTGTTCCCTGTGCCTGG - Intergenic
1014202328 6:118620596-118620618 CTCTTGCTGAATCATCTGGCTGG - Intronic
1014634519 6:123828765-123828787 TTCATGCTGTACCCTCAACCAGG + Intronic
1015012999 6:128374951-128374973 CACTTGCTGATCCCTATGCCTGG + Intronic
1015593752 6:134846412-134846434 TGCATGCTGTTCCCTCTGCCTGG - Intergenic
1016991808 6:149935307-149935329 CTCATGCTTGTCCCTCTGCTGGG + Intergenic
1017007930 6:150041312-150041334 CTCATCCTTGTCCCTCTGCCAGG - Intergenic
1017485785 6:154900812-154900834 CTAATGCTGCCTCCTCTGCCAGG - Intronic
1018203285 6:161414385-161414407 CTCAGGCAGAAACCTTTGCCTGG - Intronic
1018258290 6:161944045-161944067 CTCAGGCTGATCCCTCAGGCTGG - Intronic
1018258300 6:161944084-161944106 CTCAGGCTGATCCCTCAGGCTGG - Intronic
1018258309 6:161944123-161944145 CTCAGGCTGATCCCTCAGGCTGG - Intronic
1018269120 6:162056779-162056801 GTCATGCAGACACCTCTGCCTGG - Intronic
1018651909 6:165999247-165999269 CTGATGCTCAGTCCTCTGCCAGG + Intergenic
1019304730 7:327877-327899 CTCATTCTAATCTCTCTGCCTGG + Intergenic
1019559995 7:1651160-1651182 CTCATGCTGGTGCCTCCGCCTGG - Intergenic
1019569671 7:1705014-1705036 CACTTGCTGTGCCCTCTGCCTGG - Intronic
1019742013 7:2679776-2679798 CCCAGGCTGTGCCCTCTGCCTGG - Intronic
1020084120 7:5301492-5301514 CACATGCTGCTCCCTCTTCCTGG - Intronic
1020112730 7:5456573-5456595 CACAAGCTGTTCCCTCTGCCTGG - Intronic
1020326438 7:6978140-6978162 CACATGCTCTTCCCTCTGCCTGG + Intergenic
1021197579 7:17690225-17690247 CTCATGCTGCACACTCTGACGGG + Intergenic
1021430988 7:20559352-20559374 CTCATTCTGCCCACTCTGCCCGG + Intergenic
1021603626 7:22389315-22389337 CTCTTACTGTTCCCTCTGCCTGG - Intergenic
1022132202 7:27414900-27414922 CTCACGCAGACCCCTCTGCAGGG - Intergenic
1022162063 7:27720907-27720929 CACATGCTGTCACCTCTGCCAGG - Intergenic
1022341169 7:29469565-29469587 CATGTGCTGTACCCTCTGCCTGG + Intronic
1023035827 7:36130730-36130752 CACATGCTGTTCCTTCTGCCTGG - Intergenic
1024249045 7:47492495-47492517 CCCAGGCTGCTCCCTCTGCCTGG + Intronic
1024959536 7:54959965-54959987 CTCACCCTGTACCCTCTTCCTGG - Intergenic
1025129533 7:56368281-56368303 CTCACGCTGACCTCTCTGCGTGG + Intergenic
1025210163 7:57015704-57015726 CACATGCTGTTCCCTCTTCCTGG + Intergenic
1025661788 7:63561147-63561169 CACATGCTGTTCCCTCTTCCTGG - Intergenic
1026892527 7:73990603-73990625 CATATGCTGTTCCCTCTGCCTGG + Intergenic
1028840050 7:95419377-95419399 CTCATGCTGTTCCTTGTGCCTGG - Intronic
1028860231 7:95640998-95641020 CTCATGCTTAGGACTCTGCCTGG + Intergenic
1029439689 7:100580130-100580152 CACATGCTGGGTCCTCTGCCTGG + Intronic
1029514277 7:101016154-101016176 CTCATGCAGTGCCCCCTGCCTGG - Intronic
1029607475 7:101607894-101607916 CTCATGCTGCTCCCTCTACCTGG - Intergenic
1029669323 7:102018255-102018277 CTCATGTCGAAACCTCTGACTGG - Intronic
1030161149 7:106509796-106509818 CTTATGCTGTTCCCTATGCCTGG - Intergenic
1031794345 7:126152443-126152465 CTCATGCTGCTCCCTCTTTCTGG + Intergenic
1032270926 7:130404662-130404684 CTGATGCTGAAACCACTGCCAGG - Exonic
1032417133 7:131744413-131744435 CTCATGCTCTTCCCTCAGCCAGG - Intergenic
1032429156 7:131846934-131846956 CTCATGCTGTTCCCTCTGCCTGG - Intergenic
1032448100 7:132001969-132001991 CACATGCTGCTCCCTCTGCCTGG - Intergenic
1033171997 7:139092637-139092659 CTAATGGGGAGCCCTCTGCCTGG + Intronic
1033233612 7:139620876-139620898 CTCATTCTCAACTCTCAGCCTGG + Intronic
1034674693 7:152884057-152884079 CCCATGCGCACCCCTCTGCCCGG - Intergenic
1035023482 7:155812025-155812047 CTCTTCCCGAACCCCCTGCCCGG + Exonic
1035206169 7:157295278-157295300 CACAGGCTGCTCCCTCTGCCTGG - Intergenic
1036288186 8:7462905-7462927 CTCATGCTGACGGGTCTGCCAGG - Intronic
1036333289 8:7848623-7848645 CTCATGCTGACGGGTCTGCCAGG + Intronic
1036690783 8:10943503-10943525 CTCCTGCTGTCCCCTCTGCCTGG + Intronic
1037250461 8:16887298-16887320 CACATGCTGATCCCTTTGTCTGG - Intergenic
1037310445 8:17550028-17550050 CTCCAGCTGAACCCACAGCCAGG - Intronic
1037460090 8:19100200-19100222 CACATGCTAGTCCCTCTGCCTGG - Intergenic
1037899743 8:22680838-22680860 CCCATGCTGAACACTGTACCTGG + Intergenic
1038248871 8:25884225-25884247 ATCTTGCTGTACCCTCTACCTGG + Intronic
1038444873 8:27596356-27596378 CTCATGTTGGAACCTCTGTCAGG + Intergenic
1038941512 8:32310896-32310918 CTCATGCTGTTCCCTCTACCTGG + Intronic
1040530602 8:48263602-48263624 CCCATGCTGATCCCTGTGCGAGG + Intergenic
1040536650 8:48316568-48316590 CTCTTGCTGTTCCCTCAGCCTGG - Intergenic
1040538068 8:48326981-48327003 TTCATGCTGAGCCCTCCCCCGGG - Intergenic
1041659603 8:60388512-60388534 AACATGCTGTTCCCTCTGCCTGG - Intergenic
1042096839 8:65225407-65225429 CTCATGCTCTATCTTCTGCCTGG + Intergenic
1042450996 8:68945595-68945617 CTCATGCTGCACTCTCTACTTGG + Intergenic
1042642959 8:70955671-70955693 CTCATTCTGCCCCCTCAGCCTGG + Intergenic
1042951360 8:74203697-74203719 CTCATGCTATTTCCTCTGCCTGG + Intergenic
1043823662 8:84899101-84899123 CATATGCTGTTCCCTCTGCCTGG + Intronic
1045427186 8:102078642-102078664 CTCATGCTGGCCTCTTTGCCTGG + Intronic
1046686794 8:117236795-117236817 CACTTGGTGTACCCTCTGCCTGG - Intergenic
1046743118 8:117849089-117849111 CACTTGCTGTGCCCTCTGCCTGG + Intronic
1046905205 8:119565270-119565292 CACATTCTGTTCCCTCTGCCTGG - Intronic
1047189736 8:122667213-122667235 CATTTGCTGAACCCTCTGACTGG + Intergenic
1047224384 8:122944034-122944056 CTCATGCTGTCTGCTCTGCCTGG + Intronic
1048293660 8:133198866-133198888 CACATGCTGTGCCCTCTACCAGG + Intronic
1048397091 8:134024150-134024172 CTCACTCTGCACTCTCTGCCTGG - Intergenic
1048810751 8:138283898-138283920 CCCATGCTGTTCCCTCTGCTTGG - Intronic
1048810850 8:138284622-138284644 CCCATGCTGTTCCCTCTGCTTGG + Intronic
1049118165 8:140708313-140708335 CTTATACTGTCCCCTCTGCCTGG + Intronic
1049147649 8:141013408-141013430 CACATGCTGTGCCTTCTGCCAGG - Intergenic
1049404577 8:142446561-142446583 CACATGCTGAACCCTGATCCTGG - Intergenic
1049404596 8:142446725-142446747 CACATGCTGAACCCTGATCCTGG - Intergenic
1049413123 8:142482461-142482483 CACATGCTGAACCCTGATCCTGG + Intronic
1049413238 8:142483131-142483153 CACATGCTGAACCCTGATCCTGG + Intronic
1049413272 8:142483317-142483339 CACATGCTGAACCCTGACCCTGG + Intronic
1049413344 8:142483700-142483722 CACATGCTGAACCCTGACCCTGG + Intronic
1049413349 8:142483724-142483746 CACATGCTGAACCCTGACCCTGG + Intronic
1049414398 8:142488691-142488713 TTCATCTTGACCCCTCTGCCTGG - Intronic
1049466577 8:142753692-142753714 CTCCTGCTGTTCCCACTGCCAGG + Intergenic
1050787152 9:9418186-9418208 TTCATGCTTAACACTTTGCCAGG - Intronic
1050964695 9:11784119-11784141 CTCTTGCTTCACCTTCTGCCAGG + Intergenic
1051504426 9:17812078-17812100 CTCTTGCTGAATCCTCTGTCTGG - Intergenic
1053123597 9:35562792-35562814 CTCATGCTGCCCCCACTGCCCGG + Intronic
1053294187 9:36901267-36901289 ATCATGCTGTTCCTTCTGCCTGG + Intronic
1053303011 9:36965020-36965042 CACTTGCTGTCCCCTCTGCCAGG + Intronic
1053462643 9:38282417-38282439 CTCAAGCTGCTCCTTCTGCCTGG - Intergenic
1056052376 9:82782751-82782773 CTCAAGCTGAAACTTCTGCATGG + Intergenic
1056688811 9:88788449-88788471 CCCTTGCTGACCCCTCTCCCTGG + Intergenic
1056708123 9:88968952-88968974 CCCATGTTAAACCCTCTGACAGG + Intergenic
1057185940 9:93057836-93057858 CACCTGCTGTTCCCTCTGCCAGG + Intergenic
1057191212 9:93088617-93088639 CACACGCTGTTCCCTCTGCCTGG + Intergenic
1057282761 9:93724811-93724833 CTCATGCTCTTCCCTGTGCCTGG - Intergenic
1057310248 9:93938494-93938516 CTCATGCTCTTCCATCTGCCTGG - Intergenic
1057729157 9:97593943-97593965 CTCATGCTGTTCCCTCTGCTTGG - Intronic
1057745547 9:97748186-97748208 CTCATGCTGTTTCCTCTGCCTGG + Intergenic
1057786553 9:98092399-98092421 CACTTGCTGTGCCCTCTGCCTGG + Intronic
1057884931 9:98822880-98822902 CTCAGACTGTTCCCTCTGCCTGG - Intronic
1058168608 9:101650786-101650808 CACATGCTGTTACCTCTGCCTGG + Intronic
1058180173 9:101788707-101788729 CTCCAGCTGTCCCCTCTGCCTGG + Intergenic
1058785373 9:108381547-108381569 CTCATACTGTTCCCTCTCCCTGG - Intergenic
1058830485 9:108811972-108811994 CACATGCTGTTCCTTCTGCCTGG + Intergenic
1058835670 9:108856747-108856769 CTCAAGCTGTGCTCTCTGCCTGG - Exonic
1058952480 9:109916574-109916596 CCCATGCTGTCTCCTCTGCCTGG + Intronic
1059424067 9:114209892-114209914 CACATGCTGTTCCCTATGCCTGG - Intronic
1059466881 9:114474558-114474580 GTCATGCTGTACCCTCTGTCTGG + Intronic
1059511612 9:114853159-114853181 CCCAAGCTGGGCCCTCTGCCTGG + Intergenic
1059987493 9:119834888-119834910 CTCCAGCTGGCCCCTCTGCCTGG + Intergenic
1060072576 9:120563205-120563227 TGCATGCTCCACCCTCTGCCTGG - Intronic
1060229877 9:121818701-121818723 GTCTTGCTGGCCCCTCTGCCTGG - Intergenic
1060733737 9:126053349-126053371 CCCATGCTGTTCCCTCTGCCTGG + Intergenic
1060975597 9:127763094-127763116 CACTTGCTGTTCCCTCTGCCTGG + Intronic
1060994581 9:127868805-127868827 CTCATGCTGTTCCCTCTGCTAGG + Intronic
1061212840 9:129203513-129203535 TTCATGCTGTTCCCTCTGACTGG - Intergenic
1061429717 9:130523468-130523490 CACATGCTGTTCCTTCTGCCTGG - Intergenic
1061482873 9:130905802-130905824 CACATGCTGTTCCCTCTGCCAGG + Intronic
1061495816 9:130973646-130973668 CGCAAGCTGCTCCCTCTGCCTGG + Intergenic
1061676699 9:132221241-132221263 CACATGCTGTTCCCTCTGCCTGG - Intronic
1061712293 9:132496875-132496897 CACATGCAGACCCCCCTGCCTGG - Intronic
1061734054 9:132640304-132640326 TTCATGCTAGTCCCTCTGCCTGG - Intronic
1061896925 9:133653031-133653053 CTCAGGCTGAACACTCGCCCTGG - Intronic
1062394776 9:136348358-136348380 GTCCTGCTGTTCCCTCTGCCTGG - Intronic
1185892672 X:3835173-3835195 CTCACGCTGGGCCCTCTGCCTGG - Intronic
1185897780 X:3873593-3873615 CTCACGCTGGGCCCTCTGCCTGG - Intergenic
1185902899 X:3912024-3912046 CTCACGCTGGGCCCTCTGCCTGG - Intergenic
1186798169 X:13066708-13066730 CTCTTCCTGAACCCTCTGTCTGG + Intergenic
1187244193 X:17539155-17539177 CCCTTGCTGTTCCCTCTGCCTGG + Intronic
1187452552 X:19411719-19411741 CACTTGCTGTTCCCTCTGCCTGG - Intronic
1189209136 X:39268140-39268162 CTCATGCTGTTCCTTCTACCTGG + Intergenic
1189447615 X:41095333-41095355 CTCAAGTTGATCCCTCTGACCGG - Intronic
1191673871 X:63774607-63774629 CTTATGTTGTACCCTCTGCTTGG + Intronic
1191740527 X:64432530-64432552 CCCATCCTGCCCCCTCTGCCTGG + Intergenic
1191849765 X:65577517-65577539 ATGAAGCTGAACCCTCAGCCTGG - Intergenic
1192233210 X:69279831-69279853 CTCATGCTGTTCCTGCTGCCTGG + Intergenic
1192656753 X:73001827-73001849 CACAGACTGATCCCTCTGCCTGG + Intergenic
1192665367 X:73081174-73081196 CACAGACTGATCCCTCTGCCTGG - Intergenic
1193565760 X:83075086-83075108 CACATGCTGTTTCCTCTGCCTGG - Intergenic
1193956007 X:87863610-87863632 CACATGATGTTCCCTCTGCCTGG + Intergenic
1194280421 X:91946042-91946064 CACATGCTGAATCCTCTCCGTGG + Intronic
1194703541 X:97145901-97145923 TTCATGCTGCATCCTCTGGCTGG + Intronic
1195053616 X:101121654-101121676 CTCATGCTGTTCCCTCTGGGAGG - Intronic
1195304158 X:103562670-103562692 CACATGCTGCTCCCACTGCCTGG + Intergenic
1195625941 X:107005935-107005957 CCCATGCTGAACCAACTGCCAGG - Intergenic
1196843568 X:119880684-119880706 CTTATGCTGTTCCCTCTGCTTGG - Intergenic
1196847211 X:119905689-119905711 CTCTTGCTGTTCCCTCTGCCTGG + Intronic
1197922935 X:131614692-131614714 CACTTGCTGTTCCCTCTGCCTGG + Intergenic
1198115480 X:133540798-133540820 GTCAGGCTGTACCCTCTGCCTGG - Intronic
1198338783 X:135693523-135693545 CGCATGCTGTACCCTGAGCCAGG - Intergenic
1198374787 X:136027981-136028003 CTCATACTGTTCCCTCTGCCTGG + Intronic
1198801933 X:140457155-140457177 CTAATGCAGTCCCCTCTGCCTGG + Intergenic
1199854446 X:151749087-151749109 CTCATGCTGTTCCCTCTGCCTGG + Intergenic
1200175833 X:154115654-154115676 GTCAGGCTGAACCCTCCTCCCGG + Intergenic
1200597898 Y:5169570-5169592 CACATGCTGAATCCTCTCCGTGG + Intronic
1201440566 Y:14003763-14003785 AGAATTCTGAACCCTCTGCCAGG - Intergenic
1201444005 Y:14038945-14038967 AGAATTCTGAACCCTCTGCCAGG + Intergenic
1202053145 Y:20801893-20801915 CTCATGGGGTACCATCTGCCAGG - Intergenic
1202096799 Y:21259744-21259766 CTCATGATGAACTCTCTCTCTGG - Intergenic