ID: 1095594042

View in Genome Browser
Species Human (GRCh38)
Location 12:43938754-43938776
Sequence CTTTGGAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095594034_1095594042 11 Left 1095594034 12:43938720-43938742 CCGGGCATGGTGGCTCATGCCTG 0: 8252
1: 39501
2: 100261
3: 172981
4: 199558
Right 1095594042 12:43938754-43938776 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1095594036_1095594042 -8 Left 1095594036 12:43938739-43938761 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1095594042 12:43938754-43938776 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095594042 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG Intronic
Too many off-targets to display for this crispr