ID: 1095612291

View in Genome Browser
Species Human (GRCh38)
Location 12:44144572-44144594
Sequence GATTGCTTCTTACCTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095612288_1095612291 -8 Left 1095612288 12:44144557-44144579 CCTGCCATTTCTATTGATTGCTT 0: 1
1: 0
2: 0
3: 21
4: 269
Right 1095612291 12:44144572-44144594 GATTGCTTCTTACCTGGAACAGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095612291 Original CRISPR GATTGCTTCTTACCTGGAAC AGG Intronic
900911483 1:5599808-5599830 GAAAGCTTCTTACCTGGAGCAGG + Intergenic
902953521 1:19907460-19907482 GATTGCTTTTCAGCAGGAACAGG - Intronic
903322356 1:22550745-22550767 GAATGGTTCTTCCCTGGAGCTGG + Intergenic
906061612 1:42952774-42952796 GTTTGTTTCTTTCCTTGAACTGG + Intronic
906823946 1:48958657-48958679 GATTTCTTAGTACCTGGGACTGG + Intronic
907309151 1:53529490-53529512 CATTGCTTCTTAACTGGGGCAGG + Intronic
909005495 1:70271307-70271329 GATTGCTTCTTATCTTTAAAGGG + Intronic
909906174 1:81198341-81198363 GATTGTCTCTTTCCTAGAACAGG + Intergenic
911988056 1:104656908-104656930 TATTGCAGCTTACCTGGCACTGG + Intergenic
912526175 1:110284832-110284854 GATTGCTGCTTACCTCAAAGTGG - Intergenic
915392362 1:155555721-155555743 CATTTCTTCTTAGCTGGCACAGG + Intronic
915668581 1:157467300-157467322 GCTTGCTTCTTGCCTGAATCAGG - Intergenic
916036949 1:160930812-160930834 GATTGCTTTCTACCTGAAGCTGG - Intergenic
917272941 1:173298293-173298315 GATTGCTGTTTACCTGGTGCAGG + Intergenic
917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG + Intronic
919579375 1:199352297-199352319 GATGGCTTCTTACAGGGAAAGGG - Intergenic
920104046 1:203537937-203537959 GATGGCTTCTTTCCTTGACCAGG - Intergenic
920266724 1:204729651-204729673 GGCTGCTGCTGACCTGGAACTGG + Intergenic
920349569 1:205328913-205328935 TATTGCTTATTTCCTGGATCTGG + Intergenic
1066095886 10:32071807-32071829 GATTGCTTCTTAAGGGAAACAGG - Intergenic
1067229482 10:44396579-44396601 GACTGCTTCTCAGCTGGGACTGG + Intergenic
1069656764 10:70095403-70095425 CATTTCTTCTTCCCTGGAACAGG - Intronic
1070784531 10:79155331-79155353 GTTTGCATCAGACCTGGAACTGG - Intronic
1072964368 10:99958257-99958279 TATTGCTTCTTAACTGAAAATGG - Intronic
1074790244 10:116879281-116879303 ATGTGCTTCTTACCTGGAAGAGG - Exonic
1075501463 10:122979121-122979143 AATTCCTTCTTACCTGTAAAGGG - Intronic
1078254218 11:9643661-9643683 GATTGATTCTTGGCTGGAGCAGG + Intergenic
1079239645 11:18713631-18713653 CTCAGCTTCTTACCTGGAACAGG - Intronic
1079369382 11:19837437-19837459 GATTGCTTATTAGCTGCAAGGGG + Intronic
1079594237 11:22222546-22222568 GATTGCATCTTATCTGGTCCTGG - Intronic
1080852589 11:36082866-36082888 GGTTGCTTCATACCTGCCACTGG + Intronic
1080852946 11:36086860-36086882 GACTGCATCTGACCTGGAGCAGG + Intronic
1086989783 11:93290322-93290344 AGTTGTTTCTTCCCTGGAACCGG + Intergenic
1092170445 12:6370815-6370837 GGTAGCTTCTTTCCTGGAAATGG - Intronic
1093636210 12:21472316-21472338 GATTGTTTCTTGCATGAAACTGG - Intronic
1095612291 12:44144572-44144594 GATTGCTTCTTACCTGGAACAGG + Intronic
1095772092 12:45971335-45971357 TATTCCATCTTACCTGGAACTGG - Intronic
1101926346 12:108974781-108974803 CATTGCTTTTTTCTTGGAACTGG - Intronic
1108286715 13:48916077-48916099 TACTCCATCTTACCTGGAACTGG - Intergenic
1111795198 13:92910540-92910562 CCTTGGTTCTTACCTGGACCTGG - Intergenic
1118447537 14:65865487-65865509 AATTGCTTCTGGCCTGGAACAGG - Intergenic
1119224248 14:72932677-72932699 GAGTGCTTCCTACATAGAACAGG + Intronic
1119584627 14:75821817-75821839 GATTGCTTTTTGGCTGGAATGGG - Intronic
1119929852 14:78534808-78534830 CATTGCTGCTTACCAGAAACAGG + Intronic
1121473072 14:94171709-94171731 TAATACTTCTTAGCTGGAACAGG + Intronic
1122175255 14:99912925-99912947 GGCTGCTTCTTTCCTGGAACGGG + Intronic
1124521143 15:30407418-30407440 GATTGTTTTTGACCTGGGACTGG + Exonic
1124537519 15:30558802-30558824 GATTGTTTTTGACCTGGGACTGG - Exonic
1124563941 15:30798295-30798317 GATTGTTTTTGACCTGGACCTGG - Intergenic
1124761137 15:32448785-32448807 GATTGTTTTTGACCTGGGACTGG + Exonic
1124777497 15:32600278-32600300 GATTGTTTTTGACCTGGGACTGG - Exonic
1128034561 15:64512921-64512943 GCTTGCTTATTACCTGGATGAGG - Intronic
1128844134 15:70874413-70874435 GATTGCTTCCCACTTGGAGCAGG - Intronic
1132292262 15:100712050-100712072 GATATCTACTTATCTGGAACAGG - Intergenic
1135953251 16:26934931-26934953 GTTTGCTTCTGCCCTGGAATTGG + Intergenic
1137459868 16:48650362-48650384 GTTTACTTTTTCCCTGGAACAGG + Intergenic
1137941615 16:52693729-52693751 GATTTCTTCTGACCTGGCAAAGG - Intergenic
1139055975 16:63184657-63184679 TATTCCATCTTAACTGGAACTGG + Intergenic
1141721474 16:85758307-85758329 GATGGGTTGTTACCTGGGACTGG + Intergenic
1149653244 17:58292085-58292107 TATTCCATCTTACCTAGAACTGG - Intergenic
1153847251 18:9061230-9061252 GATTCCTTCCTAGCTGGACCTGG + Intergenic
1155075307 18:22349027-22349049 CTTTCCTACTTACCTGGAACTGG + Intergenic
1155905968 18:31451775-31451797 TCTTGCTTCATACCTGAAACCGG + Intronic
1156334826 18:36160489-36160511 GATTGCTTCTGCCCAGGAATTGG + Intronic
1158537277 18:58319511-58319533 GAATGCTTTTACCCTGGAACGGG + Intronic
929677425 2:43951080-43951102 GATTGCTTGTTACTTGTAATGGG + Intronic
930852798 2:55978879-55978901 GTTTGCATTTTAGCTGGAACTGG - Intergenic
932708552 2:74046308-74046330 GAGTCCATCTGACCTGGAACAGG - Exonic
933624218 2:84580405-84580427 GATTGCTTCCTACAGGGAAGAGG - Intronic
942846837 2:180437122-180437144 GTTTGATTCTTATCTGGGACTGG - Intergenic
944086027 2:195848995-195849017 GAATGCTTATTACCTGCAAAGGG - Intronic
947359836 2:229335665-229335687 GATTGTTTCTCACCAGGATCCGG + Intergenic
1169751539 20:8999557-8999579 GATTGCTTTTTACTTTGAGCAGG - Intergenic
1179372254 21:40817315-40817337 GCTTGTTTCTTCTCTGGAACAGG + Intronic
950051638 3:9995609-9995631 TATTGCTTCTTACCTGGATGTGG - Intronic
950058879 3:10052488-10052510 TATTGCCTCTTACCTGGATGTGG - Exonic
950300522 3:11873744-11873766 TATTGCCTCTTACCTGGATGTGG - Intergenic
954776415 3:53022733-53022755 GAATGCTGGTTACCTGGAGCGGG + Intronic
960352031 3:116605779-116605801 GATTGCTTATTAGCTGCAAGGGG - Intronic
965472958 3:169117803-169117825 GAGTGATTCTTACCTGGTAAAGG - Intronic
977708911 4:100102054-100102076 GATTGCTTGAGACCAGGAACTGG - Intergenic
977822835 4:101495698-101495720 GATTGTTTCTTACAAGGAATTGG - Intronic
978462582 4:108973056-108973078 GTTTCCCTCTTACCTGGAAAGGG + Intronic
985085180 4:186305903-186305925 GATTACTACTTATCAGGAACAGG - Intergenic
986662858 5:10074715-10074737 GATTGCTTCTTCCCTGCTTCTGG - Intergenic
987382624 5:17299913-17299935 GTTTCCTTCTTACCTGGGAATGG + Intergenic
989574444 5:42976932-42976954 GTTTACTTCTTAGCTAGAACTGG + Intergenic
995824324 5:116276832-116276854 GATTGCTGGTTACCTAGGACCGG + Intronic
998365656 5:141629172-141629194 AATTACTTCTTCCCTGGCACAGG - Exonic
1000381791 5:160636169-160636191 GAGGGCTTCCTACCTGGAGCAGG + Exonic
1005738558 6:28770966-28770988 GATGGCTTCTTTCCGGGCACTGG + Intergenic
1006486186 6:34344520-34344542 GATTGGTGGTTACCAGGAACTGG + Intronic
1006868851 6:37232017-37232039 GCTTTCTCCTTACCTGAAACTGG + Intronic
1018511736 6:164531947-164531969 CAATGATTCATACCTGGAACTGG + Intergenic
1020458341 7:8399754-8399776 TATAGCTCCTCACCTGGAACTGG + Intergenic
1020681892 7:11246815-11246837 GATTGATTCTGACCAGGAAGAGG + Intergenic
1020804601 7:12772879-12772901 GCTAGCTTCTTTACTGGAACTGG + Intergenic
1020900849 7:14001720-14001742 GATTCCATCTTACCTCAAACAGG - Intergenic
1022455201 7:30552582-30552604 AATTCCTTCTTGCCTGGAAGAGG + Intergenic
1024445630 7:49475222-49475244 GAATGCTTATTAACTGGTACTGG - Intergenic
1026067345 7:67086637-67086659 AATTCCTTCTTGCTTGGAACAGG + Intronic
1026635937 7:72081771-72081793 GATGGCTTCTTAATTGGAGCGGG + Intronic
1026709578 7:72725690-72725712 AATTCCTTCTTGCTTGGAACAGG - Intronic
1028583778 7:92433505-92433527 GATTTCTTCTTAATTGTAACTGG + Intergenic
1028738727 7:94248192-94248214 GATTGCCTTTTACCTAGAATTGG + Intergenic
1030656534 7:112174093-112174115 GAATGGTTCATACCTGGAATAGG - Intronic
1031774842 7:125895333-125895355 AAATGCTTTTAACCTGGAACAGG + Intergenic
1032305726 7:130731817-130731839 GATTCCTTCTTATCGGGAAAGGG + Exonic
1034855592 7:154543435-154543457 GATTGGCTCTTACATGGGACAGG + Intronic
1034932159 7:155171266-155171288 TATTCCTTCTTACCTTGACCTGG - Intergenic
1038011591 8:23480687-23480709 GATTGCTTCTGACCTGCAGGAGG - Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1044762824 8:95539843-95539865 GATTGCTTCTTATGTGAAATTGG + Intergenic
1044766963 8:95586805-95586827 GATTGCTTCTTACCAGACATGGG + Intergenic
1051756015 9:20401611-20401633 TTCTGCTTCTTGCCTGGAACTGG - Intronic
1052353218 9:27478171-27478193 GTTTGCTTCTTCCCTGGTTCTGG - Intronic
1052375911 9:27717337-27717359 GAGTACTTCTTGCCTGGAGCTGG + Intergenic
1052560604 9:30078823-30078845 CATTGCTACTTCCCTGGAAGGGG - Intergenic
1057004773 9:91547476-91547498 TATTGCCACTTACCTGGCACTGG + Intergenic
1058458511 9:105160641-105160663 GATGGCTGCTGTCCTGGAACAGG - Intergenic
1059537557 9:115096728-115096750 GATTGCTTCTCACTTGTACCTGG - Intronic
1061355940 9:130104989-130105011 GATTGCTCCATTCCTGGAAATGG + Intronic
1188015469 X:25103527-25103549 GATTTCCTCTCTCCTGGAACTGG - Intergenic
1188232132 X:27677533-27677555 AATTGTTTCCTACTTGGAACAGG - Intronic
1188391712 X:29629096-29629118 GATTTCTTATTTCCTGGACCTGG + Intronic
1188706102 X:33333098-33333120 GATTGCTTCTTGCCTGAAATTGG - Intronic
1188932954 X:36137073-36137095 GATTGCTTTACACCTGGAATTGG - Intronic
1192941354 X:75915182-75915204 GATTACTGGTTACCTGGGACTGG - Intergenic
1196910480 X:120479912-120479934 GATTTCTAATTATCTGGAACAGG + Intergenic
1199286842 X:146063413-146063435 GAGTGCTTCAGGCCTGGAACTGG - Intergenic
1200846494 Y:7836220-7836242 GATGGCTTCTTTCCGGGCACTGG - Intergenic