ID: 1095620460

View in Genome Browser
Species Human (GRCh38)
Location 12:44248071-44248093
Sequence GGATATAGCCCCCAGTTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095620455_1095620460 18 Left 1095620455 12:44248030-44248052 CCAGTTTGGGTCTCAGGTTCTGA 0: 1
1: 0
2: 4
3: 21
4: 206
Right 1095620460 12:44248071-44248093 GGATATAGCCCCCAGTTGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095620460 Original CRISPR GGATATAGCCCCCAGTTGGG CGG Intronic
900161520 1:1226363-1226385 GGAAAGAGCCCCCAGAGGGGAGG - Intronic
908865837 1:68547924-68547946 GGCTAGAGGCCCCAGATGGGAGG - Intergenic
908915888 1:69126045-69126067 AGATATAGGCCCCAAATGGGTGG + Intergenic
913552282 1:119927273-119927295 GGAGATAGGCCCCATTTGGCCGG + Intronic
915844854 1:159252508-159252530 GGCTGGAGACCCCAGTTGGGAGG - Intergenic
916710877 1:167406512-167406534 GGTTATAGCCTCCAGTAAGGGGG + Intronic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
923052388 1:230397940-230397962 GGGCACAGCCACCAGTTGGGTGG - Intronic
924293547 1:242563054-242563076 GGATCTAGCGCCCAGATGGAAGG + Intergenic
1070054633 10:72923395-72923417 GGTTGGAGACCCCAGTTGGGAGG + Intronic
1070054730 10:72923936-72923958 GGTTGGAGGCCCCAGTTGGGAGG + Intronic
1075500149 10:122965557-122965579 GGCTGGAGGCCCCAGTTGGGAGG - Intronic
1075893960 10:125978525-125978547 GGCTAGAGGCCCCAGTTGGAAGG + Intronic
1082746500 11:56968643-56968665 GGATAGAGCCCCCAAGTGGAGGG - Intergenic
1083008095 11:59367793-59367815 GGCTGCAGGCCCCAGTTGGGAGG - Intergenic
1083177012 11:60956747-60956769 GGCCATGGCCCCCAGTGGGGAGG + Intergenic
1086569192 11:88263267-88263289 GGCTAGAGACCCCAGTTGGGAGG + Intergenic
1086991006 11:93303820-93303842 GGCTGGAGGCCCCAGTTGGGAGG - Intergenic
1088772847 11:113053075-113053097 GGACATAGGCACAAGTTGGGGGG - Intronic
1088879655 11:113963445-113963467 GGAACTAGCTCCCAGTTCGGAGG - Intergenic
1095620460 12:44248071-44248093 GGATATAGCCCCCAGTTGGGCGG + Intronic
1106387623 13:29302858-29302880 GGCCAGAGACCCCAGTTGGGAGG - Intronic
1109361533 13:61299862-61299884 GGCTAGAGACCCCAGTTAGGAGG - Intergenic
1111223449 13:85238010-85238032 AGACATTGCGCCCAGTTGGGAGG - Intergenic
1111662054 13:91223915-91223937 TGATATAGGTCCCAGTTAGGAGG - Intergenic
1117014428 14:51504363-51504385 GGCTAGAGACCCCTGTTGGGAGG + Intronic
1117641112 14:57800064-57800086 GGCTAGAGACCCCTGTTGGGAGG - Intronic
1118768793 14:68928116-68928138 ATTTATAGCCCCCAGCTGGGCGG - Intronic
1118957643 14:70497505-70497527 GGCTAGAGACCCCGGTTGGGAGG - Intergenic
1120206139 14:81589551-81589573 GGATAGAGCCTGCAGGTGGGTGG + Intergenic
1123459835 15:20459654-20459676 CCATACAGCCCCCCGTTGGGCGG - Intergenic
1123658227 15:22540766-22540788 CCATACAGCCCCCCGTTGGGCGG + Intergenic
1124266066 15:28235491-28235513 CCATACAGCCCCCCGTTGGGTGG - Intronic
1124312092 15:28635258-28635280 CCATACAGCCCCCCGTTGGGCGG + Intergenic
1125094936 15:35839743-35839765 GGATACAGGCCCCAGATGGGTGG + Intergenic
1127012228 15:54643057-54643079 GGCTAGAGACCCCTGTTGGGGGG - Intergenic
1130185527 15:81677656-81677678 GGTTGGAGACCCCAGTTGGGAGG - Intergenic
1134830104 16:17316045-17316067 GGAAATAGCCCCCACCTGGTTGG + Intronic
1139954727 16:70687675-70687697 GGCTATAGCCCCCCACTGGGTGG + Exonic
1140673745 16:77305686-77305708 GAATATAGCCCCCAATTTGGTGG + Intronic
1144616822 17:16783744-16783766 GGCTGGAGACCCCAGTTGGGAGG + Intronic
1144895869 17:18531930-18531952 GGCTGGAGACCCCAGTTGGGAGG - Intergenic
1146479275 17:33191633-33191655 AGAAATAGCCACCAGTAGGGTGG + Intronic
1147888453 17:43700190-43700212 GATTCTAGCCCCCAGTGGGGTGG + Intergenic
1155091426 18:22515188-22515210 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
1155577117 18:27259872-27259894 AGCTAGAGTCCCCAGTTGGGAGG + Intergenic
1156779949 18:40838830-40838852 GGGTATAGCCCCGAGTCTGGAGG - Intergenic
1162067953 19:8137176-8137198 GGATCTAGACCCCAGGTTGGAGG - Intronic
1162068022 19:8137398-8137420 GGATCTAGGCCCCAGGTTGGAGG - Intronic
925646778 2:6044362-6044384 GGATAGAGCCCCCAGTGGGAGGG + Intergenic
930229326 2:48827431-48827453 GGCTGGAGACCCCAGTTGGGAGG - Intergenic
930585990 2:53267779-53267801 GGCTGGAGGCCCCAGTTGGGAGG - Intergenic
931543320 2:63353670-63353692 GGATGGAGACCCTAGTTGGGAGG - Intronic
934623865 2:95832757-95832779 GGCTGGAGGCCCCAGTTGGGTGG + Intergenic
934624243 2:95834306-95834328 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
934624310 2:95834620-95834642 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
934624555 2:95835629-95835651 GGCTGGAGGCCCCAGTTGGGAGG - Intergenic
934809029 2:97265791-97265813 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
934809300 2:97266890-97266912 GGCTGGAGGCCCCAGTTGGGAGG - Intergenic
934809330 2:97266993-97267015 GGCTGGAGGCCCCAGTTGGGAGG - Intergenic
934809360 2:97267096-97267118 GGTTGCAGGCCCCAGTTGGGAGG - Intergenic
934809569 2:97268022-97268044 GGCTGCAGGCCCCAGTTGGGAGG - Intergenic
934809940 2:97269569-97269591 GGCCAGAGACCCCAGTTGGGAGG - Intergenic
934827752 2:97438370-97438392 GGCCAGAGACCCCAGTTGGGAGG + Intergenic
934828090 2:97489856-97489878 GGTTGCAGGCCCCAGTTGGGAGG + Intergenic
934828120 2:97489959-97489981 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
934828149 2:97490062-97490084 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
934828476 2:97491378-97491400 GGCTGGAGGCCCCAGTTGGGAGG - Intergenic
936625928 2:114149536-114149558 GGATGTAGCCCCTGGTTAGGTGG + Intergenic
939976128 2:148719667-148719689 GGTTGGAGACCCCAGTTGGGAGG + Intronic
940615014 2:156038795-156038817 GGCTGGAGGCCCCAGTTGGGAGG - Intergenic
947098270 2:226591513-226591535 GGAGATATCACCCAGTTAGGAGG + Intergenic
1168805587 20:670519-670541 GGATGTAGCACCCACTAGGGAGG + Intronic
1171282129 20:23909953-23909975 GGCTGGAGACCCCAGTTGGGAGG + Intergenic
1177651381 21:23965176-23965198 TGACATAGCCCCCAGAGGGGAGG - Intergenic
1179968348 21:44819219-44819241 GGCTAGAGCCCCCACTTAGGAGG + Intergenic
951683865 3:25323270-25323292 GGAAATAGACCCAAGGTGGGAGG + Intronic
952548527 3:34449759-34449781 GGCTAAAGACCCCAGTTGGGAGG + Intergenic
953816488 3:46162700-46162722 GGCTGCAGACCCCAGTTGGGAGG + Intergenic
955314594 3:57925765-57925787 GGATTCAGACCCCAGTAGGGTGG - Intronic
956588225 3:70886131-70886153 AGATGTTGCCCCCAGTTAGGTGG + Intergenic
957399758 3:79694439-79694461 GGAGATAGCCCAGAGTTGGGTGG - Intronic
959397159 3:105854958-105854980 GGCTAAAGCCTCCTGTTGGGTGG + Intronic
959605462 3:108236880-108236902 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
960502447 3:118454386-118454408 GGATAAAGACCCCAGTTGGGAGG + Intergenic
961623231 3:128240810-128240832 GGTTCTTGCCCCTAGTTGGGTGG + Intronic
966340897 3:178924085-178924107 GGATGGAGGCCCCAGTTGGGAGG - Intergenic
967503160 3:190223091-190223113 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
969496662 4:7530171-7530193 TGAAATAGCTCCCAGTGGGGTGG + Intronic
969603480 4:8190254-8190276 GGAGATGGCTCCCAGCTGGGAGG + Intronic
971969800 4:33606260-33606282 GGATGGAGGTCCCAGTTGGGAGG - Intergenic
974935328 4:68404317-68404339 AGATAAAGCCTCCAGATGGGAGG - Intergenic
975734046 4:77364608-77364630 GGATGTTGCCACCACTTGGGGGG + Intronic
979968467 4:127106020-127106042 GGCTGGAGACCCCAGTTGGGAGG - Intergenic
990931258 5:61094899-61094921 GGCTAGAGACCCCAGTTAGGAGG + Intronic
993450787 5:88070152-88070174 GGCTACAGACTCCAGTTGGGAGG - Intergenic
995300212 5:110571428-110571450 GAATATGGCCCCCAGTAGTGAGG + Intronic
997204996 5:132043041-132043063 GGCTGGAGACCCCAGTTGGGAGG + Intergenic
997205162 5:132043849-132043871 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
997205350 5:132045160-132045182 GACTAGAGGCCCCAGTTGGGAGG + Intergenic
997722156 5:136088094-136088116 GCAGATAGCTCCCAGTTGGGTGG + Intergenic
997743663 5:136279670-136279692 GGGCATAGCCTCCAGTGGGGTGG - Intronic
999666181 5:153916312-153916334 GGCTGGAGACCCCAGTTGGGAGG + Intergenic
1001148308 5:169204107-169204129 GGAAACAGCCCCCAGTGTGGTGG + Intronic
1003264035 6:4550408-4550430 TGATGGAGCCCCCAGGTGGGTGG - Intergenic
1009325726 6:62345863-62345885 GAGTAAAGACCCCAGTTGGGAGG - Intergenic
1016569681 6:145497993-145498015 GGCTGTAGGCCCCAGTTTGGAGG + Intergenic
1018338906 6:162828651-162828673 GGATATAGCACCCTTTTGTGGGG + Intronic
1020338917 7:7088722-7088744 GGAGATGTCTCCCAGTTGGGAGG + Intergenic
1021773767 7:24031241-24031263 GGAAATAGCCACCACTTGAGAGG + Intergenic
1022076190 7:26973574-26973596 GACTAGAGACCCCAGTTGGGAGG + Intronic
1027452856 7:78352634-78352656 GGATATAGTATCCAGCTGGGAGG + Intronic
1028177112 7:87672187-87672209 GGCTAGAGGCCCCACTTGGGAGG + Intronic
1040285352 8:46097933-46097955 GGCTGTAGCCCCCAACTGGGGGG - Intergenic
1041561645 8:59225711-59225733 GGCTGGAGGCCCCAGTTGGGAGG - Intergenic
1043516043 8:80996110-80996132 GGACAAAGGCCCCAGTTGCGGGG + Intronic
1051726061 9:20089098-20089120 GGATAGAGCTCCCAGTGGGAGGG + Intergenic
1051899889 9:22026303-22026325 GGCTGGAGGCCCCAGTTGGGAGG + Intronic
1056127994 9:83555323-83555345 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
1062709305 9:137965129-137965151 GGCTGGAGACCCCAGTTGGGAGG + Intronic
1187101362 X:16196331-16196353 AAATTTAGCCCCCAGTTTGGTGG + Intergenic
1191155186 X:57266164-57266186 GGCTAAAGACCCCTGTTGGGAGG - Intergenic
1191209577 X:57871233-57871255 GGCTGGAGACCCCAGTTGGGAGG + Intergenic
1192055418 X:67768849-67768871 GGCTGGAGACCCCAGTTGGGAGG - Intergenic
1192810000 X:74538895-74538917 GGGTAAAGGCCACAGTTGGGAGG - Intergenic
1192923700 X:75734441-75734463 GGATAGAGCCCCCAGAGGGAGGG - Intergenic
1192926354 X:75758950-75758972 GGCTGGAGACCCCAGTTGGGAGG - Intergenic
1193715142 X:84928083-84928105 GGCTAGAGGCCCCATTTGGGAGG + Intergenic
1194029050 X:88789300-88789322 GGCTAGAGACCCCAGTTGGGAGG + Intergenic
1194213127 X:91092939-91092961 GGCTGGAGACCCCAGTTGGGAGG + Intergenic
1194608133 X:96006389-96006411 AGATTTAGACTCCAGTTGGGAGG - Intergenic
1194635643 X:96342669-96342691 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
1194917366 X:99722517-99722539 GGCTAAAGGCCCCGGTTGGGAGG - Intergenic
1197077018 X:122364571-122364593 GGCTGGAGGCCCCAGTTGGGAGG + Intergenic
1201967618 Y:19755042-19755064 GGCTAGAGGCCCCAGTTGGGAGG + Intergenic