ID: 1095626584

View in Genome Browser
Species Human (GRCh38)
Location 12:44321570-44321592
Sequence GTCACCAGATTCATCCCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095626584_1095626591 15 Left 1095626584 12:44321570-44321592 CCGACAGGGATGAATCTGGTGAC 0: 1
1: 0
2: 2
3: 7
4: 123
Right 1095626591 12:44321608-44321630 CTTCCTTGAGAATGGAGAGATGG 0: 1
1: 0
2: 3
3: 50
4: 458
1095626584_1095626590 7 Left 1095626584 12:44321570-44321592 CCGACAGGGATGAATCTGGTGAC 0: 1
1: 0
2: 2
3: 7
4: 123
Right 1095626590 12:44321600-44321622 CAGAGGTGCTTCCTTGAGAATGG 0: 1
1: 0
2: 1
3: 19
4: 219
1095626584_1095626585 -10 Left 1095626584 12:44321570-44321592 CCGACAGGGATGAATCTGGTGAC 0: 1
1: 0
2: 2
3: 7
4: 123
Right 1095626585 12:44321583-44321605 ATCTGGTGACTCCCACCCAGAGG 0: 1
1: 0
2: 4
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095626584 Original CRISPR GTCACCAGATTCATCCCTGT CGG (reversed) Intronic