ID: 1095626586

View in Genome Browser
Species Human (GRCh38)
Location 12:44321594-44321616
Sequence TCAAGGAAGCACCTCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095626586_1095626593 21 Left 1095626586 12:44321594-44321616 CCCACCCAGAGGTGCTTCCTTGA 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1095626593 12:44321638-44321660 CAATCACAGACTTTCACATTAGG 0: 1
1: 0
2: 2
3: 12
4: 216
1095626586_1095626591 -9 Left 1095626586 12:44321594-44321616 CCCACCCAGAGGTGCTTCCTTGA 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1095626591 12:44321608-44321630 CTTCCTTGAGAATGGAGAGATGG 0: 1
1: 0
2: 3
3: 50
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095626586 Original CRISPR TCAAGGAAGCACCTCTGGGT GGG (reversed) Intronic