ID: 1095626587 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:44321595-44321617 |
| Sequence | CTCAAGGAAGCACCTCTGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 203 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 190} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1095626587_1095626593 | 20 | Left | 1095626587 | 12:44321595-44321617 | CCACCCAGAGGTGCTTCCTTGAG | 0: 1 1: 0 2: 0 3: 12 4: 190 |
||
| Right | 1095626593 | 12:44321638-44321660 | CAATCACAGACTTTCACATTAGG | 0: 1 1: 0 2: 2 3: 12 4: 216 |
||||
| 1095626587_1095626591 | -10 | Left | 1095626587 | 12:44321595-44321617 | CCACCCAGAGGTGCTTCCTTGAG | 0: 1 1: 0 2: 0 3: 12 4: 190 |
||
| Right | 1095626591 | 12:44321608-44321630 | CTTCCTTGAGAATGGAGAGATGG | 0: 1 1: 0 2: 3 3: 50 4: 458 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1095626587 | Original CRISPR | CTCAAGGAAGCACCTCTGGG TGG (reversed) | Intronic | ||