ID: 1095626588

View in Genome Browser
Species Human (GRCh38)
Location 12:44321598-44321620
Sequence ATTCTCAAGGAAGCACCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095626588_1095626593 17 Left 1095626588 12:44321598-44321620 CCCAGAGGTGCTTCCTTGAGAAT 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1095626593 12:44321638-44321660 CAATCACAGACTTTCACATTAGG 0: 1
1: 0
2: 2
3: 12
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095626588 Original CRISPR ATTCTCAAGGAAGCACCTCT GGG (reversed) Intronic