ID: 1095626591

View in Genome Browser
Species Human (GRCh38)
Location 12:44321608-44321630
Sequence CTTCCTTGAGAATGGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 458}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095626586_1095626591 -9 Left 1095626586 12:44321594-44321616 CCCACCCAGAGGTGCTTCCTTGA 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1095626591 12:44321608-44321630 CTTCCTTGAGAATGGAGAGATGG 0: 1
1: 0
2: 3
3: 50
4: 458
1095626584_1095626591 15 Left 1095626584 12:44321570-44321592 CCGACAGGGATGAATCTGGTGAC 0: 1
1: 0
2: 2
3: 7
4: 123
Right 1095626591 12:44321608-44321630 CTTCCTTGAGAATGGAGAGATGG 0: 1
1: 0
2: 3
3: 50
4: 458
1095626587_1095626591 -10 Left 1095626587 12:44321595-44321617 CCACCCAGAGGTGCTTCCTTGAG 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1095626591 12:44321608-44321630 CTTCCTTGAGAATGGAGAGATGG 0: 1
1: 0
2: 3
3: 50
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095626591 Original CRISPR CTTCCTTGAGAATGGAGAGA TGG Intronic