ID: 1095626592

View in Genome Browser
Species Human (GRCh38)
Location 12:44321611-44321633
Sequence TTTCCATCTCTCCATTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 382}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095626592_1095626593 4 Left 1095626592 12:44321611-44321633 CCTTGAGAATGGAGAGATGGAAA 0: 1
1: 0
2: 2
3: 44
4: 382
Right 1095626593 12:44321638-44321660 CAATCACAGACTTTCACATTAGG 0: 1
1: 0
2: 2
3: 12
4: 216
1095626592_1095626595 28 Left 1095626592 12:44321611-44321633 CCTTGAGAATGGAGAGATGGAAA 0: 1
1: 0
2: 2
3: 44
4: 382
Right 1095626595 12:44321662-44321684 GTAAAAACTTATATTATGATGGG 0: 1
1: 1
2: 0
3: 22
4: 304
1095626592_1095626594 27 Left 1095626592 12:44321611-44321633 CCTTGAGAATGGAGAGATGGAAA 0: 1
1: 0
2: 2
3: 44
4: 382
Right 1095626594 12:44321661-44321683 AGTAAAAACTTATATTATGATGG 0: 1
1: 0
2: 1
3: 31
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095626592 Original CRISPR TTTCCATCTCTCCATTCTCA AGG (reversed) Intronic