ID: 1095626592 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:44321611-44321633 |
| Sequence | TTTCCATCTCTCCATTCTCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 429 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 44, 4: 382} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1095626592_1095626593 | 4 | Left | 1095626592 | 12:44321611-44321633 | CCTTGAGAATGGAGAGATGGAAA | 0: 1 1: 0 2: 2 3: 44 4: 382 |
||
| Right | 1095626593 | 12:44321638-44321660 | CAATCACAGACTTTCACATTAGG | 0: 1 1: 0 2: 2 3: 12 4: 216 |
||||
| 1095626592_1095626595 | 28 | Left | 1095626592 | 12:44321611-44321633 | CCTTGAGAATGGAGAGATGGAAA | 0: 1 1: 0 2: 2 3: 44 4: 382 |
||
| Right | 1095626595 | 12:44321662-44321684 | GTAAAAACTTATATTATGATGGG | 0: 1 1: 1 2: 0 3: 22 4: 304 |
||||
| 1095626592_1095626594 | 27 | Left | 1095626592 | 12:44321611-44321633 | CCTTGAGAATGGAGAGATGGAAA | 0: 1 1: 0 2: 2 3: 44 4: 382 |
||
| Right | 1095626594 | 12:44321661-44321683 | AGTAAAAACTTATATTATGATGG | 0: 1 1: 0 2: 1 3: 31 4: 380 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1095626592 | Original CRISPR | TTTCCATCTCTCCATTCTCA AGG (reversed) | Intronic | ||