ID: 1095626593

View in Genome Browser
Species Human (GRCh38)
Location 12:44321638-44321660
Sequence CAATCACAGACTTTCACATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095626588_1095626593 17 Left 1095626588 12:44321598-44321620 CCCAGAGGTGCTTCCTTGAGAAT 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1095626593 12:44321638-44321660 CAATCACAGACTTTCACATTAGG 0: 1
1: 0
2: 2
3: 12
4: 216
1095626589_1095626593 16 Left 1095626589 12:44321599-44321621 CCAGAGGTGCTTCCTTGAGAATG 0: 1
1: 0
2: 0
3: 4
4: 187
Right 1095626593 12:44321638-44321660 CAATCACAGACTTTCACATTAGG 0: 1
1: 0
2: 2
3: 12
4: 216
1095626592_1095626593 4 Left 1095626592 12:44321611-44321633 CCTTGAGAATGGAGAGATGGAAA 0: 1
1: 0
2: 2
3: 44
4: 382
Right 1095626593 12:44321638-44321660 CAATCACAGACTTTCACATTAGG 0: 1
1: 0
2: 2
3: 12
4: 216
1095626586_1095626593 21 Left 1095626586 12:44321594-44321616 CCCACCCAGAGGTGCTTCCTTGA 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1095626593 12:44321638-44321660 CAATCACAGACTTTCACATTAGG 0: 1
1: 0
2: 2
3: 12
4: 216
1095626587_1095626593 20 Left 1095626587 12:44321595-44321617 CCACCCAGAGGTGCTTCCTTGAG 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1095626593 12:44321638-44321660 CAATCACAGACTTTCACATTAGG 0: 1
1: 0
2: 2
3: 12
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095626593 Original CRISPR CAATCACAGACTTTCACATT AGG Intronic