ID: 1095632341

View in Genome Browser
Species Human (GRCh38)
Location 12:44392937-44392959
Sequence AACAAACATCAGGGCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 2, 1: 0, 2: 0, 3: 39, 4: 335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095632341 Original CRISPR AACAAACATCAGGGCAAATT TGG Intergenic
900541274 1:3204187-3204209 AATAAACATCAGAGCAGACTTGG + Intronic
903127021 1:21255148-21255170 AACGGACAACAGGTCAAATTCGG + Intronic
904283866 1:29441314-29441336 AACAAATCTCATGGCAATTTAGG - Intergenic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
908232148 1:62115955-62115977 AACAAAAATCAGTGCACATCTGG + Intronic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
909891452 1:81012887-81012909 AACACACACCAGGGCCAGTTGGG - Intergenic
910852034 1:91657820-91657842 AAGAATCATCAGTGCAAAGTTGG - Intergenic
911551473 1:99287050-99287072 AACACACACCAGGGCATGTTGGG - Intronic
911974987 1:104480862-104480884 AATAAACAGCAGGGCCAATGTGG - Intergenic
912186628 1:107284291-107284313 AACCAACATCAGGAGAATTTGGG + Intronic
912900349 1:113640704-113640726 AACAAACACCAGGGCCAGTCGGG + Intronic
914340662 1:146757143-146757165 AACAAGCAGCAGGACAGATTTGG + Intergenic
914738407 1:150440806-150440828 AATAAACATCAGAAGAAATTTGG + Intronic
914756518 1:150564808-150564830 AACAGGCAGCAGGGCAAATTTGG + Intergenic
915011300 1:152688610-152688632 ATCACACATCGGGGCATATTGGG - Intergenic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
917059613 1:171022577-171022599 AACACACACCAGGGCCACTTGGG + Intronic
919445637 1:197701408-197701430 AACACACACCAGGGCCCATTCGG + Intronic
919823663 1:201488924-201488946 ACCAATCTTCTGGGCAAATTTGG + Exonic
920273296 1:204783534-204783556 TACAAATAGAAGGGCAAATTTGG - Intergenic
920813503 1:209308984-209309006 AACAAACACCATGGCAAAGCAGG + Intergenic
921125547 1:212174530-212174552 AACAAACATCAGGGCGGGTGCGG + Intergenic
921436856 1:215133968-215133990 AACAAACAAGAGGCCAAGTTTGG + Intronic
921702288 1:218282300-218282322 AACACACACCAGGGCCAATCGGG + Intergenic
923166205 1:231365230-231365252 AAAAAACATAACAGCAAATTTGG + Exonic
923411981 1:233719678-233719700 AACAAAGATCAGATCAAATAAGG - Intergenic
924085748 1:240449627-240449649 CACAATCATCATGGCAAATTAGG + Intronic
924187687 1:241512587-241512609 AACAAAAATAGGGGCAAATCTGG - Intronic
1063658679 10:8017372-8017394 CCCAAACATCAGGGAAAAATGGG + Intergenic
1064592022 10:16903081-16903103 AACACACATCATGACAAAATAGG + Intronic
1064925806 10:20567546-20567568 AAGAAAACTCAGGACAAATTTGG + Intergenic
1066345709 10:34583878-34583900 AAAAAAAATCAGTGCAAATTAGG + Intronic
1067331306 10:45322733-45322755 AATCAACAACAGGGGAAATTTGG + Intergenic
1068198850 10:53756209-53756231 AACAAACCTCAGTTTAAATTAGG - Intergenic
1068249305 10:54416287-54416309 AACACACATCAGGGCCTTTTGGG - Intronic
1068372239 10:56131926-56131948 AACACACACCAGGGCCAATCAGG + Intergenic
1068426670 10:56874936-56874958 AACAAACATGAGTTGAAATTTGG + Intergenic
1068979705 10:63049334-63049356 AACACACACCAGGGCATGTTGGG - Intergenic
1070038619 10:72752578-72752600 AACAAAACTGAGGGCACATTTGG + Intronic
1070187566 10:74080357-74080379 AACAAACCTGAGATCAAATTAGG + Intronic
1070316818 10:75321461-75321483 AAGGAACATTAGGGAAAATTTGG + Intergenic
1071117980 10:82245863-82245885 ACCCAAGAGCAGGGCAAATTAGG - Intronic
1071211880 10:83351048-83351070 AACACACATCAGGGCCTGTTGGG - Intergenic
1071691279 10:87821841-87821863 AACAAACATCTGAGCTGATTGGG + Intronic
1072952138 10:99857181-99857203 AACAGGTAGCAGGGCAAATTTGG - Intergenic
1073945761 10:108748000-108748022 AACATAAATCAGGACAATTTTGG - Intergenic
1074115503 10:110454955-110454977 CACAAATATCAGGACAAATTGGG + Intergenic
1074117200 10:110465352-110465374 AACCAACATCAGGGCCATATGGG + Intergenic
1074216157 10:111386286-111386308 ATCAAACACCAGGGCCTATTGGG - Intergenic
1075358575 10:121807743-121807765 AACAAGCAGCAGACCAAATTTGG - Intronic
1078749005 11:14142447-14142469 AAAAAATGTTAGGGCAAATTGGG - Intronic
1079312865 11:19381721-19381743 AAATAACGTCAGGGCAAATGTGG + Intronic
1080143354 11:28949124-28949146 AATAAACATAAGGGCTATTTGGG + Intergenic
1080253447 11:30262812-30262834 AACAAATTTCAAGGGAAATTAGG - Intergenic
1080653076 11:34237971-34237993 ATCACACATCAGGGCAAATGGGG - Intronic
1081115443 11:39193495-39193517 AACAACTATCAGGCCAAATGAGG - Intergenic
1081250205 11:40821599-40821621 GACAAATATTAGGGAAAATTGGG - Intronic
1081269968 11:41071228-41071250 AACACACACCAGGGCCTATTAGG + Intronic
1082214838 11:49557239-49557261 AATAAAGATAAGGTCAAATTTGG - Intergenic
1083640401 11:64142237-64142259 AACAAACATCAGGTCAGACATGG + Intronic
1084075977 11:66776708-66776730 AACAAACACGCTGGCAAATTAGG - Intronic
1085289171 11:75385218-75385240 AACAAAAATCAGGCCAGATGTGG + Intergenic
1085601057 11:77856360-77856382 AAGGAAGATGAGGGCAAATTTGG - Intronic
1086634744 11:89067227-89067249 AATAAAGATAAGGTCAAATTTGG + Intergenic
1087914240 11:103790347-103790369 CACACACACCAGTGCAAATTTGG + Intergenic
1088217045 11:107522631-107522653 AAAAAAAATCAATGCAAATTTGG + Intronic
1089103784 11:115985310-115985332 GTCTAACATCAGGGCAGATTTGG - Intergenic
1090986561 11:131772010-131772032 AACAAACAACAGTGAAACTTGGG - Intronic
1091453915 12:591224-591246 ACCAACCATCAGGGCAGTTTAGG + Intronic
1092320323 12:7465904-7465926 AACACACATCAGAGCCTATTGGG + Intronic
1093316114 12:17652170-17652192 ATTAAGCATCAGGCCAAATTTGG - Intergenic
1093747768 12:22762473-22762495 AACAAATATTAGGCCACATTTGG - Intergenic
1094055230 12:26262439-26262461 AACACACACCAGGGCCTATTGGG + Intronic
1095055581 12:37594146-37594168 AACAAAGATAAGTGCAAAATTGG + Intergenic
1095632341 12:44392937-44392959 AACAAACATCAGGGCAAATTTGG + Intergenic
1095881976 12:47147474-47147496 AACAGACATCAGTGGAAATATGG - Intronic
1096656825 12:53097456-53097478 AAGAAAAATCAGAGCAATTTGGG + Exonic
1097539286 12:60916601-60916623 AACAAAAATCTGGACAAATTAGG - Intergenic
1097612642 12:61843400-61843422 AAAAAACAACAGGAAAAATTCGG + Intronic
1098821367 12:75234429-75234451 AACAAACAAAAGGGAAAAATTGG + Intergenic
1099549635 12:84026870-84026892 AACACACATCAGGGCCTGTTGGG + Intergenic
1100651846 12:96599170-96599192 ATCACACATCAGGGCTTATTGGG - Intronic
1103928774 12:124438083-124438105 AACCAATAACGGGGCAAATTTGG - Intronic
1104141091 12:125986151-125986173 AATAAACATCAAGGCATAATGGG + Intergenic
1106130896 13:26938592-26938614 AACACACACCAGGGCCAGTTGGG - Intergenic
1106210762 13:27642329-27642351 ATCAAACATTAGGGCAGACTGGG - Intronic
1106440672 13:29764681-29764703 AACAAAGTTCAGGACAATTTAGG + Exonic
1106619079 13:31356503-31356525 AACAAACATCAGGCCAGAAGAGG - Intergenic
1107002288 13:35562302-35562324 AACAGAAATCAGGTCAATTTGGG - Intronic
1107484337 13:40811925-40811947 GACAAACATCAGGGGACATCTGG + Intergenic
1107727623 13:43315929-43315951 AATAAGCATCAGGGCACTTTGGG + Intronic
1108130756 13:47297631-47297653 AACACACACCAGGGCCAGTTTGG + Intergenic
1108774309 13:53745721-53745743 AACACACACCAGGGCCAGTTGGG - Intergenic
1108996913 13:56746546-56746568 AACAAACATCAAGGCCAGCTAGG - Intergenic
1109104849 13:58238236-58238258 AATATACATATGGGCAAATTTGG - Intergenic
1110498861 13:76202208-76202230 AACACACATCAGGGCCTGTTGGG - Intergenic
1110842417 13:80157898-80157920 AACACACCTAAGGGCAGATTTGG + Intergenic
1111045395 13:82807248-82807270 AAGACACACCATGGCAAATTGGG + Intergenic
1111703346 13:91718082-91718104 AACAAAGATTAGGGGAAAGTGGG - Intronic
1111907881 13:94276601-94276623 AACAAACACCAGGGCCTGTTAGG - Intronic
1113833924 13:113316407-113316429 AAAAAAAATCATGCCAAATTGGG - Intronic
1114056574 14:18973719-18973741 CAGAAATATCAGGGCCAATTTGG + Intronic
1114105975 14:19428008-19428030 CAGAAATATCAGGGCCAATTTGG - Intronic
1115492488 14:33971481-33971503 TAATAACATCAGGGCAAATGGGG - Intronic
1116000323 14:39236385-39236407 GAAGAACCTCAGGGCAAATTGGG + Intronic
1117460613 14:55941069-55941091 AGCAAACATCAGAGCAGAGTAGG - Intergenic
1117651587 14:57913038-57913060 AACAAACATCAGAGCAAAGAAGG - Intronic
1118027964 14:61789994-61790016 AACAGACATAAGAGCAAATACGG + Intronic
1118228542 14:63926588-63926610 AGCAAGCAGCAGGTCAAATTTGG + Intronic
1121950826 14:98169841-98169863 AAGAGGCATCAGTGCAAATTAGG + Intergenic
1122621712 14:103061678-103061700 AACAAGCAGCAGGCTAAATTTGG + Intergenic
1122733865 14:103823354-103823376 AAAAAACAACAGGGACAATTTGG + Intronic
1202933903 14_KI270725v1_random:65741-65763 AATAAACGCAAGGGCAAATTGGG - Intergenic
1126350211 15:47738162-47738184 AACACACACCAGGGCCTATTTGG - Intronic
1126972971 15:54138939-54138961 AAAAAAAATTAGGGGAAATTTGG - Intronic
1127051900 15:55092259-55092281 AACAAAAATAAGGGTAAGTTTGG + Intergenic
1127175376 15:56349466-56349488 AAAGAACATGAGAGCAAATTTGG - Intronic
1128190906 15:65695480-65695502 AATAGGCTTCAGGGCAAATTTGG + Intronic
1130962922 15:88676227-88676249 AACAATAAACAGTGCAAATTTGG - Intergenic
1131120548 15:89820687-89820709 AACAAACATTAGGGCAGAATAGG + Intergenic
1132711213 16:1268838-1268860 AATAAACATCACTGGAAATTGGG + Intergenic
1132817114 16:1835515-1835537 TACCAACATCAGGGAAAACTGGG + Intronic
1138038360 16:53631863-53631885 AAGAAAGATAGGGGCAAATTGGG + Intronic
1139993623 16:70960263-70960285 AACAAGCAGCAGGACAGATTTGG - Intronic
1140061239 16:71571363-71571385 TACAAATATCAGGTCAAATCAGG + Intronic
1140896486 16:79329151-79329173 AAGAAACACCAGGGCACATTAGG + Intergenic
1141043719 16:80695110-80695132 AACAAACATCTGGCCAGATTTGG - Intronic
1149158333 17:53661156-53661178 AACAAACGGCAGGCCAGATTTGG + Intergenic
1149241647 17:54657702-54657724 AACACACATCAGGGCCTGTTGGG - Intergenic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1154130045 18:11729002-11729024 AAGAAACATCAGAGCCATTTGGG + Intronic
1154979462 18:21490613-21490635 AATAAACATGGGGTCAAATTGGG - Intronic
1155521144 18:26670244-26670266 AAAGAACATCAGGCCAAAGTTGG + Intergenic
1156723342 18:40097209-40097231 AATAAACATCATGGCAAAAGTGG - Intergenic
1156725541 18:40121865-40121887 ATCTGTCATCAGGGCAAATTGGG + Intergenic
1157018631 18:43751084-43751106 AACAAGCAACAGGCCAGATTTGG + Intergenic
1157163250 18:45334638-45334660 AAGAAAGATCAAGGCAAAATGGG - Intronic
1157632266 18:49110037-49110059 AACAGACAACAGGCCAGATTTGG - Intronic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1158182989 18:54738931-54738953 AAGAAGCATCAGGGAAATTTGGG - Intronic
1162180018 19:8862138-8862160 AATAATCATCAGGGTAAATGGGG + Intronic
1163065523 19:14790337-14790359 AACAAGCAGCAGGGTGAATTTGG + Intergenic
1163409172 19:17142835-17142857 AACAAGCATCAGACCAGATTTGG + Intronic
1164231900 19:23296771-23296793 AACATACATCAGGGCTAGTCAGG - Intergenic
1164975127 19:32567311-32567333 AAGTAACATCAGAGCAAATGTGG - Intergenic
925243364 2:2354700-2354722 AACACACACCAGGGCCTATTGGG - Intergenic
925432718 2:3809754-3809776 AACACACATCAGGGCCTGTTGGG - Intronic
926107048 2:10159081-10159103 AACAAAAATTAGGGCCAATTTGG - Intronic
927305040 2:21561556-21561578 AATATACCTCAGGGCAAATAAGG - Intergenic
927654442 2:24933576-24933598 AAAAAAAAAGAGGGCAAATTTGG - Intergenic
929262306 2:39879371-39879393 AACACACATCAGGGCCCATTGGG + Intergenic
930115278 2:47712770-47712792 AACAAACATACGGGCAAAAATGG + Intronic
930185040 2:48404917-48404939 AAGAAAAATCAGTGGAAATTTGG - Intergenic
932033886 2:68220557-68220579 AACAAATCTCAGATCAAATTTGG + Intronic
933499836 2:83097080-83097102 AACAAAGATGAGGGGAAAATGGG + Intergenic
933601969 2:84341863-84341885 AACACACATCAGGGCCTGTTGGG - Intergenic
933603693 2:84359795-84359817 ATCACACATCAGGGCCTATTGGG + Intergenic
933789321 2:85871406-85871428 AAGAAATATAAGGGCAAATTTGG + Intronic
935117170 2:100146666-100146688 AACAAACTTGAGTGCCAATTCGG + Intergenic
935268301 2:101413137-101413159 AACAAAAATCTTGGCAATTTGGG - Intronic
935665056 2:105503979-105504001 TACATACAACAGAGCAAATTTGG + Intergenic
935891655 2:107685695-107685717 ACAGAACATTAGGGCAAATTAGG - Intergenic
937893406 2:126957777-126957799 AACACACATCAGGGCCTGTTGGG - Intergenic
939371694 2:141309692-141309714 AACATACACCAGGGCCAGTTCGG + Intronic
940450753 2:153833722-153833744 AACAAGCAGCAGGCCAGATTTGG + Intergenic
940881962 2:158955467-158955489 AACAAAGATCAGGGGAGACTTGG - Intergenic
940996990 2:160160063-160160085 AACAAGCAACAGGCCAAATATGG - Intronic
941263726 2:163332227-163332249 AGAAAACAAGAGGGCAAATTGGG + Intergenic
941698290 2:168576680-168576702 AAAAAACATCAGAGCAAGTATGG - Intronic
942291714 2:174479107-174479129 AACAACCATCAGGGAAATTTGGG + Intronic
942819589 2:180096495-180096517 AAAAAAAATCAGAACAAATTAGG + Intergenic
942936745 2:181566382-181566404 AACAGGCACCAGGACAAATTGGG - Intronic
943377117 2:187091355-187091377 AAGAATCATGAGGGCAAATTTGG + Intergenic
943786592 2:191884246-191884268 AAAAGTCATCAGGGGAAATTTGG - Intergenic
944969045 2:204970354-204970376 AAAATAAATCAGGACAAATTTGG + Intronic
946280679 2:218663779-218663801 AACAGACTTCAGAGCAAAGTTGG + Intergenic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
947699787 2:232223074-232223096 AACACACAACAGTCCAAATTCGG - Intronic
948065213 2:235073352-235073374 AATAAACAAGAGGGAAAATTTGG - Intergenic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1168866224 20:1089329-1089351 AACAAGCAGCAGGCCAGATTTGG + Intergenic
1170155387 20:13264512-13264534 ACCAAGCCACAGGGCAAATTAGG - Intronic
1170454467 20:16519414-16519436 ATCAAACATCTGGGAAAAATAGG - Intronic
1171526662 20:25818187-25818209 AACAAAGATAAGTGCAAAATTGG - Intronic
1171550165 20:26037698-26037720 AACAAAGATAAGTGCAAAATTGG + Intergenic
1172945728 20:38687310-38687332 AACAAACACCAGGGCCTGTTGGG - Intergenic
1174792906 20:53497130-53497152 AACAAGTAGCAGGCCAAATTTGG + Intergenic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175330808 20:58162474-58162496 AAGAAACATCATGGCTATTTAGG + Intergenic
1176595302 21:8687898-8687920 AATAAACGCAAGGGCAAATTGGG - Intergenic
1176845514 21:13873629-13873651 AAGAAAGATGAGGGAAAATTTGG - Intergenic
1177110165 21:17017727-17017749 AACACACACCAGGGCCTATTGGG + Intergenic
1177373293 21:20235102-20235124 AACACACATCAGGGCCTGTTGGG - Intergenic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177609039 21:23422007-23422029 AACAAACATCGCAGCAATTTAGG + Intergenic
1178182190 21:30174535-30174557 AAGGAACACCAGGGCAAATGTGG - Intergenic
1178704884 21:34864825-34864847 AAAAAACAACAGGGCAGATGAGG + Intronic
1179285410 21:39973715-39973737 AACAATCATCAAGGCATGTTTGG + Intergenic
1179411261 21:41165460-41165482 AACAAACATCAGTGGAACATGGG + Intergenic
1180475060 22:15696332-15696354 CAGAAATATCAGGGCCAATTTGG + Intronic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
951448284 3:22807417-22807439 AGCAAAAATCAGGAAAAATTTGG - Intergenic
951759745 3:26133117-26133139 AAGAAACCACAGGGTAAATTAGG - Intergenic
953057907 3:39402926-39402948 AACAAGCAGCAGGGCACAGTGGG + Intergenic
955303404 3:57806219-57806241 AACACACACCAGGGCCAGTTGGG - Intronic
955408750 3:58642475-58642497 GACAAAGGTCAGGGCAAGTTGGG - Intronic
956161431 3:66357471-66357493 AGCAAACATCAGGGAAAATGTGG + Intronic
956318133 3:67962399-67962421 AAATTACATCAGGGCAAATGGGG - Intergenic
957699403 3:83689076-83689098 AACACACACCAGGGCATGTTGGG - Intergenic
958457127 3:94345856-94345878 AACACACATCAGGGCCTGTTGGG + Intergenic
958543127 3:95506528-95506550 AAGAAATATCATAGCAAATTAGG - Intergenic
959006947 3:101030332-101030354 AACACACACCAGGGCCAGTTGGG - Intergenic
959231858 3:103664873-103664895 ACCAGAGATGAGGGCAAATTGGG - Intergenic
962377927 3:134874344-134874366 AACAAACACCGGGGCCTATTGGG + Intronic
962541508 3:136387301-136387323 AAAACACATCAGGTCAGATTTGG + Intronic
964587486 3:158322975-158322997 AACAGACATCTGGGTTAATTTGG + Intronic
964593067 3:158388592-158388614 AACAAAAAACACGGCTAATTTGG - Intronic
965853098 3:173054613-173054635 AACACACACCAGGGCCTATTGGG + Intronic
965942526 3:174201857-174201879 TAAAAAGGTCAGGGCAAATTAGG - Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966672573 3:182544441-182544463 ACCAACCATTATGGCAAATTTGG - Intergenic
969077041 4:4588156-4588178 AACACACACCAGGGCCAGTTGGG + Intergenic
970062631 4:12051803-12051825 AACACACACCAGGGCCAATCAGG + Intergenic
970074072 4:12197352-12197374 AGCAAACCTCTGGCCAAATTAGG + Intergenic
971037416 4:22709272-22709294 AATGAACATCAGGGAAAATGGGG + Intergenic
972586726 4:40444361-40444383 AACAAACAGCAGGCCATATTTGG - Intronic
972996637 4:44887205-44887227 TAAAAACATCAGGGTAAATGAGG + Intergenic
974515831 4:62908596-62908618 AACAAACACCAGGGCCTGTTGGG - Intergenic
974968528 4:68795858-68795880 AACACACACCAGGGCCTATTGGG + Intergenic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
975432299 4:74308132-74308154 AACAAACATAACTGCAAATTAGG - Intergenic
976806880 4:89057933-89057955 AACACACATCAGGGCCTGTTGGG - Intronic
977348437 4:95847658-95847680 AACAAAATTTGGGGCAAATTGGG - Intergenic
977466261 4:97385606-97385628 AGCAAACTTCAGCTCAAATTTGG + Intronic
977471097 4:97444303-97444325 AACAAACACCAAGGAGAATTGGG + Intronic
977646845 4:99422482-99422504 AACACACATCAGGGCCTGTTAGG + Intronic
978562655 4:110050086-110050108 AACAAACTTCAAGGCAAGTTTGG - Exonic
978657399 4:111080519-111080541 AACACACACCAGGGCCTATTGGG + Intergenic
979026808 4:115587900-115587922 AACACACAGCAGGGCAAGTTGGG + Intergenic
979164078 4:117504171-117504193 AACAAAGATGAGGGGAAATTGGG + Intergenic
979834025 4:125339071-125339093 AACATACATCGGGGCATCTTAGG - Intronic
980212790 4:129811479-129811501 AACTAACATCTGGCAAAATTTGG - Intergenic
980557398 4:134427178-134427200 AACAAACATTAGTGCACAGTTGG + Intergenic
981578784 4:146231601-146231623 AACAAAAATCACTACAAATTCGG + Intergenic
983111634 4:163757381-163757403 AATAAACCTCAGGGAAAATGTGG + Intronic
983209379 4:164943145-164943167 AACACACATCAGGGCCAGTCAGG + Intergenic
983402580 4:167284129-167284151 AACACACATCAGGGCATGTTGGG - Intergenic
983807428 4:172012447-172012469 AAAAAACATCACAGAAAATTAGG - Intronic
984985051 4:185320455-185320477 AACACACACCAGGGCCTATTGGG + Intronic
986076597 5:4344243-4344265 AACATACACCAGGGCATGTTGGG - Intergenic
986801412 5:11264379-11264401 AACAAACAGTGGGCCAAATTTGG + Intronic
987177083 5:15324071-15324093 AATAAACATCTGGGCAATATTGG + Intergenic
987514852 5:18892170-18892192 AACACACATCAGGGCCTGTTAGG + Intergenic
987540318 5:19246540-19246562 AACACACACCAGGGCCTATTGGG + Intergenic
987669246 5:20985994-20986016 AACAGACAAAAGGCCAAATTTGG - Intergenic
987734880 5:21827817-21827839 AATAAACATGACGGCAATTTTGG + Intronic
988832660 5:35002979-35003001 AACAAAGGACAGGACAAATTAGG + Intronic
989516742 5:42352980-42353002 AATGAACATCAGGGGAAACTAGG + Intergenic
990626985 5:57624678-57624700 AACAGACAGCAGGGCTTATTTGG - Intergenic
990641992 5:57796841-57796863 AATAAACATAATGGCTAATTTGG - Intergenic
990647533 5:57861250-57861272 AAAAAACATCAAGGCACTTTAGG + Intergenic
991078195 5:62565791-62565813 AACACACACCAGGGCCAGTTGGG - Intronic
991366665 5:65875643-65875665 ATCAAATATGAAGGCAAATTTGG - Intergenic
992203871 5:74410826-74410848 TACAACCATCAGGACCAATTAGG + Intergenic
993213884 5:84993905-84993927 AACAAACATCAGGCCTATTTGGG - Intergenic
993544451 5:89194145-89194167 AACACACACCAGGGCCTATTGGG - Intergenic
994155198 5:96495430-96495452 ATCACACATCAGGGCCTATTGGG - Intergenic
995138061 5:108701860-108701882 AACACACAACAGGGCCTATTAGG - Intergenic
995504440 5:112844500-112844522 AACTTACATCAGGGAAAAATTGG + Exonic
995944334 5:117624656-117624678 AACAATCTTCAGGGGAAATTTGG + Intergenic
995956517 5:117783264-117783286 AACATACATCATGGGAAATGGGG - Intergenic
996138986 5:119881344-119881366 CACAAAAATCAGGTCAAATATGG + Intergenic
998627960 5:143866887-143866909 AACACACACCAGGGCCCATTAGG - Intergenic
999006069 5:147980925-147980947 AACAAACAACATGGAAAATTAGG + Intergenic
999659910 5:153850174-153850196 AACAACCATCAGAGAATATTAGG - Intergenic
1000531903 5:162433132-162433154 AACTAACATCAGGGTAAATGGGG + Intergenic
1000718269 5:164674522-164674544 AACAGACCTCTGGGCAGATTAGG - Intergenic
1001215325 5:169850702-169850724 AACACATATCAGGGCATACTAGG + Intronic
1001352791 5:170986494-170986516 AATAAACATCAGGGTAATTGGGG - Intronic
1002415548 5:179119189-179119211 AAGAAGCATCAGGGAAAATTGGG - Intronic
1002655159 5:180740170-180740192 AACAAACTGCAGAGCAAAATAGG - Intergenic
1003856819 6:10284871-10284893 CCCAAACATCAGGGCCAAGTAGG - Intergenic
1004630277 6:17414416-17414438 AACACACACCAGGGCCTATTGGG - Intronic
1004835313 6:19524465-19524487 AACAGGCAACAGGGCAGATTTGG - Intergenic
1005254421 6:23985361-23985383 AACAACCATCAGCTCACATTTGG + Intergenic
1007920016 6:45598708-45598730 AACTAACATGAGGGACAATTTGG - Intronic
1008748152 6:54698386-54698408 AATAAATATCAAGGGAAATTTGG + Intergenic
1009276104 6:61682497-61682519 AACAATCAGCTGGCCAAATTTGG - Intronic
1010126580 6:72439633-72439655 AACAAAGATCACGGCAGTTTTGG + Intergenic
1010537511 6:77049166-77049188 AATAAATTTCAGTGCAAATTAGG - Intergenic
1010963009 6:82168599-82168621 GAGAAACATCAGGTCAAGTTTGG + Intergenic
1011102775 6:83743186-83743208 AACAAGCATCAGGACAATCTAGG - Intergenic
1011324927 6:86140121-86140143 CAATCACATCAGGGCAAATTGGG + Intergenic
1013725453 6:113090070-113090092 AGCAAACATCAGCAAAAATTTGG - Intergenic
1014222288 6:118809809-118809831 AACTAAGAACAAGGCAAATTGGG - Intergenic
1015051979 6:128852469-128852491 AACAAGCCTAAGGGAAAATTAGG + Intergenic
1017377279 6:153786029-153786051 AACAAACACCAGGGCCTGTTGGG + Intergenic
1017961157 6:159221806-159221828 AAGAAATAACAGGGCAAATGTGG + Intronic
1018882866 6:167902883-167902905 AACAAACAACACAGCAGATTAGG - Intronic
1019736627 7:2653085-2653107 AACACAGCTCAGGGCAAATTTGG + Intronic
1021130673 7:16908938-16908960 AATAATCATCTGGGCAAATGGGG + Intergenic
1021187589 7:17583341-17583363 AACACACATCAGGGCCTGTTGGG + Intergenic
1021206305 7:17785507-17785529 ATCCAACATCTGGGCAAACTAGG + Intergenic
1022635190 7:32125697-32125719 AACACACATCAGGGCCTGTTGGG + Intronic
1023218884 7:37897677-37897699 AACATACATCAGGGCCTGTTGGG - Intronic
1025299002 7:57801742-57801764 AACAAAGATAAGTGCAAAATTGG + Intergenic
1027803129 7:82781460-82781482 AACACACATCAGGGCCTGTTGGG - Intronic
1028644123 7:93076586-93076608 ACCAAACATATGAGCAAATTTGG - Intergenic
1029852089 7:103472996-103473018 AACAAATATCAGAGTAACTTAGG - Intronic
1030210160 7:106988030-106988052 GACAAACGCAAGGGCAAATTGGG - Intergenic
1030951649 7:115798059-115798081 CACAAATATCAGTGCAAATTAGG - Intergenic
1031604914 7:123757213-123757235 AACAAGCATCAGGGCTGACTTGG + Intergenic
1033126087 7:138708501-138708523 AGAAAACATCAGGGCAAGCTGGG + Intronic
1033494873 7:141884030-141884052 AATAAACATAAGAGCACATTGGG + Intergenic
1033512860 7:142077689-142077711 TAATCACATCAGGGCAAATTGGG - Intronic
1033706241 7:143887405-143887427 AGAAAACATAAGGACAAATTTGG + Intronic
1035856727 8:2983786-2983808 AACACACATAAGAACAAATTTGG - Intronic
1036004616 8:4647577-4647599 AACACACACCAGGACATATTGGG - Intronic
1037002704 8:13739643-13739665 AATAAACATCAGCCAAAATTGGG - Intergenic
1039402774 8:37285221-37285243 AACACACACCAGGGCCTATTGGG + Intergenic
1043190960 8:77222433-77222455 AACAACCATCAGAGAATATTAGG - Intergenic
1043576297 8:81662151-81662173 AACAAACATCTGTGGAAATTTGG - Intronic
1043883749 8:85574557-85574579 AACATAAATCAGGGCAAATGTGG + Intergenic
1044288351 8:90437540-90437562 AACAATCAACAAGGCAAATTTGG + Intergenic
1044774197 8:95670566-95670588 AGTAAACATTAGGACAAATTGGG + Intergenic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1045094437 8:98783331-98783353 AACAATCATCAGGGCATAGTGGG - Intronic
1045823395 8:106368562-106368584 AACACACATCAGGGCCTGTTGGG - Intronic
1045952988 8:107872863-107872885 AACATGCACCAGGGCATATTGGG - Intergenic
1046072196 8:109269610-109269632 AAGAAACATCAGGGCACACTTGG + Intronic
1046456410 8:114469756-114469778 AACAGACATTAGAGCAAACTAGG - Intergenic
1047558103 8:125955389-125955411 AACACACACCAGGGCCAGTTGGG + Intergenic
1050440534 9:5657767-5657789 AACAGGCACCAGGGCATATTTGG - Intronic
1050916902 9:11147793-11147815 AAAATAGATCAGGGCAAATCAGG - Intergenic
1051098497 9:13494146-13494168 AACAAAATTCAGTGTAAATTGGG - Intergenic
1051800255 9:20924782-20924804 AACAAGAACCAGGGCAAGTTGGG + Intronic
1052041810 9:23747637-23747659 TACAAACATGAGTGCAAAGTAGG + Intronic
1052241004 9:26273528-26273550 ATCAAACAAGAGGGGAAATTTGG + Intergenic
1052369834 9:27651555-27651577 AACACACACCAGGGCCAGTTGGG + Intergenic
1053189661 9:36052296-36052318 CACATACATCACGGCACATTTGG - Exonic
1053228847 9:36387526-36387548 AAGAAACATCAGGGAATTTTGGG + Intronic
1053794580 9:41714288-41714310 AACAAAGATAAGTGCAAAATTGG - Intergenic
1054182988 9:61926336-61926358 AACAAAGATAAGTGCAAAATTGG - Intergenic
1054470369 9:65531640-65531662 AACAAAGATAAGTGCAAAATTGG + Intergenic
1054655518 9:67662139-67662161 AACAAAGATAAGTGCAAAATTGG + Intergenic
1057290856 9:93806619-93806641 AACACACATCAGGGCCTGTTGGG + Intergenic
1059688049 9:116656829-116656851 AACAAACATCCGTGCAGCTTTGG - Intronic
1185723751 X:2402791-2402813 TACTCACATCAGGGCAAATAGGG + Intronic
1185980130 X:4770005-4770027 AAAACACTTCAGGGAAAATTTGG + Intergenic
1186206861 X:7209787-7209809 AACACACACCAGGGCCTATTTGG - Intergenic
1186318100 X:8392917-8392939 AACACACACCAGGGCCAATCGGG + Intergenic
1188397194 X:29699627-29699649 AAGTCACATCATGGCAAATTAGG + Intronic
1189034956 X:37486432-37486454 TAAAAACATCATGGAAAATTGGG - Intronic
1189778294 X:44489740-44489762 AACAGACAGCAGGGTAGATTTGG + Intergenic
1191160170 X:57321303-57321325 ATCACACATTAGGGCACATTGGG + Intronic
1191776447 X:64819754-64819776 AACACACACCAGGGCCTATTGGG + Intergenic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1192553003 X:72068958-72068980 AACAGAAATCTGGGAAAATTTGG - Intergenic
1193047884 X:77071390-77071412 AACACACACCAGGGCTAGTTGGG - Intergenic
1193848111 X:86500064-86500086 AACAAACTTGAGGTCCAATTGGG + Intronic
1194206391 X:91016196-91016218 GACAAACATGAGGGAAAATTTGG - Intergenic
1194307262 X:92263041-92263063 AACAAAAATCAGCTCAAATTTGG - Intronic
1194789039 X:98122846-98122868 TAATCACATCAGGGCAAATTTGG - Intergenic
1194900666 X:99506781-99506803 AAAAAACATTAGGGCAATATGGG + Intergenic
1195136811 X:101916219-101916241 AACACACATCGGGGCCAGTTGGG + Intronic
1195148336 X:102041169-102041191 AACAAACACCAGGGCCAGTTGGG + Intergenic
1197674956 X:129319298-129319320 AACAAACATCTTGGGAAATGTGG + Intergenic
1197922526 X:131610193-131610215 AATGAACACCAGGGCAATTTGGG - Intergenic
1198823688 X:140676475-140676497 AACAAACATTAGAGAATATTAGG - Intergenic
1199139512 X:144293392-144293414 AACAAACAGAAGAGGAAATTGGG + Intergenic
1199748620 X:150793475-150793497 AAGGAACATCAGGGGAAATGTGG + Intronic
1200552144 Y:4591017-4591039 GACAAACATGAGGGAAAACTTGG - Intergenic
1201751618 Y:17438131-17438153 AACAAACATCAGGGCAAATTGGG + Intergenic
1201923776 Y:19262632-19262654 AACCATCATAAGGGCATATTTGG + Intergenic