ID: 1095634000

View in Genome Browser
Species Human (GRCh38)
Location 12:44409832-44409854
Sequence TTTTTTGTTTTTAATTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095634000_1095634002 -5 Left 1095634000 12:44409832-44409854 CCATGGAAATTAAAAACAAAAAA No data
Right 1095634002 12:44409850-44409872 AAAAAATTCTTATTTTTGGTAGG No data
1095634000_1095634001 -9 Left 1095634000 12:44409832-44409854 CCATGGAAATTAAAAACAAAAAA No data
Right 1095634001 12:44409846-44409868 AACAAAAAAATTCTTATTTTTGG No data
1095634000_1095634003 -2 Left 1095634000 12:44409832-44409854 CCATGGAAATTAAAAACAAAAAA No data
Right 1095634003 12:44409853-44409875 AAATTCTTATTTTTGGTAGGAGG No data
1095634000_1095634006 3 Left 1095634000 12:44409832-44409854 CCATGGAAATTAAAAACAAAAAA No data
Right 1095634006 12:44409858-44409880 CTTATTTTTGGTAGGAGGAGGGG No data
1095634000_1095634004 1 Left 1095634000 12:44409832-44409854 CCATGGAAATTAAAAACAAAAAA No data
Right 1095634004 12:44409856-44409878 TTCTTATTTTTGGTAGGAGGAGG No data
1095634000_1095634005 2 Left 1095634000 12:44409832-44409854 CCATGGAAATTAAAAACAAAAAA No data
Right 1095634005 12:44409857-44409879 TCTTATTTTTGGTAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095634000 Original CRISPR TTTTTTGTTTTTAATTTCCA TGG (reversed) Intergenic
No off target data available for this crispr