ID: 1095634005

View in Genome Browser
Species Human (GRCh38)
Location 12:44409857-44409879
Sequence TCTTATTTTTGGTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095634000_1095634005 2 Left 1095634000 12:44409832-44409854 CCATGGAAATTAAAAACAAAAAA No data
Right 1095634005 12:44409857-44409879 TCTTATTTTTGGTAGGAGGAGGG No data
1095633998_1095634005 26 Left 1095633998 12:44409808-44409830 CCTCAGGTTCTCATGGTGAACAA No data
Right 1095634005 12:44409857-44409879 TCTTATTTTTGGTAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095634005 Original CRISPR TCTTATTTTTGGTAGGAGGA GGG Intergenic
No off target data available for this crispr