ID: 1095636356

View in Genome Browser
Species Human (GRCh38)
Location 12:44438498-44438520
Sequence ATTAAGAGGGCCAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095636356_1095636363 6 Left 1095636356 12:44438498-44438520 CCATCCTCCTTGGCCCTCTTAAT No data
Right 1095636363 12:44438527-44438549 TGAGGAGTATTATACTGAGGTGG No data
1095636356_1095636362 3 Left 1095636356 12:44438498-44438520 CCATCCTCCTTGGCCCTCTTAAT No data
Right 1095636362 12:44438524-44438546 GAATGAGGAGTATTATACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095636356 Original CRISPR ATTAAGAGGGCCAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr