ID: 1095643343

View in Genome Browser
Species Human (GRCh38)
Location 12:44510860-44510882
Sequence AGGTGCCGGCTCAGAGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095643338_1095643343 0 Left 1095643338 12:44510837-44510859 CCTGTCTGACAAAGGCCACTCTG 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1095643343 12:44510860-44510882 AGGTGCCGGCTCAGAGGCACAGG 0: 1
1: 0
2: 0
3: 18
4: 171
1095643333_1095643343 26 Left 1095643333 12:44510811-44510833 CCCAGGCTGGAACCATCTTTGCC 0: 1
1: 1
2: 0
3: 21
4: 238
Right 1095643343 12:44510860-44510882 AGGTGCCGGCTCAGAGGCACAGG 0: 1
1: 0
2: 0
3: 18
4: 171
1095643337_1095643343 5 Left 1095643337 12:44510832-44510854 CCTCTCCTGTCTGACAAAGGCCA 0: 1
1: 0
2: 1
3: 9
4: 214
Right 1095643343 12:44510860-44510882 AGGTGCCGGCTCAGAGGCACAGG 0: 1
1: 0
2: 0
3: 18
4: 171
1095643332_1095643343 27 Left 1095643332 12:44510810-44510832 CCCCAGGCTGGAACCATCTTTGC 0: 1
1: 0
2: 2
3: 12
4: 234
Right 1095643343 12:44510860-44510882 AGGTGCCGGCTCAGAGGCACAGG 0: 1
1: 0
2: 0
3: 18
4: 171
1095643335_1095643343 14 Left 1095643335 12:44510823-44510845 CCATCTTTGCCTCTCCTGTCTGA 0: 1
1: 0
2: 3
3: 48
4: 532
Right 1095643343 12:44510860-44510882 AGGTGCCGGCTCAGAGGCACAGG 0: 1
1: 0
2: 0
3: 18
4: 171
1095643334_1095643343 25 Left 1095643334 12:44510812-44510834 CCAGGCTGGAACCATCTTTGCCT 0: 1
1: 0
2: 1
3: 13
4: 196
Right 1095643343 12:44510860-44510882 AGGTGCCGGCTCAGAGGCACAGG 0: 1
1: 0
2: 0
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095643343 Original CRISPR AGGTGCCGGCTCAGAGGCAC AGG Intronic
900818760 1:4870323-4870345 AGATGCAGGCTGAGGGGCACAGG + Intergenic
901044274 1:6386108-6386130 AGGTCTTGGCTCACAGGCACCGG + Intronic
903647037 1:24902040-24902062 ATGGGCCGGCTCCGAGGCTCCGG - Exonic
903829199 1:26164639-26164661 AGGGGAGGGCTCAGAGGCCCTGG + Intergenic
903833609 1:26189175-26189197 AGGTGCTGGCTTCCAGGCACCGG + Intronic
904620531 1:31772572-31772594 AGGTATCGGCTCAAAGGCACAGG - Intergenic
904629559 1:31830699-31830721 AGCTAGCAGCTCAGAGGCACAGG - Intergenic
906223727 1:44103886-44103908 AGGCGCTGGCTGGGAGGCACTGG - Intergenic
915081401 1:153355109-153355131 AAGGGCTGGCTCAGAGGCACTGG - Intergenic
921056797 1:211548680-211548702 AGCTGCTGACTCAGAAGCACAGG - Intergenic
922702196 1:227768344-227768366 ACCTGCCGACTCAGAGGCTCAGG - Intronic
922961690 1:229652301-229652323 GGGTGTCAGCTCAGAGGCTCTGG + Intronic
923087530 1:230712879-230712901 AGGTGCTGGCCAAGAGGCAGGGG - Intronic
1062961515 10:1576375-1576397 AGGAGGGGGCTCAGAGTCACAGG + Intronic
1063137574 10:3230502-3230524 AGGTGCAGGCGCAGAGGTCCTGG + Intergenic
1067222219 10:44352545-44352567 AGCTGCCGGCTCCAAGGCTCAGG + Intergenic
1067368461 10:45659216-45659238 AGGTCCCAGCCTAGAGGCACAGG + Intronic
1067442244 10:46315229-46315251 AGCTTCCTGCTCAGAGACACTGG + Intronic
1074805372 10:117045356-117045378 AGGTCACAGCCCAGAGGCACAGG + Intronic
1076558245 10:131344333-131344355 AGGTATCGGCTCAGAGGGAGAGG + Intergenic
1076558264 10:131344417-131344439 AGGTATCGGCTCAGAGGGAGAGG + Intergenic
1076558274 10:131344459-131344481 AGGTATCGGCTCAGAGGGAGAGG + Intergenic
1077049466 11:560382-560404 AGGTGCCCGCTCAGAAGGCCCGG - Intronic
1077087749 11:763151-763173 AGGTGCCCACCCAGAGCCACAGG - Intronic
1078565189 11:12408496-12408518 AGGGTCTGGCTGAGAGGCACAGG - Intronic
1080178192 11:29392542-29392564 TGGTGCAGGCTGAGAGGAACTGG - Intergenic
1082025083 11:47565705-47565727 AGGTGCCGGGTCGGGCGCACCGG + Exonic
1083025037 11:59543431-59543453 AGCTGCAGCCTCAGTGGCACTGG - Intergenic
1083152324 11:60799628-60799650 GGGTGATGGCTCAGAGGCAGGGG - Intronic
1083253338 11:61482187-61482209 AGGGGAGGGCTCAGAGCCACGGG - Intronic
1084174541 11:67416435-67416457 AGGAGACGGCACAGAGGCTCTGG + Intronic
1084367484 11:68712133-68712155 ATGTGCAGGCTCAGAGGAAAGGG - Intronic
1084411818 11:69010040-69010062 AGGTGATGGCTGAGAGCCACAGG - Intronic
1085348896 11:75785671-75785693 AGGGACTGGCTCACAGGCACTGG - Intronic
1085464904 11:76716709-76716731 AGGTGACGGCTCTGAGTCAGAGG - Intergenic
1085475159 11:76784409-76784431 AGGCGCCGGCTCACAGGACCCGG + Intronic
1088879901 11:113964981-113965003 AGGTGTCCCCTCAGAGGAACAGG + Intergenic
1091374809 12:18316-18338 ATGGGCGGCCTCAGAGGCACGGG + Intergenic
1095643343 12:44510860-44510882 AGGTGCCGGCTCAGAGGCACAGG + Intronic
1100742952 12:97615307-97615329 AGGTGCTAGCTCTGAGGCCCAGG - Intergenic
1102000931 12:109557785-109557807 AGGTACCGGGTGAGAAGCACAGG + Intronic
1104939488 12:132388213-132388235 AGATGCGGGCTCAGAGAGACGGG + Intergenic
1105520057 13:21123572-21123594 AGGTGCCATCTAAGAGGAACGGG + Intergenic
1106360453 13:29026168-29026190 AAGTGGCCGCTCAGAAGCACGGG + Exonic
1106646994 13:31646979-31647001 AGGTGCCTGGTCAGGGGCAAGGG + Intergenic
1110626176 13:77658615-77658637 AGGGGCCAGGTCAGAGGCCCTGG - Intergenic
1113412595 13:110103358-110103380 GGGTGCAGGCTCACAGGCGCAGG + Intergenic
1113565598 13:111317869-111317891 AAGTGCAGGCGCAGAGGCCCGGG - Intronic
1116653733 14:47626546-47626568 AGGTGCCGACGAAGAGGCGCAGG + Intronic
1117330081 14:54703584-54703606 GGGTGCCGGCACAGAGACTCAGG + Intronic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1120162882 14:81164373-81164395 ATGTGCTGGCTGAGAGGTACAGG - Intergenic
1121643065 14:95499288-95499310 AGGTGGAGGCTGTGAGGCACAGG - Intergenic
1121950430 14:98166855-98166877 CGGGGCTGGCTCTGAGGCACTGG + Intergenic
1122273279 14:100577922-100577944 AGGGGCCAGCTCCCAGGCACGGG - Intronic
1123007659 14:105332223-105332245 AGAAGCAGGCACAGAGGCACAGG - Intronic
1123041774 14:105493169-105493191 AGGGGCTGGCTCAGGGGCACAGG + Intronic
1124232408 15:27956751-27956773 AAGTGCCGGCTCAGTGCCATTGG - Intronic
1125502777 15:40249860-40249882 TGGTGCCATCTCAGAGGCATTGG - Intronic
1131013851 15:89041606-89041628 AGATGCCCGGACAGAGGCACAGG - Intergenic
1132250042 15:100329179-100329201 ACGTACCGGCACAGAGGCAGAGG - Intronic
1132684072 16:1154931-1154953 AGCTGCCGGCTCAGAAGGGCCGG - Intronic
1132720456 16:1313125-1313147 AGGTCCCTGATCAGAGGCAGCGG - Intronic
1135182944 16:20291279-20291301 AGGTGACGGGCCAGAGGCTCTGG - Intergenic
1139546913 16:67653744-67653766 TGCTGCCGGCTCAGTGGCGCCGG - Intronic
1141895417 16:86955858-86955880 ATGTGCCGGCTCAGAGTCCCAGG - Intergenic
1144523475 17:15969888-15969910 AGGGGCCAGTTCATAGGCACCGG - Intronic
1147210221 17:38868998-38869020 AGGTGCCGGGTTTGAGGGACAGG - Intergenic
1150550421 17:66204571-66204593 AGGTGCCAGCTCAGGCGCAGTGG + Intergenic
1151885628 17:76921709-76921731 AAGTCCTGGCTCAGAGGCAGTGG + Intronic
1152242592 17:79168088-79168110 TGGGGCCGGCTCAGAGGCTAAGG + Intronic
1152987914 18:336242-336264 ATGGGCCAGCTCAGAGGGACGGG + Intronic
1153306866 18:3639454-3639476 AGGAGCCTGCACAGAAGCACAGG + Intronic
1158958056 18:62561113-62561135 AGGTGGATGCTCAGAGACACAGG - Intronic
1160324557 18:77932075-77932097 ATGTTCCAGCTGAGAGGCACTGG - Intergenic
1160364523 18:78313006-78313028 AGGTGGCGGAGCAGTGGCACAGG - Intergenic
1160583878 18:79902246-79902268 GGCTGCCGGCCCACAGGCACAGG + Intergenic
1161144841 19:2671350-2671372 AGGTCGAGGCTCAGAGCCACCGG - Intronic
1161408526 19:4103377-4103399 AGGTGCCTCTTCAGAGGCAGAGG + Intronic
1163835346 19:19570058-19570080 AAGGGCCGGCTCTGAGGGACTGG - Intronic
926698170 2:15785027-15785049 AGGTGTCTGCTCAGGGGCACAGG + Intergenic
929599875 2:43198345-43198367 AAGTGCCGGCTCAGAGGTGCTGG + Intergenic
931865142 2:66401411-66401433 AGGTTACAGCCCAGAGGCACAGG + Intergenic
932817989 2:74876999-74877021 AGGTGACGGCTCAGAGGGGCTGG - Intronic
934076820 2:88435564-88435586 AGGTCACAGCCCAGAGGCACAGG - Intergenic
934589234 2:95531178-95531200 AGGTGCCGGCCAAAAGGGACTGG - Intergenic
934604180 2:95681805-95681827 AGCTGCCGGATCAGAGGGCCTGG + Intergenic
936537570 2:113324039-113324061 AGCTGCCGGATCAGAGGGCCTGG + Intergenic
938608257 2:132919344-132919366 AGGTGGAGGCGCAGAGGCCCTGG + Intronic
940468673 2:154064884-154064906 AGGTACCCGCTCAGCTGCACTGG + Intronic
945003314 2:205375620-205375642 AAGGGCCTGCTCAAAGGCACTGG + Intronic
948205451 2:236160637-236160659 AGGGACGGGCTCAGGGGCACAGG + Intergenic
949001803 2:241619043-241619065 AGGTCACGGCTCAGGGACACGGG + Intronic
949041702 2:241852600-241852622 AGGTGCGGCCTCGGAGGCCCCGG - Exonic
1171145463 20:22777611-22777633 AGCTGCCATCTCAGAGGCATTGG - Intergenic
1173631648 20:44520879-44520901 AGGTGGCCGGTCAGAAGCACAGG + Intronic
1175856469 20:62123137-62123159 AGGTGCCAGCTCCGAGGAGCAGG + Intronic
1175985548 20:62762633-62762655 AGGGGCCGGCTCAGGGGCTCCGG - Exonic
1176310669 21:5147268-5147290 AGGTGCGGCCTCAGAGGCTTCGG - Exonic
1178734466 21:35136554-35136576 AGCTGCTGGCTCAGTGGCTCTGG + Intronic
1179846386 21:44114767-44114789 AGGTGCGGCCTCAGAGGCTTCGG + Exonic
1180732302 22:17991226-17991248 ACACGCAGGCTCAGAGGCACAGG - Intronic
1181516990 22:23420228-23420250 TCATGCGGGCTCAGAGGCACAGG - Intergenic
1183482574 22:38073211-38073233 AGGTGTGGGCCCAGAGGCCCAGG + Intronic
1185179443 22:49350617-49350639 AGGGGCCGCATCAGAGGCACTGG - Intergenic
954618055 3:51980356-51980378 AGGTACCAGCTGAGGGGCACTGG - Intronic
954647119 3:52138323-52138345 AGGTGCTGGCTAGGAGGCACAGG + Intronic
960004311 3:112766464-112766486 AGGTGCCGTCTATGAGGAACAGG + Intronic
961044582 3:123699815-123699837 AGGTCCCGGCTCAGGGGCCTTGG - Intronic
961220429 3:125194925-125194947 TGGGGCCGGTTCAGAGGCAGGGG - Intronic
961561039 3:127730454-127730476 GGCTGCCTGTTCAGAGGCACAGG - Intronic
961726191 3:128932624-128932646 AGGCGCCTGCTGAGAGGCATAGG - Intronic
961918035 3:130397722-130397744 TGGGGCTGGCACAGAGGCACAGG + Exonic
962062256 3:131942561-131942583 GGGTGCCAGATCAAAGGCACTGG - Intronic
962198880 3:133385348-133385370 AGGTGCTGGCTGGGATGCACAGG - Intronic
965037634 3:163462176-163462198 AGGTCACAGCTCAGAGACACAGG + Intergenic
966423053 3:179752838-179752860 ACCTGCCTGCTCAGAGGCAGAGG - Intronic
968674845 4:1871698-1871720 AGGGGCCGGCTCAGGGGCTGGGG + Intronic
968979294 4:3837967-3837989 AAGTGCCGGATCAGAGGGGCTGG + Intergenic
969299728 4:6290891-6290913 AGGTGCAGACCCGGAGGCACAGG - Intronic
969299974 4:6292024-6292046 AGGTGCAGGCTGGGAGGCATGGG - Intronic
969299992 4:6292099-6292121 AGGCGCAGGCTGGGAGGCACGGG - Intronic
979716309 4:123842965-123842987 AGGTCACAGCCCAGAGGCACAGG + Intergenic
981847293 4:149184209-149184231 AGCTGCTTGCTCAGAAGCACTGG + Intergenic
985079998 4:186255029-186255051 CTGTGCCGTCTGAGAGGCACTGG + Intronic
985586941 5:745381-745403 AGGGGCCGGATCAGTGGCACTGG - Intronic
985601513 5:837563-837585 AGGGGCCGGATCAGTGGCACTGG - Intronic
985891033 5:2715358-2715380 AGGTGCAGGCTCAGGGGGCCAGG - Intergenic
988149709 5:27362086-27362108 AGGTCACAGCTCAGAGGCATAGG + Intergenic
990922182 5:60979625-60979647 AGGTGCCGGCTCAGCCACAGTGG + Intronic
991655697 5:68901960-68901982 AGGTGGCGACTCGGAGGCAGGGG - Intergenic
992100999 5:73407517-73407539 AGGGCCCTGCTCAGTGGCACAGG + Intergenic
999319500 5:150604730-150604752 AGGTGGCGGCACAGAAGCCCTGG + Intronic
1000907256 5:166978312-166978334 GGGTGCAGGTTCAGAGCCACCGG + Intergenic
1000959535 5:167583756-167583778 AGGTAGAGGCTCAGAGGCAGGGG - Intronic
1001936001 5:175706536-175706558 AGTTGCCTTCTCAGAGCCACAGG + Intergenic
1001956006 5:175848559-175848581 AGGTGCTGGGACAGAGCCACAGG + Intronic
1002283996 5:178150113-178150135 AGGGGCCAGATCTGAGGCACAGG - Exonic
1002453401 5:179331998-179332020 AGCCGCCTGGTCAGAGGCACAGG - Intronic
1007037401 6:38689017-38689039 AGGTGCTGGCTCTGAGACATGGG + Intronic
1012375567 6:98557942-98557964 AGGTGCAGGCCCCGGGGCACTGG + Intergenic
1013799977 6:113931565-113931587 AGGGGCAGGGTCAGAGGCAGAGG - Intergenic
1017633839 6:156424318-156424340 AGGGGCCAGCTCAGGGGCATTGG - Intergenic
1018708947 6:166484026-166484048 CAGTGCCTGCTCAGATGCACGGG - Intronic
1019009700 6:168834207-168834229 AGGTGCAGGCTCTGAGGCCAAGG - Intergenic
1019356597 7:583072-583094 GGGTGACGGCTCACAGGGACGGG + Intronic
1019415977 7:926657-926679 AGGGGCCGGGTCAGAGGCCTGGG + Intronic
1022113496 7:27245046-27245068 AGGGTCCGGCTCCGAGGCGCTGG + Exonic
1022942615 7:35254559-35254581 TGGCGCCGGCTCAGAGGCGCCGG - Intergenic
1023148309 7:37174812-37174834 AGGTGACGGCTCAGTGTCTCAGG - Intronic
1023540606 7:41261322-41261344 AGTTCCCGGTTCAGAGGCAAAGG - Intergenic
1024524432 7:50336414-50336436 GGTTGCAGGCTCAGAGGCACAGG + Intronic
1024638663 7:51311342-51311364 AGGGGCTGGCTCAGAAGCACAGG + Intronic
1025012475 7:55408523-55408545 AGGTGCCCGCTATGAGGCCCAGG - Intronic
1026523145 7:71133124-71133146 GTGTGCCGGCTCCCAGGCACAGG - Intronic
1027176295 7:75905957-75905979 AAGTGACTGCTCAGAGGCACAGG + Intronic
1028317269 7:89419139-89419161 AGGTCACAGCTCAGAGACACAGG - Intergenic
1032864805 7:135914793-135914815 AGGTCCAGGCCCAGAGCCACAGG - Intergenic
1033643348 7:143283487-143283509 AGGTGTAGGCTAAGAGGCACGGG - Intronic
1035775777 8:2186928-2186950 AGGTGGTGGCTCAGATGCAGAGG + Intergenic
1037819815 8:22130217-22130239 AGGTGACGGCGCAGTGGCAGAGG + Intronic
1038696564 8:29812023-29812045 AGGTGCAGCCTCAGTGGCTCTGG - Intergenic
1039992636 8:42502633-42502655 AGGTGCTGGCACAGAGCCTCAGG - Intronic
1047085640 8:121512464-121512486 AGGTGCCAGCTCTTAGGCACTGG - Intergenic
1047525080 8:125626148-125626170 CTGTGCCCTCTCAGAGGCACAGG - Intergenic
1049180717 8:141220712-141220734 AGGCGACGGCTCCGAGGCAGAGG + Intronic
1049660683 8:143818514-143818536 AGATGGCGGCTCAGCGGCAGCGG - Exonic
1050755407 9:8996645-8996667 AGGTGCTGTCTGAGAGGAACAGG - Intronic
1053820189 9:41958577-41958599 AGGTCACAGCCCAGAGGCACAGG - Intronic
1054110463 9:61102276-61102298 AGGTCACAGCCCAGAGGCACAGG - Intergenic
1054610394 9:67228849-67228871 AGGTCACAGCCCAGAGGCACAGG + Intergenic
1054905937 9:70413664-70413686 GGGAGCCGGCTCAGAGGGGCCGG - Exonic
1055469896 9:76601007-76601029 AGGTGCCAGCCGAGGGGCACAGG - Intergenic
1057509208 9:95663671-95663693 AGGTCCTAGCACAGAGGCACGGG + Intergenic
1062233911 9:135499039-135499061 GGGTGGGGGCTCAGAGGCAGAGG - Intronic
1062334489 9:136059036-136059058 AGGTGCTGGGTCAGGGGCAGGGG + Intronic
1062718695 9:138023661-138023683 AGGAGCCGGCGCGGCGGCACCGG + Exonic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1195943965 X:110189652-110189674 AGCTGCCCTCTCAGAGGCATTGG - Intergenic
1198341658 X:135720065-135720087 AGCTGCCTGCGCAGAGGCAGAGG - Intronic
1198346340 X:135763296-135763318 AGCTGCCTGCGCAGAGGCAGAGG + Intronic
1198348246 X:135780581-135780603 AGCTGCCTGCGCAGAGGCAGAGG + Intergenic
1198350148 X:135797844-135797866 AGCTGCCTGCGCAGAGGCAGAGG + Intronic
1198352058 X:135815117-135815139 AGCTGCCTGCGCAGAGGCAGAGG + Intronic
1198353966 X:135832385-135832407 AGCTGCCTGCGCAGAGGCAGAGG + Intronic
1198355874 X:135849635-135849657 AGCTGCCTGCGCAGAGGCAGAGG + Intronic
1198357785 X:135866914-135866936 AGCTGCCTGCGCAGAGGCAGAGG + Intergenic
1198359703 X:135884196-135884218 AGCTGCCTGCGCAGAGGCAGAGG + Intronic
1198366557 X:135945974-135945996 AGCTGCCTGCGCAGAGGCAGAGG + Intergenic
1199501660 X:148513787-148513809 ATGTGCCAGGTCAGATGCACTGG - Intronic