ID: 1095647600

View in Genome Browser
Species Human (GRCh38)
Location 12:44566603-44566625
Sequence TGACCTATATTTACAGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095647600 Original CRISPR TGACCTATATTTACAGCTGG GGG Intronic
902989731 1:20178379-20178401 TGGGCTAGATTTACACCTGGTGG + Intergenic
908445039 1:64191884-64191906 TGACCAATATTTCCAACTGTTGG + Intergenic
911885905 1:103299288-103299310 TGATCTATCCTTATAGCTGGGGG - Intergenic
918178361 1:182065080-182065102 TTACCTGCATTTACAGATGGAGG + Intergenic
918646170 1:186907825-186907847 TGACTTATATTAACAGGTTGTGG - Intronic
919404359 1:197159477-197159499 TGAACTATATTTGCAGGTTGAGG + Exonic
922110926 1:222554542-222554564 TTACCTATATTTACAGCACAAGG - Intergenic
923688533 1:236171374-236171396 TGACCTACATTTCTGGCTGGGGG - Intronic
924133596 1:240939025-240939047 TGACCTTTATTAATAGATGGGGG - Intronic
1064050155 10:12053014-12053036 TTCCCTATTTTTACAGATGGGGG + Intergenic
1065461341 10:25968476-25968498 TGCCCTATATTTACCACTGATGG - Intronic
1071101099 10:82038623-82038645 TGATCTTTATTAATAGCTGGAGG + Intronic
1095647600 12:44566603-44566625 TGACCTATATTTACAGCTGGGGG + Intronic
1095888970 12:47218146-47218168 TGACTTATTTTTGGAGCTGGAGG + Intronic
1101185769 12:102277124-102277146 TAAACTAAATTTACAGCTTGAGG + Intergenic
1108833285 13:54506313-54506335 TTACCTATATTTAAAACTGCTGG - Intergenic
1110935216 13:81279185-81279207 TGTCCTATATTTACCCCAGGTGG - Intergenic
1112993861 13:105548136-105548158 TGACCTATATTTAAGGGTGAAGG - Intergenic
1116423226 14:44758147-44758169 TGAGCTATAATTACTGCTGGAGG + Intergenic
1121833823 14:97074392-97074414 TGACCTAAAATTACAGCATGTGG - Intergenic
1125032957 15:35091297-35091319 GAACCTATATACACAGCTGGTGG + Intergenic
1126268608 15:46785715-46785737 TGATGTATATTTAAAGCTGAGGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1133069706 16:3237155-3237177 GGAACTATATGTACACCTGGAGG + Intergenic
1138747524 16:59380877-59380899 TGACCTATATAAACAGATGGTGG + Intergenic
1141566775 16:84907671-84907693 TGACCTATTTTTTCAGCCGTGGG + Exonic
1141794381 16:86260272-86260294 TGAGGGATATTTACAGATGGGGG + Intergenic
1143740762 17:8952334-8952356 TGCCATTTAGTTACAGCTGGTGG + Intronic
1145231721 17:21177924-21177946 TCACCTATCTTCACAGCTGAGGG - Intronic
1146050294 17:29545542-29545564 TGACCTACATGTAAAACTGGTGG - Exonic
1146704995 17:34994843-34994865 TTACCCATTGTTACAGCTGGTGG + Intronic
1147566613 17:41540350-41540372 TGACCTATATAAACTGCTGGAGG - Intergenic
1147931558 17:43984328-43984350 TGACCTGGATTCACAGCAGGTGG + Intronic
1151128639 17:71872552-71872574 TAACCTACATTTCCAGCTTGAGG - Intergenic
1154940560 18:21109278-21109300 GGACCTTTATTTACATGTGGAGG - Intronic
1156165297 18:34412744-34412766 AGCCCTAGATTTAGAGCTGGTGG + Intergenic
1156514359 18:37667710-37667732 TGAAGTATAATTAGAGCTGGTGG - Intergenic
1156590277 18:38480258-38480280 TCACCAACATTAACAGCTGGAGG - Intergenic
1159010582 18:63055776-63055798 TGAACTATATTTTCAGCTTCTGG - Intergenic
928672674 2:33618600-33618622 TGACCTATTTTTACAGAGGAAGG + Intergenic
936052686 2:109236873-109236895 TGACCTGTACTTACAGCTCAGGG + Intronic
939932760 2:148255056-148255078 TGACCAATGTTTCCAGCTGTTGG - Intronic
1169077778 20:2772036-2772058 TGACCTATATTGACACCTGTAGG - Intergenic
1173351077 20:42246148-42246170 TGATATATATATGCAGCTGGGGG + Intronic
1175488407 20:59362329-59362351 TAAACTACACTTACAGCTGGTGG + Intergenic
1179459938 21:41527695-41527717 TGACTTACATATACAGCTGGAGG + Intronic
1181105135 22:20569772-20569794 TCACATTTACTTACAGCTGGGGG + Intronic
1181418712 22:22781231-22781253 TGACCTATCTTCAGAGCTGGAGG - Intronic
1183867612 22:40716360-40716382 TGAGCAATATGTACAGCTGGTGG + Intergenic
949949752 3:9219451-9219473 TCACCTCTATTTACAGATGAGGG + Intronic
952817346 3:37457213-37457235 TGATCTATATTTAGGGCTGGGGG + Intronic
954846473 3:53563009-53563031 TTGCCTATATTTAAAGATGGAGG + Intronic
957450430 3:80374463-80374485 TGATCTATAATTACAGATGTAGG - Intergenic
963123143 3:141793214-141793236 GGACCTCAATTTACAGCTGGTGG + Intronic
964408753 3:156377265-156377287 TGACCAATGATTCCAGCTGGAGG + Intronic
972560703 4:40225944-40225966 TGTCTCATTTTTACAGCTGGGGG - Intronic
980011146 4:127596009-127596031 TGAGCTATATTTACACTTGAAGG + Intergenic
980920961 4:139084734-139084756 CCACCTTTATTTACAGCTGCAGG - Intronic
986508499 5:8477753-8477775 AGGCCTATAATAACAGCTGGGGG - Intergenic
987712820 5:21525367-21525389 TGAAGTATGTTTACAGCTGAGGG - Intergenic
989652270 5:43705526-43705548 TCACCTATATTTAGAGCTTTAGG - Exonic
994439793 5:99788322-99788344 TGAGAAATATTCACAGCTGGTGG - Intergenic
995652962 5:114391927-114391949 TCACCTCTATTTAGGGCTGGAGG + Intronic
1000125619 5:158240809-158240831 TGACCTATTTTTACATCTCTAGG - Intergenic
1002993039 6:2255628-2255650 TGAGCTATATTCTCATCTGGAGG + Intergenic
1004064820 6:12233728-12233750 TGACCTGTACTCATAGCTGGAGG + Intergenic
1005968526 6:30743561-30743583 AGACCTGCATTTACAGCAGGGGG + Exonic
1009920419 6:70052301-70052323 TGAACTATCTTTACACCTGTAGG - Intronic
1010852177 6:80790795-80790817 TGTCCTATATTTACAGTTTAAGG + Intergenic
1010985937 6:82424101-82424123 TGACTTATTTTTAAAGATGGTGG - Intergenic
1013295259 6:108753186-108753208 TGACCTTGATGTACAGGTGGTGG + Intergenic
1015384629 6:132607784-132607806 TGACCTCTATTAACAACTAGCGG - Intergenic
1018005809 6:159620540-159620562 TACCCTCTATTTACAGCAGGAGG + Intergenic
1021641931 7:22746227-22746249 TGACTTAGATTTATTGCTGGGGG - Intergenic
1023658636 7:42451205-42451227 TGACCTACATTCTCATCTGGAGG - Intergenic
1023862475 7:44224801-44224823 TGCCCTATTTACACAGCTGGTGG + Intronic
1027693089 7:81372963-81372985 TGACCTTTATGACCAGCTGGGGG - Intergenic
1030119783 7:106097850-106097872 TCACATATGTTTACACCTGGAGG + Exonic
1033755886 7:144398278-144398300 TCACCTATATTCCCAGCAGGTGG + Exonic
1037227066 8:16605042-16605064 TGTACTATATTTACAGGTGAAGG + Intergenic
1038264009 8:26022906-26022928 TGACCTAGAGTTGCAGCTGGAGG - Intronic
1039502605 8:38029908-38029930 GGAGCTAAATTTAGAGCTGGGGG - Intergenic
1039690312 8:39857582-39857604 TCACCTAAATTTACACCTGAAGG + Intergenic
1041904193 8:63013484-63013506 TGGCCTATCTTTCCTGCTGGTGG + Intergenic
1043079396 8:75746707-75746729 TAAGCTCTATTTAAAGCTGGAGG + Intergenic
1045470498 8:102508269-102508291 TTACCTTTACCTACAGCTGGAGG - Intergenic
1046014131 8:108585815-108585837 TGACCTTCAGTTACAGCTGCTGG + Intergenic
1055883633 9:81032825-81032847 TGACCTATTTTAATAGCTTGGGG - Intergenic
1056544745 9:87604303-87604325 TGATCCGTATTTACAGTTGGGGG + Intronic
1060428700 9:123528407-123528429 TGCCATATATTTATTGCTGGAGG + Intronic
1061803840 9:133127461-133127483 TGATCTATATTTAGAGCCTGGGG + Intronic
1194108385 X:89799753-89799775 TGAGTTATATATAGAGCTGGAGG + Intergenic
1195596269 X:106693777-106693799 TTACCTGTGTGTACAGCTGGAGG + Intronic
1197633027 X:128884116-128884138 TGGCCTATCTTCCCAGCTGGTGG - Intergenic
1200461041 Y:3454489-3454511 TGAGTTATATATAGAGCTGGAGG + Intergenic