ID: 1095647849

View in Genome Browser
Species Human (GRCh38)
Location 12:44570226-44570248
Sequence TTCCTTTTGCTCACATTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095647849_1095647851 15 Left 1095647849 12:44570226-44570248 CCACTAAATGTGAGCAAAAGGAA 0: 1
1: 0
2: 1
3: 26
4: 260
Right 1095647851 12:44570264-44570286 TATGTCATGTGTGGCGATGCTGG 0: 1
1: 0
2: 1
3: 3
4: 63
1095647849_1095647852 30 Left 1095647849 12:44570226-44570248 CCACTAAATGTGAGCAAAAGGAA 0: 1
1: 0
2: 1
3: 26
4: 260
Right 1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG 0: 1
1: 0
2: 1
3: 9
4: 83
1095647849_1095647850 6 Left 1095647849 12:44570226-44570248 CCACTAAATGTGAGCAAAAGGAA 0: 1
1: 0
2: 1
3: 26
4: 260
Right 1095647850 12:44570255-44570277 TCGTGTTGCTATGTCATGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095647849 Original CRISPR TTCCTTTTGCTCACATTTAG TGG (reversed) Intronic
901024783 1:6273441-6273463 TTCCTTTTGCCTGCATTTAGCGG - Intronic
903008384 1:20313347-20313369 TTCCTGTTGCTCACAAATGGTGG + Intronic
904123140 1:28216372-28216394 TTCCTTTTCCTCAGAACTAGTGG - Intronic
904123301 1:28217644-28217666 TTCCTTTTCCTCAGAACTAGTGG - Intronic
904123459 1:28218929-28218951 TTCCTTTTCCTCAGAACTAGTGG - Intronic
904278932 1:29404822-29404844 TTGCTTTGGCTCACACTTGGTGG + Intergenic
904918970 1:33991611-33991633 TTCCTTTGGCTCCCTTTCAGGGG - Intronic
905094502 1:35457606-35457628 TTGCTTATGCTCACATTTTGAGG - Intronic
905919541 1:41710292-41710314 TTCCTTTTGGTCACATGAAGAGG - Intronic
908299604 1:62750686-62750708 TTCTTTTTGCTCACGGGTAGTGG + Intergenic
909016944 1:70390549-70390571 TTCCTTTTGTTAACATTGAATGG - Intergenic
909526013 1:76623405-76623427 TTCCTATTGCACAGAATTAGGGG + Intronic
910033111 1:82755813-82755835 TTTCTTTTCCTCAAGTTTAGAGG - Intergenic
910913891 1:92268326-92268348 TTTATTTTGGTCAGATTTAGTGG - Intronic
912013175 1:104997314-104997336 TTCCTTTTTGTCACATCTATGGG - Intergenic
912458737 1:109817430-109817452 TCCATTCTGCTCACATTTACTGG + Intergenic
912521178 1:110245820-110245842 TTCCTCTTTCTGACATTGAGAGG + Intronic
914048216 1:144107870-144107892 TTCCTTTTGCACAGAATGAGAGG - Intergenic
914130968 1:144857578-144857600 TTCCTTTTGCACAGAATGAGAGG + Intergenic
916581280 1:166111590-166111612 TTCCTTTTGGTCACCTGAAGTGG + Intronic
918339494 1:183556332-183556354 TCCCTGTTGATCACAATTAGGGG - Intronic
918683878 1:187390686-187390708 TGTCTTTTACTAACATTTAGTGG - Intergenic
919001445 1:191837000-191837022 TTTTTTTTGCTCTCATTAAGAGG - Intergenic
919028875 1:192213447-192213469 TGCCTTTTTCTCAAACTTAGGGG - Intergenic
919603835 1:199655187-199655209 TGCCTATGGCTCAAATTTAGTGG - Intergenic
921179644 1:212621973-212621995 TTCTTTTGTTTCACATTTAGAGG + Intergenic
921304223 1:213779826-213779848 TTTCTTTTTCTCAAATATAGAGG + Intergenic
923412526 1:233724530-233724552 TTGCTGTTGCTCACTTTTTGGGG + Intergenic
923546340 1:234926431-234926453 TTCGTTGTTCTCACAGTTAGTGG + Intergenic
924198144 1:241631581-241631603 CTCATTTTCCTCACATATAGAGG + Exonic
1063483147 10:6394532-6394554 TTCCTTTTTCTGACCTTCAGCGG + Intergenic
1064135226 10:12744965-12744987 TTCCTTGTGCTCAGGTATAGTGG + Intronic
1065853531 10:29811487-29811509 TTCTTCTTGCTCACATTCAGGGG - Intergenic
1067010850 10:42712265-42712287 TTCCATTTGCTAACATTGTGAGG + Intergenic
1067312661 10:45128944-45128966 TTCCATTTGCTAACATTGTGAGG - Intergenic
1067731083 10:48811971-48811993 TTCCTTTTGGGCACAGCTAGGGG + Intronic
1068176147 10:53461669-53461691 TTGCTTTTTCTCAGTTTTAGGGG + Intergenic
1068241185 10:54302543-54302565 TGCTTTTGGCTCACAGTTAGTGG - Intronic
1069068354 10:63969562-63969584 TTTCCTTTGCCCACTTTTAGTGG - Intergenic
1069809818 10:71150027-71150049 TTTCTTTTGTTCACATCAAGGGG + Intergenic
1070644381 10:78191379-78191401 CTCCTTTTGCTCCCATTAAAGGG + Intergenic
1071026206 10:81116861-81116883 TTAATTAGGCTCACATTTAGAGG - Intergenic
1073281387 10:102356889-102356911 TTCCTATAGCTTACTTTTAGTGG - Intronic
1076719143 10:132385520-132385542 TTCCTTTTGCTCAGTATTTGTGG + Intergenic
1076766559 10:132637935-132637957 TTCCTTTTGCTCATCTTTAGTGG + Intronic
1079075758 11:17384662-17384684 CTCCTTTTGCCTACGTTTAGGGG - Intergenic
1080976182 11:37343395-37343417 TTCCCTTTGCACACAGTGAGAGG - Intergenic
1083140069 11:60714465-60714487 TTTCTTTTCCCCACATTCAGAGG + Intronic
1086247510 11:84771435-84771457 TATCTTTTGCTCACTTTTAATGG + Intronic
1088338071 11:108730661-108730683 TTTTTTATGCTCACATTTATAGG - Intronic
1090787548 11:130063374-130063396 TTCCTTTTCCTTACATTTTCAGG - Intergenic
1092460907 12:8685558-8685580 TTCCGTTTGCTAATATTTTGAGG + Intronic
1093244546 12:16720412-16720434 TACCTTCTGCTCACATGTTGAGG - Intergenic
1093376673 12:18436459-18436481 TTCTTTTTGCAGACATTAAGGGG + Intronic
1093872294 12:24306791-24306813 TGACATTTGTTCACATTTAGGGG - Intergenic
1094330164 12:29282669-29282691 GTCCTTTTGATCACATTTCCTGG - Intronic
1094593529 12:31843454-31843476 TTCTTTTTGCTCAGATCTGGAGG - Intergenic
1095647849 12:44570226-44570248 TTCCTTTTGCTCACATTTAGTGG - Intronic
1095924068 12:47561050-47561072 TGCCTCTTCATCACATTTAGAGG - Intergenic
1097407495 12:59208699-59208721 TTCCTTTTCCTCCCATCCAGAGG + Intergenic
1097967679 12:65598040-65598062 TTCTTTTTGCCCACATTGAATGG - Intergenic
1098158867 12:67628459-67628481 TTTCCTTTGTTCATATTTAGAGG + Intergenic
1098677598 12:73310275-73310297 TGCCTTTTGCCCACATTTAATGG + Intergenic
1099589164 12:84564875-84564897 TTCCTTTTCTTTAGATTTAGAGG + Intergenic
1099633016 12:85174839-85174861 TTCATTTTCCTAACATTTAGTGG - Intronic
1101767694 12:107717515-107717537 TTCCTTCTGTCCACATTTTGGGG - Intergenic
1105525340 13:21172712-21172734 CTCCTTTTCCTTACATTTATTGG - Intronic
1106054279 13:26223352-26223374 TTTCTTCTGCTTACATTTACAGG + Intergenic
1106445035 13:29821468-29821490 TACCTTTTGCAGACATTTATTGG + Intronic
1108710050 13:53024476-53024498 TGCCTCTTTCTCACAGTTAGAGG + Intergenic
1109082235 13:57919226-57919248 TTCCTGTTCCTCCCATATAGAGG - Intergenic
1109162081 13:58988051-58988073 TTCCTATTGCTGAGCTTTAGAGG - Intergenic
1111097936 13:83538972-83538994 TTCTCTGTGCTCACATTTGGTGG - Intergenic
1111274024 13:85924606-85924628 TTCCTTTCACTTACACTTAGAGG + Intergenic
1111332400 13:86776849-86776871 TGTCTTTTGCCCACATTTAATGG + Intergenic
1111682625 13:91462250-91462272 TTCATTCTGATCACATTTGGGGG + Intronic
1112277551 13:98035392-98035414 TTCTTTTTGCCCACTTTGAGTGG - Intergenic
1112896084 13:104302432-104302454 TTCCTTTTGCTGATATTAAATGG - Intergenic
1117722434 14:58640532-58640554 TTCCACTTTCTCACATTTTGTGG - Intronic
1118807206 14:69248577-69248599 TTCCCTTTTGTCACATCTAGTGG + Intergenic
1119954395 14:78780586-78780608 TTTCTCTTGATCACATGTAGGGG - Intronic
1120128310 14:80773834-80773856 TTCCTTTTGCTTACATTTTATGG - Intronic
1120452890 14:84692844-84692866 TAGCTTTTGCTCTGATTTAGGGG + Intergenic
1122380421 14:101300486-101300508 TTCCATTTGCTCTCATCTATAGG - Intergenic
1124599576 15:31121777-31121799 TTCCTTCTGCTTCCATTTTGTGG - Intronic
1126261718 15:46700815-46700837 ATCCCTTTGCTCACATCAAGGGG - Intergenic
1127506434 15:59602547-59602569 TTGCTTTTGCTCATTTTTTGTGG + Intronic
1127582782 15:60352808-60352830 CTCCCTTTGGGCACATTTAGGGG + Intronic
1128726364 15:69991384-69991406 TTCCTTTTGTTCTCATTAAATGG + Intergenic
1128997305 15:72306508-72306530 TTCCTTTGGATCAAATTTGGGGG + Intronic
1131544035 15:93300784-93300806 TTCCTATTGCTTACTTTCAGAGG + Intergenic
1132036610 15:98490628-98490650 TTCCTTTTTCTAACCTTTGGAGG - Intronic
1132292088 15:100710895-100710917 TTCCTTCTGCTCACTTTTCCAGG - Intergenic
1134192584 16:12133943-12133965 TTCCTTTTGCTAAGAATTACTGG + Intronic
1134677200 16:16099032-16099054 TTCATTTAGCACACATTTACTGG + Intronic
1140700361 16:77575598-77575620 TTCCTTTTGCTCTTATTCTGAGG + Intergenic
1147450943 17:40503474-40503496 TTCAATTTGCTAACATTTTGTGG + Intergenic
1147976497 17:44250958-44250980 TTCATTTTGCTCACCTGTAAAGG - Intronic
1148528602 17:48366914-48366936 TTGCTGTTGCTCTCATTTATTGG + Intronic
1148559794 17:48599277-48599299 TTCCTTGTGCCCAGATTTACTGG - Intronic
1149332085 17:55594443-55594465 TTACTTATGCTCTCATGTAGTGG - Intergenic
1149563005 17:57622639-57622661 TTTTTTTTGCTCACATTTCAGGG - Intronic
1149989047 17:61370307-61370329 TTCCTTTTGGTGACAGTTTGGGG - Intronic
1152011157 17:77719116-77719138 TCCCTTTTTCTTCCATTTAGTGG + Intergenic
1153471741 18:5453949-5453971 TTCATTTTCCTCACATTTAAAGG + Intronic
1155262775 18:24060842-24060864 TTTCTTTTGGCCACATTTTGGGG + Intronic
1155898389 18:31357308-31357330 TTTCTTTTTCTGACACTTAGGGG + Intergenic
1156625049 18:38898828-38898850 TTCAGTTTGCTCAGATTTAATGG - Intergenic
1156901297 18:42303068-42303090 TTCTTTTTTCTTATATTTAGAGG - Intergenic
1158782590 18:60668766-60668788 TGCCTTTTGCTGACATCTACTGG - Intergenic
1159633386 18:70776236-70776258 TTCATTTTGCTGACATTTAAAGG - Intergenic
1159669630 18:71207052-71207074 TTCCTTAAGCTCACATAAAGAGG + Intergenic
1160001635 18:75029983-75030005 TGCCATTTGCACACATTTACAGG - Intronic
1160153946 18:76418663-76418685 TTTCTTTTTTTCACATTTAGAGG - Intronic
1162688871 19:12412558-12412580 TTGTTTTTGCTGACATTTCGTGG - Intronic
1162733628 19:12733978-12734000 CTCCCTTTCCTCACAATTAGTGG + Intronic
1163365182 19:16872022-16872044 TTCCTTGTGTTGACATTCAGTGG - Intronic
1165979155 19:39705235-39705257 TTCCTTTTCCTCACTCTTACTGG - Intronic
1202687668 1_KI270712v1_random:60765-60787 TTCCTTTTGCACAGAATGAGAGG - Intergenic
926695294 2:15766593-15766615 TTCCTGTTGCTCTGATTTATGGG - Intergenic
927503334 2:23596692-23596714 TTCCTATCGCCCTCATTTAGAGG - Intronic
927670462 2:25064755-25064777 TTCCCTTTGCTTCCATTTATTGG + Intronic
928889446 2:36186188-36186210 TCCTATTTGCTAACATTTAGAGG - Intergenic
929409936 2:41687105-41687127 TGCCCTTTGGTCACATTTAGGGG + Intergenic
929630661 2:43458298-43458320 TTGCTTTTGCTCACATTTCAGGG - Intronic
930368313 2:50471658-50471680 TTCATTTAGCTCTCATTTATAGG - Intronic
931893510 2:66702586-66702608 TGCCCTTTGCTCAGATTTATGGG - Intergenic
933958686 2:87394820-87394842 TTCCTTTTGCACAGAATGAGAGG + Intergenic
934020524 2:87947049-87947071 GACCTTTTGGTCACATTGAGTGG + Intergenic
934242816 2:90286826-90286848 TTCCTTTTGCACAGAATGAGAGG + Intergenic
934270360 2:91529857-91529879 TTCCTTTTGCACAGAATGAGAGG - Intergenic
934971591 2:98768718-98768740 GTCCTTTTTCTAGCATTTAGAGG - Intergenic
935023775 2:99256701-99256723 ATCCTTCTGCTCTCAGTTAGTGG + Intronic
936904738 2:117524495-117524517 TCCTTTTTGCTCAAATTTAAGGG - Intergenic
937315465 2:120929466-120929488 ATCATTTTGTCCACATTTAGTGG + Intronic
937415554 2:121711690-121711712 TTCTTTTTACTCTCACTTAGTGG - Intergenic
937460388 2:122080227-122080249 TTTCTTTTGCTGACTTTTATGGG - Intergenic
939072991 2:137566288-137566310 GTCCATTTGCTCACATGCAGTGG + Intronic
939649282 2:144741820-144741842 TTTCTTTTTCTCACTTCTAGAGG - Intergenic
943839276 2:192557801-192557823 TTTATTATTCTCACATTTAGAGG + Intergenic
944163671 2:196694026-196694048 TTCATTTTGCTAATATTTTGTGG + Intronic
944851793 2:203727185-203727207 TTTCCTTTGCTGACATTGAGCGG + Intronic
945350043 2:208766710-208766732 TTCTTTGTGCTCAAATTGAGAGG + Intronic
945479003 2:210322535-210322557 TTTCTCTTGCTCAGATTTTGGGG - Intergenic
946694638 2:222342325-222342347 TTCCTTGTCTTCACATTGAGTGG - Intergenic
947382316 2:229556954-229556976 CTCCCTTTGATCACATCTAGGGG + Intronic
948582701 2:238998682-238998704 TTGTTTCTGCTCACATTTGGTGG + Intergenic
1169632144 20:7646064-7646086 TAACTTTTCCTCACATTTAGGGG - Intergenic
1177901440 21:26921587-26921609 TTCCCTTTGTTCACAATTCGTGG + Exonic
1179129416 21:38621362-38621384 TCACTTTTGCTCACTTTTACTGG - Intronic
1179596762 21:42448195-42448217 TTGCCTTTTCTCACTTTTAGAGG + Intergenic
1181348774 22:22240511-22240533 TTCCTGTTGTTCACAGTTAGTGG + Intergenic
1181350258 22:22250183-22250205 TTCCTTTTGCACAGAATGAGAGG - Intergenic
1184824075 22:46935232-46935254 CTCCTGTAGCTCACATTCAGAGG + Intronic
1185092267 22:48782432-48782454 CTCCTCTTGCTCACATTTATGGG + Intronic
949315844 3:2754114-2754136 TTCATCTTTCTCACATGTAGGGG - Intronic
951829551 3:26910472-26910494 TTCCTTTTCTAAACATTTAGAGG - Intergenic
952230275 3:31422438-31422460 TCACTTCTGCTCACATTTTGTGG - Intergenic
955225624 3:57058010-57058032 TTCCTTTTCCTCATATTGACTGG + Intronic
956490444 3:69766066-69766088 TTCCATTTTCTTATATTTAGTGG - Intronic
956581121 3:70814899-70814921 TTCCTTTTAGTCAAAGTTAGTGG - Intergenic
957506794 3:81131766-81131788 TTCTATTTGCACACATTTATGGG - Intergenic
959084667 3:101838652-101838674 TTGCTTTTGCTTACATTTTCTGG - Intronic
960285478 3:115823651-115823673 TTCCTTTTCTCCACATTTAAAGG - Intronic
963452193 3:145496012-145496034 TTCCTTTTGCTACCATTTGTTGG + Intergenic
963730257 3:148964371-148964393 TTACTATTGCTCCCATTAAGAGG - Intergenic
963938618 3:151079337-151079359 TTCCTTTTGCTCTAATTTCATGG + Intergenic
964524275 3:157601193-157601215 TTCAATTTACTCACATTTACAGG - Exonic
965341715 3:167499260-167499282 TTCCTTATGTCCACAGTTAGGGG - Intronic
965569893 3:170161689-170161711 TTTATTTTGCACACTTTTAGAGG + Intronic
965991738 3:174827403-174827425 TGCCTTTTCCCCACATTTACTGG + Intronic
966477340 3:180365605-180365627 TTCCCTTTGCTCAGTTTTAGAGG + Intergenic
966700326 3:182842258-182842280 TTTGTTTTGTTTACATTTAGTGG + Intronic
966718527 3:183037967-183037989 TTACTTTTGATCCCATTTATTGG - Intronic
967322227 3:188206002-188206024 TTCCTTTTGCTAACACTGAGAGG + Intronic
969894679 4:10292412-10292434 TTCAGCCTGCTCACATTTAGTGG - Intergenic
972785436 4:42322167-42322189 TTCCTTTAGCTCACCTTTCTAGG - Intergenic
972972168 4:44590959-44590981 TTCCTTTTGCTCTCTCTCAGAGG + Intergenic
975305220 4:72841493-72841515 CTGCTTTGGCTCACATTCAGTGG + Intergenic
975801314 4:78061145-78061167 TTTCTTTTGATAAAATTTAGAGG - Intronic
976177473 4:82369635-82369657 TTCCTCTTTCTCCCATTTTGAGG - Intronic
976695320 4:87913256-87913278 TTTCTTTAGCTGACAGTTAGGGG - Intergenic
976992372 4:91382676-91382698 CTCCTTTGGCTCACACTTGGTGG + Intronic
977467252 4:97398202-97398224 TACCCTTTGCTCACTTTTTGAGG + Intronic
977654465 4:99505161-99505183 CTGCTTTTGCTCACATGTGGAGG - Intergenic
978353878 4:107849775-107849797 TTCCCTCTGCTCTCAATTAGAGG + Intronic
978666418 4:111188902-111188924 TTCCTATTGCTCATTTTTAAGGG + Intergenic
980805746 4:137811253-137811275 TTCCTGTTTTTCACATTTACAGG - Intergenic
981705351 4:147653492-147653514 TTCCTTTTGGTTCCTTTTAGTGG - Intronic
982512032 4:156294797-156294819 TTCCTTTTGCTGCCATCTACTGG - Intergenic
983170227 4:164527770-164527792 TTGCTCTTGCTAACAATTAGTGG + Intergenic
983490698 4:168385778-168385800 TGCGTTTTGCTCATATTCAGAGG + Intronic
984547121 4:181119728-181119750 TCGCTGTTTCTCACATTTAGAGG - Intergenic
984624017 4:181985641-181985663 TTCGATTTGCTAACATTTATGGG - Intergenic
985951192 5:3222556-3222578 TTCCTTTTTCTCACTTAGAGGGG + Intergenic
986107794 5:4676573-4676595 TTCCATTTTGTCACATTCAGAGG + Intergenic
986107818 5:4677008-4677030 TTCCATCTGGTCACATTCAGAGG + Intergenic
986620960 5:9673884-9673906 TTCTTCCTGCTCTCATTTAGGGG - Intronic
987780473 5:22427451-22427473 TTCCTTTTGGTCAGATGCAGTGG - Intronic
987946273 5:24612738-24612760 TTTCATTTGTTCACATTTACTGG + Intronic
987956070 5:24741927-24741949 TTCGTTTTCCTCAAATTTTGGGG + Intergenic
988929826 5:36026978-36027000 TTGCCTTTGCTCACTTTCAGAGG - Intergenic
989514181 5:42322482-42322504 TTTCATTTGAACACATTTAGTGG + Intergenic
990957108 5:61352864-61352886 TTTCTTTTGCTCACATGCATAGG + Intronic
991193129 5:63899276-63899298 TTCTTTTTTCTGACATTTTGTGG - Intergenic
992079672 5:73223312-73223334 TTCTTTTTTCTTACATTTGGAGG - Intergenic
992811075 5:80389292-80389314 TTCTTTTTGCTCCATTTTAGTGG - Intergenic
992931726 5:81654345-81654367 TACCTTTTGCTCACCTTGAATGG + Intronic
994086864 5:95768555-95768577 TTCCTTTTGCTCAAATAAAAAGG - Intronic
994190546 5:96864208-96864230 TTCCTTGTACTTAGATTTAGTGG + Intronic
995105130 5:108368944-108368966 TTCCTTTTGGTCAAATTGTGAGG - Intronic
995207558 5:109499355-109499377 ATCCTTTTATTTACATTTAGGGG + Intergenic
995398957 5:111719023-111719045 TTCCTTCACCTCTCATTTAGTGG + Intronic
996103801 5:119474387-119474409 TTCCTTTCCCTCAGATTCAGTGG + Exonic
996233459 5:121095992-121096014 TTCCTTTTACCCACATCCAGTGG + Intergenic
997626239 5:135332726-135332748 GTCCTTTTGGTGACATCTAGTGG + Intronic
997635991 5:135406640-135406662 TTTCTTTTTCTCCCTTTTAGTGG - Intergenic
998339952 5:141408591-141408613 TTCCTTTTTATCAAATTGAGGGG - Exonic
998978566 5:147675219-147675241 TTCCTTTTCCTCACCCTTTGTGG - Intronic
999349411 5:150854067-150854089 TTCCTTTTGTGTACATTTTGTGG + Intronic
999524637 5:152391298-152391320 TTCCTTTCACTTACACTTAGAGG + Intergenic
1000376921 5:160591371-160591393 TTATTTTTGCCCACATTTAATGG - Intronic
1000456823 5:161459844-161459866 TTTTTTTTTCTCACATTTACAGG - Exonic
1000888877 5:166780810-166780832 TTCCTTTTCCATACACTTAGAGG - Intergenic
1001357435 5:171042562-171042584 TTCCTTTTACTTATATTTTGAGG + Intronic
1001893256 5:175356841-175356863 TTCTTTTTGGTCTCATTTGGGGG - Intergenic
1006894862 6:37461528-37461550 TTCCTTGTGCTCTCATTTCAGGG + Exonic
1007103602 6:39268456-39268478 TTCCTTTTGGCCCCAGTTAGAGG + Intergenic
1008767796 6:54940614-54940636 TTCCTTTTGCTCAGGTAAAGTGG - Exonic
1008946272 6:57100440-57100462 TTCCTTTTGCTGACCTTGAGTGG + Intronic
1009360878 6:62811167-62811189 TTCATTTTGCTCATATTTCATGG - Intergenic
1010124698 6:72418681-72418703 TGGCTTTTGCTGACATTCAGAGG + Intergenic
1014394897 6:120915005-120915027 GTCCTTTTGATATCATTTAGGGG + Intergenic
1015447636 6:133326111-133326133 TTCCTGTTCCTCACATATGGAGG + Intronic
1016516015 6:144893642-144893664 ATCATTTTGCTCACATTCAGGGG + Intergenic
1020284138 7:6667333-6667355 TTCCTGCTGCTCAGATTTATTGG + Intergenic
1020416803 7:7955746-7955768 TTAATTTTGATTACATTTAGAGG + Intronic
1022772368 7:33487676-33487698 TACCCTATGCTCACATTTTGGGG + Intronic
1023007815 7:35892306-35892328 TTCCTTTTGTTCACATATTGAGG - Intronic
1025627969 7:63240053-63240075 TTCCTTTTGTTCACATATTGAGG + Intergenic
1025963386 7:66245000-66245022 TTGCTTTTGATCTGATTTAGAGG - Intronic
1026209950 7:68295281-68295303 TTCGTTTTCCTCCCATTTGGGGG + Intergenic
1026548260 7:71344087-71344109 GTCCTTTTGGTCACTTTTAGAGG + Intronic
1031165593 7:118223996-118224018 TTTCCTTTGGTCACATTTTGTGG + Intronic
1033243062 7:139696678-139696700 TTCTTTGTGCTGCCATTTAGAGG - Intronic
1033569085 7:142609304-142609326 CTCCATTTGCTCAGAGTTAGAGG + Intergenic
1035489233 7:159257709-159257731 TTCCATTTGCCCACATGTAATGG - Intergenic
1036206680 8:6810801-6810823 TAGCTTTGCCTCACATTTAGCGG - Exonic
1037245039 8:16823823-16823845 TTCCTGTTGTGCACATTTAGCGG - Intergenic
1038724530 8:30068709-30068731 TGCCTGTTGCTCAGATTTACAGG + Intronic
1039439677 8:37586211-37586233 CTTCTATTCCTCACATTTAGTGG + Intergenic
1041171514 8:55147156-55147178 TACCTGTTTCTCACATTTACTGG - Intronic
1041568471 8:59308227-59308249 TTTCTTTTGATTAAATTTAGGGG + Intergenic
1042313876 8:67405176-67405198 TCCCTTTTGCTCACATTCCTGGG - Intergenic
1043313460 8:78891369-78891391 TTCCTTTTACTCACAATAATGGG + Intergenic
1044045939 8:87432100-87432122 TTCTTTTTGCTCTCCTTTTGGGG + Intronic
1045796799 8:106055862-106055884 TTCCTTTTGCTTTTCTTTAGTGG + Intergenic
1046610665 8:116420868-116420890 TTCAATTTGCTGACATTTTGTGG - Intergenic
1047058805 8:121198520-121198542 TCACTTCTGCTCACATTTTGTGG - Intergenic
1047909845 8:129516061-129516083 TTACTTCTGCTCACATTTATTGG - Intergenic
1048451880 8:134540658-134540680 GTCTTTTTACTTACATTTAGAGG - Intronic
1048931399 8:139318340-139318362 TTCCATTTTCTCGCATTTAAAGG + Intergenic
1049638803 8:143705080-143705102 CTCCTGTTGCTCATACTTAGAGG + Intronic
1050082466 9:1929387-1929409 TTCTTTTTGCTCTAATTTACAGG + Intergenic
1050583875 9:7089826-7089848 TTTCCTTTGCTCAGATTTGGTGG + Intergenic
1051553808 9:18360070-18360092 TTGCTGTTGCTCACAGTGAGGGG + Intergenic
1051841929 9:21407652-21407674 TTCTTTTTGCTCTCATTTATTGG + Intergenic
1056014738 9:82372200-82372222 TGACTTTTACTCACATTTATGGG + Intergenic
1057003075 9:91530687-91530709 TACATTTTGCTTACATTTAAGGG + Intergenic
1057320690 9:94010019-94010041 TGCTTTGTGCCCACATTTAGAGG - Intergenic
1059835308 9:118145542-118145564 TTATTTTTGCTCACATTTTTTGG + Intergenic
1060155425 9:121316945-121316967 TTCCTCTCGCACACATTTAGAGG - Intronic
1203580100 Un_KI270745v1:35824-35846 TTCATTTGGTTCACATTTGGTGG + Intergenic
1185534190 X:846568-846590 TTCCTTTTGCACAGAATGAGAGG + Intergenic
1186139317 X:6554362-6554384 TTCCTTTTCCTCATATATACTGG - Intergenic
1186353386 X:8763446-8763468 TCCCTTTTCCTCTCTTTTAGTGG - Intergenic
1186794620 X:13032561-13032583 TCCCTTTTCCTCTCTTTTAGTGG - Intergenic
1188761232 X:34032748-34032770 TGTCTTTTGCTCATTTTTAGTGG + Intergenic
1188963858 X:36526795-36526817 TTCCTTCTGCTGAAATTGAGGGG - Intergenic
1191974509 X:66857241-66857263 TTCCTTTAGCTAATATTTAAAGG + Intergenic
1192187384 X:68959189-68959211 TTCCTATTTTTCACATTTTGAGG - Intergenic
1194507225 X:94747078-94747100 TTTCTTTTGTTGCCATTTAGAGG + Intergenic
1195229968 X:102836804-102836826 TTCCTATTACTCACATTCTGTGG + Intergenic
1195262038 X:103142015-103142037 TTTCTTCTTCTCACATCTAGTGG - Intergenic
1196486024 X:116208224-116208246 TTCAATTTGCTAACATTTTGAGG - Intergenic
1198712043 X:139514936-139514958 TTCCATTTCCTCACATTTTTTGG - Intergenic
1199123997 X:144092080-144092102 GACCTTTTGGTCACATTGAGTGG - Intergenic
1199907135 X:152244419-152244441 TTCCTTTAGGTCACTTTTATAGG - Intronic