ID: 1095647852

View in Genome Browser
Species Human (GRCh38)
Location 12:44570279-44570301
Sequence GATGCTGGTGCTCCACAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095647849_1095647852 30 Left 1095647849 12:44570226-44570248 CCACTAAATGTGAGCAAAAGGAA 0: 1
1: 0
2: 1
3: 26
4: 260
Right 1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG 0: 1
1: 0
2: 1
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095647852 Original CRISPR GATGCTGGTGCTCCACAATT AGG Intronic
908918000 1:69155231-69155253 AATCTGGGTGCTCCACAATTGGG + Intergenic
909004256 1:70256490-70256512 GATGCTTGTCTTCCAAAATTTGG - Intergenic
911503193 1:98714646-98714668 AACACTGGTGCTCCAGAATTTGG - Intronic
912115269 1:106398955-106398977 GATGCTGGTAATACACATTTTGG - Intergenic
912463323 1:109852054-109852076 GATGCTGGTGACCCACAGATGGG - Intergenic
912556746 1:110521754-110521776 GAAGCTGGTGCTCCAAACTGAGG - Intergenic
915639160 1:157208665-157208687 GATGCTGCTGCCCCAAGATTCGG + Intergenic
916071150 1:161170704-161170726 GAAGCAGCTGCTACACAATTAGG + Exonic
917220136 1:172719925-172719947 ACTGCTGATGCTCCACAGTTGGG - Intergenic
920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG + Exonic
1068235718 10:54230324-54230346 GATCCTTGTGCTACACAACTGGG - Intronic
1072640996 10:97211308-97211330 GGAGCTGGTCCTCCACAATTAGG - Intronic
1072822035 10:98567788-98567810 GAGGCAAGTGCTACACAATTTGG - Intronic
1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG + Intergenic
1079543605 11:21606284-21606306 GACTCTTGTGCTCCTCAATTAGG - Intergenic
1081008481 11:37777611-37777633 GATGCTGGTGTTCCCAGATTAGG + Intergenic
1086787171 11:90983247-90983269 GTTGCTTGTGCTTCACAGTTGGG + Intergenic
1089183557 11:116599229-116599251 GATGCTGGAGCTCCCCACTGAGG - Intergenic
1090049149 11:123362141-123362163 GTTGCTGGTGATCCACAGTAGGG + Intergenic
1091937902 12:4447887-4447909 TATGCTGGTGGTCCTCACTTAGG + Intergenic
1094311915 12:29093341-29093363 GATGCTGGTGACCTACAGTTGGG - Intergenic
1094345821 12:29467760-29467782 GATGGTGGTGTTCCACACTTAGG - Intronic
1095601176 12:44014498-44014520 GATGCTGATGCTCCTAAATCTGG + Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095658518 12:44700088-44700110 GATGTTGGTGCTGCTCACTTAGG - Intronic
1104722405 12:131052170-131052192 GCTGCTGCTGCTCCACAAATTGG + Intronic
1107178357 13:37426152-37426174 TATGTTGGTGCTCCAGCATTAGG - Intergenic
1112217363 13:97446889-97446911 GATGCTGTGGGTCAACAATTTGG - Intronic
1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG + Intronic
1115908191 14:38224671-38224693 GATTCTGAAGCTCCACAAATTGG - Intergenic
1116812640 14:49554349-49554371 GATGATGCTGCTTCACTATTAGG + Intergenic
1120827810 14:88970885-88970907 GATGCTGCTGCTCCTCCAATAGG - Intergenic
1122703441 14:103605581-103605603 GCTGCTGGTGCTCCTCAATCTGG - Intronic
1127924329 15:63524086-63524108 GATGTTTGTGCTCAAGAATTAGG + Intronic
1140183584 16:72746008-72746030 GAAGATGGTGATCCACAACTCGG + Intergenic
1144020035 17:11232753-11232775 GATACTGGTAGTCCAAAATTAGG - Intergenic
1150348093 17:64420229-64420251 GGTGCTGATGCCCCACAATTGGG + Intergenic
1151651846 17:75475137-75475159 GATGCTGCTGCTCTGCAATCTGG - Intronic
1157141447 18:45111169-45111191 GTTGCTGATGCTCCACAAAATGG - Intergenic
1159666256 18:71163821-71163843 GATGCTGGTGCTCCCCAGGTGGG - Intergenic
925881356 2:8355424-8355446 GATGTTCATGCACCACAATTAGG + Intergenic
927846580 2:26475436-26475458 GATGCTGGTGTTCGACAACCTGG - Exonic
929010812 2:37442283-37442305 GATGCTGTAGCTGCACATTTGGG - Intergenic
933577351 2:84084460-84084482 AATTCTGGGGATCCACAATTTGG - Intergenic
935644487 2:105322976-105322998 GATGCTGGTGCCATATAATTAGG + Intronic
937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG + Intergenic
937687667 2:124716274-124716296 GATGATGGTGCCACACATTTAGG - Intronic
937908025 2:127061833-127061855 GATGCTCGTGCTCCACAATGAGG + Intronic
943241959 2:185396740-185396762 CATGGTGGTACTCCAAAATTAGG + Intergenic
947491296 2:230596771-230596793 AATGCTGGTGCTCCAGTGTTGGG - Intergenic
948606010 2:239135635-239135657 GATGCTGGAGCTCCACTCTTGGG + Intronic
1170543476 20:17412014-17412036 GATGTTGGTGATCTACAAATGGG - Intronic
1171050573 20:21854395-21854417 GATGCTGGTGACCTACACTTGGG - Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1183028449 22:35084137-35084159 GCAGCTGGTGCTGCCCAATTGGG - Intronic
1183232935 22:36594103-36594125 GATCCAGGTGCTCCAAAATCTGG + Intronic
953344749 3:42165875-42165897 GATGCTGGTACCCCACTATTAGG - Intronic
954114366 3:48457293-48457315 GAAGCATGTTCTCCACAATTTGG + Exonic
954533332 3:51339316-51339338 GAACCTGGTGCACCAGAATTTGG - Intronic
955543134 3:59999312-59999334 GATGGTGGTGCTGCACAAAATGG - Intronic
962379074 3:134882523-134882545 GACGCTGATGCTTCATAATTGGG - Intronic
968977118 4:3827809-3827831 GAGGCTGGTCCTCCACCATCGGG - Intergenic
969156533 4:5215872-5215894 GAAGATGGACCTCCACAATTAGG + Intronic
970513559 4:16804918-16804940 GATGCTGGAAATCCAAAATTGGG + Intronic
974705077 4:65503955-65503977 GTTACTGATGGTCCACAATTTGG - Intronic
975384526 4:73740319-73740341 AATACTGAAGCTCCACAATTTGG - Intergenic
985764859 5:1771950-1771972 GATGCTGGGGCTCCACTGATTGG + Intergenic
989149866 5:38288793-38288815 GAAGCAGTTGCTCAACAATTTGG - Intronic
989196758 5:38723951-38723973 GAGGCTGGAGGTCCACGATTAGG + Intergenic
996817088 5:127586441-127586463 GATGCTGGAGTCCCACAATCTGG - Intergenic
1001458348 5:171885485-171885507 GAAGCTGCTGCCCCACAAATTGG - Intronic
1002393273 5:178933255-178933277 GATGCTCTTGTTCCACAATCTGG + Intergenic
1002433560 5:179218215-179218237 GCTGCTGGTGCTCCAGGCTTTGG - Intronic
1021642406 7:22751963-22751985 GATGCTGTTGCCCCAAATTTTGG - Intergenic
1024560423 7:50640255-50640277 GATGCTGGAGATCCCCAAATGGG + Intronic
1024610198 7:51057778-51057800 GATGCTGGGGCTCCAGCCTTAGG + Intronic
1024770216 7:52713479-52713501 GAAGCTGGTGCTCCCCAAACTGG - Intergenic
1028909523 7:96192440-96192462 GATTCTGGTGCTCCACGAGCAGG + Intronic
1030056969 7:105591655-105591677 TATGCTGGTGGTCCACACATAGG - Intronic
1032452231 7:132042931-132042953 GATGCTTGCCCTCCACTATTGGG + Intergenic
1033556716 7:142494617-142494639 TATGCTGGTACACCACAAATTGG + Intergenic
1034999691 7:155603021-155603043 CACGCTGGTGCTCCACACTCGGG + Intergenic
1040605126 8:48923964-48923986 GAAATTGGTGCTCCATAATTAGG + Intergenic
1041690557 8:60681730-60681752 CATGCTGGTACTCAAGAATTGGG + Intronic
1046319699 8:112556909-112556931 GATCCTGGCATTCCACAATTTGG - Exonic
1055392066 9:75833638-75833660 GAGGCTGGTGGTCCTCAAATTGG - Intergenic
1055824022 9:80302514-80302536 GATACTGTTACTCCACCATTGGG + Intergenic
1056829862 9:89907070-89907092 GATGCTGGTGACCCACAGATGGG - Intergenic
1057734300 9:97639686-97639708 GATGCTGCTGCTAAACACTTTGG - Intronic
1060052790 9:120389040-120389062 GGTGCAGGTGCTCCACAAACGGG - Exonic
1060212613 9:121719809-121719831 GTTGCTGGTGGTTCACATTTTGG - Intronic
1061648438 9:132026141-132026163 GCTGCTGCTGCTCCTCATTTTGG - Intronic
1186937122 X:14463002-14463024 GATGTTGGTGACCTACAATTGGG + Intergenic
1196686370 X:118513860-118513882 GATGCTGCTGCTCCCCCATAAGG - Intronic