ID: 1095649321

View in Genome Browser
Species Human (GRCh38)
Location 12:44588323-44588345
Sequence TGGCTCAGGCTGCCTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 338}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095649321_1095649332 21 Left 1095649321 12:44588323-44588345 CCTCTCTGAGGCAGCCTGAGCCA 0: 1
1: 0
2: 0
3: 16
4: 338
Right 1095649332 12:44588367-44588389 AAGCTTCACGGCCAAGGCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 146
1095649321_1095649330 15 Left 1095649321 12:44588323-44588345 CCTCTCTGAGGCAGCCTGAGCCA 0: 1
1: 0
2: 0
3: 16
4: 338
Right 1095649330 12:44588361-44588383 CAAGCCAAGCTTCACGGCCAAGG 0: 1
1: 0
2: 1
3: 2
4: 113
1095649321_1095649335 24 Left 1095649321 12:44588323-44588345 CCTCTCTGAGGCAGCCTGAGCCA 0: 1
1: 0
2: 0
3: 16
4: 338
Right 1095649335 12:44588370-44588392 CTTCACGGCCAAGGCTGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 158
1095649321_1095649333 22 Left 1095649321 12:44588323-44588345 CCTCTCTGAGGCAGCCTGAGCCA 0: 1
1: 0
2: 0
3: 16
4: 338
Right 1095649333 12:44588368-44588390 AGCTTCACGGCCAAGGCTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 131
1095649321_1095649326 9 Left 1095649321 12:44588323-44588345 CCTCTCTGAGGCAGCCTGAGCCA 0: 1
1: 0
2: 0
3: 16
4: 338
Right 1095649326 12:44588355-44588377 CCCTCCCAAGCCAAGCTTCACGG 0: 1
1: 0
2: 2
3: 18
4: 210
1095649321_1095649334 23 Left 1095649321 12:44588323-44588345 CCTCTCTGAGGCAGCCTGAGCCA 0: 1
1: 0
2: 0
3: 16
4: 338
Right 1095649334 12:44588369-44588391 GCTTCACGGCCAAGGCTGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095649321 Original CRISPR TGGCTCAGGCTGCCTCAGAG AGG (reversed) Intronic
900406451 1:2495139-2495161 TAGCTCGGCCTGACTCAGAGGGG - Intronic
900564190 1:3324307-3324329 TGGCAAAGGTGGCCTCAGAGAGG - Intronic
900592765 1:3467352-3467374 TGGGTGAGGCTGCCCCACAGAGG + Intronic
901198638 1:7454247-7454269 TGGCTCAGGCGGCCACCTAGTGG - Intronic
901773920 1:11546076-11546098 TGGCTCTGCTTGGCTCAGAGTGG - Intergenic
902385171 1:16072264-16072286 TGGCTCAGGATGTCTCTGGGAGG - Intronic
902968643 1:20030647-20030669 TAGCTCAGGCTGTCTCAGTGGGG + Intronic
903628053 1:24745366-24745388 GGGCTGCGGCTGGCTCAGAGTGG + Exonic
904003651 1:27351956-27351978 AGCCTCTGGCTGCATCAGAGTGG - Intronic
904701890 1:32362648-32362670 CAGCTCATGCTGCCTCTGAGAGG - Exonic
905628535 1:39505214-39505236 TATCTCAGGCTGTCTCAGTGCGG + Intronic
906508380 1:46396479-46396501 TATCTCAGGCTGTCTCAGTGGGG + Intronic
906638704 1:47427865-47427887 TGGATCAGGATGTCTCAGTGAGG - Intergenic
907020161 1:51059422-51059444 TTGCTCAGGGTGGCTCAGTGTGG + Intergenic
907730751 1:57063029-57063051 TGGCTAAGGGTGCCTGAGAATGG + Intronic
911595475 1:99794185-99794207 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
911728808 1:101270129-101270151 TGCCTCAGACTCCCTCAGACTGG + Intergenic
912450883 1:109766965-109766987 TATCTCAGGCTGTCTCAGTGGGG - Intronic
912687365 1:111778025-111778047 TGGCTAAGGCTGCCAGAGTGAGG + Intronic
912740943 1:112196954-112196976 TGGCTCATTCTGCCTCTGTGGGG - Intergenic
912944723 1:114075473-114075495 AGGCATAGGCTGCCTCACAGTGG + Intergenic
913437829 1:118865614-118865636 TGACTCTGGCTGGCTCAAAGAGG - Intergenic
914466000 1:147928675-147928697 TGGCGCAGGCCGCGTAAGAGAGG - Intronic
914924512 1:151872851-151872873 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
916039159 1:160947527-160947549 TATCTCAGGCTGTCTCAGTGGGG + Intronic
916080062 1:161226709-161226731 TGGGTCATGCAGCCTCAGGGAGG + Intronic
917291262 1:173474775-173474797 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
920786603 1:209048490-209048512 AAGCTCAGTCTGACTCAGAGAGG + Intergenic
921874300 1:220176824-220176846 TGTCTCATGTTGGCTCAGAGAGG - Intronic
922133751 1:222805206-222805228 TGGCACAGACTGCCTCTGTGTGG + Intergenic
922222429 1:223618760-223618782 TGGTTCAGGCTGCAGCTGAGCGG + Intronic
922233167 1:223703563-223703585 TGGCCAAGGCTTTCTCAGAGTGG + Intronic
1063453242 10:6165090-6165112 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1065651234 10:27894100-27894122 TGGCCCAGGCTGGATCACAGTGG - Intronic
1066539612 10:36431406-36431428 TTGCTCAGGCTGCAGTAGAGTGG - Intergenic
1067753778 10:48988666-48988688 AGGCTGAGGCTGCCTCATGGAGG - Intergenic
1070870231 10:79744939-79744961 TATCTCAGGCTGCCTCAGTTGGG - Intergenic
1071637150 10:87267159-87267181 TATCTCAGGCTGCCTCAGTTGGG - Intergenic
1071658095 10:87470795-87470817 TATCTCAGGCTGCCTCAGTTGGG + Intergenic
1073480240 10:103781984-103782006 TGGCGTGGGCTGCTTCAGAGAGG - Intronic
1075310337 10:121408343-121408365 TGGCTCTGCCTGGCTTAGAGTGG - Intergenic
1075890060 10:125940708-125940730 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1076132875 10:128025948-128025970 TGGCTCTGGCTGCCAAAGAAAGG - Intronic
1076566839 10:131404650-131404672 TGGCACAGGTTGGCTCACAGGGG - Intergenic
1077439637 11:2561966-2561988 CGACTAAGGCTGCCTCAGGGTGG + Intronic
1078435082 11:11318080-11318102 TGGCCCTGCCTGACTCAGAGGGG - Intronic
1078544042 11:12234041-12234063 TGGGTCAGGGTGGGTCAGAGGGG + Intronic
1078766532 11:14303786-14303808 TGTCTCTGGCTCCTTCAGAGTGG + Intronic
1081973544 11:47216352-47216374 TGACTCAGACTGCCTCTGGGTGG + Exonic
1082898338 11:58217515-58217537 TGGCCCAGGCTGGAGCAGAGTGG + Intergenic
1083254184 11:61486293-61486315 GGGCCCAGGCTGCCTCTGCGGGG + Intronic
1083631361 11:64097162-64097184 AGGCTCAGGATGCTGCAGAGGGG - Intronic
1084105366 11:66977067-66977089 GGGCTTAGCCTGCCTCACAGGGG - Intergenic
1084173609 11:67412160-67412182 TCTGTCAGCCTGCCTCAGAGTGG + Intronic
1084477914 11:69399229-69399251 TGGCTCAGGCTGCCTTGCGGGGG - Intergenic
1084685320 11:70691001-70691023 TGGATGAGGCTGGGTCAGAGTGG + Intronic
1085481391 11:76825525-76825547 TGGTTCAAGCTGACTCAGAATGG + Intergenic
1085882559 11:80485047-80485069 TGGCTCAGTTAGCCTCTGAGAGG + Intergenic
1087034900 11:93745286-93745308 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1089214202 11:116825935-116825957 TGGCACAGGCTGCATCAAAAAGG - Intergenic
1089736809 11:120555321-120555343 TGGCCCTTGCTGCCTCACAGTGG - Intronic
1091749870 12:3015531-3015553 AGGCTCAGGGAGGCTCAGAGAGG - Intronic
1091760870 12:3086404-3086426 TCTCTCAGGCTCCCTCACAGTGG + Intronic
1092234535 12:6798016-6798038 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1093771958 12:23028605-23028627 AGGCTTAGGCTGCCTCAGCTTGG - Intergenic
1095649321 12:44588323-44588345 TGGCTCAGGCTGCCTCAGAGAGG - Intronic
1096001964 12:48137669-48137691 TGGCTCAGGCTGCCCCATCTTGG - Intronic
1096051800 12:48615970-48615992 TGGCTGAAGCTCCCACAGAGAGG + Intergenic
1096181711 12:49554763-49554785 AGGGTAAGGCTGCCTCAGACAGG - Intronic
1097242063 12:57582329-57582351 GGTCTCAGGCTGCCTGGGAGTGG + Intronic
1098029640 12:66240646-66240668 TGCCTCAGGCTGTCCCAGAGGGG + Intronic
1098680574 12:73348553-73348575 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1101030319 12:100651818-100651840 TGGCTCCAGCTGCCCCAGACAGG - Intergenic
1101963232 12:109265357-109265379 GGGCAGAGGATGCCTCAGAGAGG - Intronic
1102609196 12:114096306-114096328 TGGCTCAGCCTCCCCCAAAGTGG + Intergenic
1102848264 12:116211454-116211476 TGGCTGATTCTGCCTCAGAGGGG + Intronic
1103972769 12:124682395-124682417 GGCCTCAGGCTGGCTCAGGGAGG + Intergenic
1106243464 13:27927880-27927902 AGGCACAGGCTGCCTGAGACTGG + Intergenic
1106879592 13:34114761-34114783 TGGCTCAGGCTGCAGCTGAATGG + Intergenic
1107963608 13:45579826-45579848 TGGGTCATGCTGGATCAGAGAGG + Intronic
1110806963 13:79766050-79766072 TAGTTCAGGCTGCCTCACAGCGG + Intergenic
1113244104 13:108376195-108376217 TGGCTCTTGCTGCCTCATAGAGG + Intergenic
1117079158 14:52133477-52133499 TGTCTCTGGCTGCCTGAGACAGG + Intergenic
1117429189 14:55635592-55635614 TTGCTCAGGCTGACTGAGGGAGG + Intronic
1117684242 14:58237230-58237252 TGGCTTAGGCTCCCTCAGCATGG + Intronic
1118862427 14:69674839-69674861 TTGCCCAGGCTGGATCAGAGGGG - Intronic
1118885936 14:69865927-69865949 TCCCTCTGGCTGCCACAGAGAGG - Intronic
1119097919 14:71851418-71851440 TGACTCAGTCTGCCTCAAATGGG + Intergenic
1119760400 14:77146687-77146709 TGGCCCAGGCTGCAGAAGAGAGG + Intronic
1122112849 14:99514108-99514130 TGGCTCACGCCCCCTCAGTGAGG + Exonic
1123027445 14:105433419-105433441 GGCCTCAGGCCACCTCAGAGAGG - Intronic
1123088867 14:105732775-105732797 TATCTCAGGCTGTCTCAGTGAGG - Intergenic
1202904261 14_GL000194v1_random:59492-59514 TGCCTCAGACTGCCCCTGAGGGG - Intergenic
1123707093 15:22958599-22958621 AGGGTCAGGCTGCCTCTGGGAGG + Intronic
1123723751 15:23082336-23082358 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1123876836 15:24631852-24631874 TGGCTGTGGCTCCCTCTGAGTGG - Intergenic
1125579099 15:40773306-40773328 TGTCTCTGGCTGCCCCAGAAAGG - Intronic
1127078104 15:55348100-55348122 TGCCTCAGCCTGCCTCAGCTGGG + Intronic
1129773944 15:78221669-78221691 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1131274987 15:90973448-90973470 TATCTCAGGCTGTCTCAGTGCGG - Intronic
1131511067 15:93049812-93049834 AGTCTCTGGCTGCCTGAGAGGGG + Intronic
1132301622 15:100779645-100779667 TGCCTTAGGAGGCCTCAGAGAGG + Intergenic
1132335262 15:101044323-101044345 TGTCTGAGGCTGTCTCAGTGGGG + Intronic
1132433030 15:101775815-101775837 TGGCTTAGAATGCCCCAGAGAGG - Intergenic
1132474267 16:125483-125505 TGGCCCTGCCTCCCTCAGAGGGG - Intronic
1132520939 16:388443-388465 TATCTCAGGCTGTCTCAGTGCGG + Intergenic
1132866214 16:2093907-2093929 TGGCTGTGGCTGTCTCAGGGTGG - Exonic
1133013533 16:2928359-2928381 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1133148390 16:3807866-3807888 TGGGTCAGGCTGCCTCACAAAGG + Intronic
1134406902 16:13969012-13969034 TGGCTCATGCGGACTCATAGAGG + Intergenic
1136355203 16:29740587-29740609 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1137072968 16:35923411-35923433 TTTCTCAGGCTGTCTCAGTGGGG + Intergenic
1137435196 16:48448961-48448983 CGCCTCAGGCAGCATCAGAGGGG - Intergenic
1137487188 16:48901447-48901469 TGGCTCATTCTGTCTCAGAAAGG + Intergenic
1139658798 16:68405997-68406019 GGGCTAAGGGTGCCTCAGAGGGG - Intronic
1141342159 16:83213243-83213265 TGGCTCAAGCTCTCTGAGAGAGG + Intronic
1141671107 16:85492091-85492113 TGGCACCCGCTGCCTCGGAGGGG - Intergenic
1141736179 16:85855372-85855394 TGTCACAGGCTACCCCAGAGGGG + Intergenic
1142057828 16:88011097-88011119 TGGCTCTGAGTGCCACAGAGCGG + Intronic
1142183162 16:88681459-88681481 TGGTTCAGGCTGTCTTTGAGGGG + Exonic
1142714995 17:1742472-1742494 TGGTTCAGCCAGGCTCAGAGAGG - Intergenic
1143209133 17:5170577-5170599 AGGCTCCGGCTGCCCCAGATTGG + Exonic
1143275052 17:5704108-5704130 GTGCTCAGACTGCATCAGAGGGG - Intergenic
1143307415 17:5958501-5958523 TGGGTCAGACTGGCTCACAGGGG + Intronic
1144618618 17:16800049-16800071 AGGCTCTGGCTGCCCCAGATTGG + Intronic
1144894087 17:18515650-18515672 AGGCTCCGGCTGCCCCAGATTGG - Intergenic
1145033075 17:19520051-19520073 TATCTCAGGCTGTCTCAGTGGGG - Intronic
1145138145 17:20428610-20428632 AGGCTCCGGCTGCCCCAGATTGG + Intergenic
1145367773 17:22278875-22278897 GGAATCAGGCTGTCTCAGAGAGG - Intergenic
1146166677 17:30595065-30595087 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1146923729 17:36730220-36730242 TGGCTCAGGCCAACTGAGAGGGG + Intergenic
1147250772 17:39151501-39151523 TGGCTCAGGCTGCGGCCGCGCGG + Exonic
1147360776 17:39928155-39928177 TGGCCCAGGCTGCCCCGGACCGG + Intergenic
1147652207 17:42069120-42069142 GGGCTGAGGCTGCTGCAGAGAGG + Intergenic
1148482341 17:47968187-47968209 TGAGTCAGGCTGACTCAGATGGG + Intronic
1148713153 17:49696569-49696591 AGGCTCATACTGCCACAGAGTGG + Intergenic
1149871008 17:60181628-60181650 AGGCTCCGGCTGCCCCAGATTGG - Exonic
1150703710 17:67469278-67469300 TGGCACAGGCTGCAGCAGTGGGG - Intronic
1152133328 17:78490352-78490374 AGGGTCAGGCTGCCTCTAAGGGG - Intronic
1152291863 17:79444336-79444358 GGGCTCAGGGTGCCTGAGAGTGG - Intronic
1152639426 17:81443500-81443522 TGCCGTAGGCTGCCTCAGACCGG - Exonic
1153508951 18:5832023-5832045 TGGTGCAGGCTTCCTCAGTGGGG - Intergenic
1154411538 18:14144615-14144637 TGGCTCTGGCTGCCTCAGCCTGG + Intergenic
1157250174 18:46088659-46088681 TATCTCAGGCTGTCTCAGTGGGG - Intronic
1157332904 18:46716462-46716484 TGGCCCAGGCTGCCTGTGGGTGG - Intronic
1157804309 18:50646668-50646690 TTGCTCAAGCTTTCTCAGAGGGG + Intronic
1157825988 18:50813043-50813065 AGGGTCAGGTTGCATCAGAGAGG - Intronic
1159091339 18:63852680-63852702 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1159476069 18:68922317-68922339 CGGCTTATGCTGTCTCAGAGGGG + Intronic
1160073399 18:75648536-75648558 TGGCTCAGGGTACCTGAAAGAGG - Intergenic
1160695698 19:483316-483338 TGGCTCTGGCTGACATAGAGTGG - Intergenic
1160999921 19:1905473-1905495 AGGCTCAGACTTCCCCAGAGGGG + Intronic
1161379225 19:3955890-3955912 TGGCCCAGCCTTCCTCAGTGGGG - Intergenic
1161431398 19:4234375-4234397 TGCCTGGGGCTGCCACAGAGGGG - Intronic
1162128678 19:8512528-8512550 TGGCCAAGGCTGGCTCCGAGGGG + Intronic
1162278580 19:9677395-9677417 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1162291547 19:9784668-9784690 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1163322814 19:16584513-16584535 TGACCCAGGCTGCTTCTGAGGGG - Intronic
1163400488 19:17089176-17089198 TTGGTCAGGGTGGCTCAGAGTGG - Intronic
1163885573 19:19961939-19961961 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1163986879 19:20961905-20961927 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1164614685 19:29659925-29659947 TTGCTCAGGCTGGCTTACAGTGG - Intergenic
1165112793 19:33512072-33512094 AGGCTCTGCCTGCCCCAGAGAGG + Intronic
1165169077 19:33878399-33878421 CTGATCAGTCTGCCTCAGAGAGG + Intergenic
1166157229 19:40922825-40922847 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1166659814 19:44639402-44639424 TCTCTCAGGCTGTCTCAGTGGGG - Intergenic
1167277084 19:48545252-48545274 AGGCTCAGGCAACCTCAGATGGG - Intergenic
1167814621 19:51869056-51869078 TATCTCAGGCTGTCTCAGTGGGG - Intronic
1167824613 19:51960866-51960888 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1167888208 19:52519261-52519283 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1167916107 19:52741392-52741414 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1167928877 19:52847397-52847419 TATCTCAGGCTGTCTCAGTGGGG - Intronic
1167939324 19:52933556-52933578 TATCTCAGGCTGTCTCAGTGAGG + Intronic
1167940917 19:52945198-52945220 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1167991370 19:53364148-53364170 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1168003751 19:53468956-53468978 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1168085234 19:54041011-54041033 TGTCTGAAGCTGCCTCAGACAGG + Exonic
1168358508 19:55718240-55718262 TATCTCAGGCTGTCTCAGTGGGG - Intronic
1168614830 19:57829302-57829324 TATCTCAGGCTGTCTCAGTGGGG - Intronic
925198762 2:1949377-1949399 TGGCCCAGGCTGGCTTGGAGGGG - Intronic
925210829 2:2044552-2044574 TGTCTCAGGCTGCATCTAAGAGG - Intronic
925915353 2:8600593-8600615 GGGTCCAGCCTGCCTCAGAGGGG - Intergenic
927125799 2:20011965-20011987 GTCCTCAGGCTGCCTCAGACTGG - Intronic
928385925 2:30867984-30868006 TGGCTGAGGCAGCCTCAGCCTGG + Intergenic
930191015 2:48460043-48460065 TGGCTCAGGCTACGACAGATAGG - Intronic
934123878 2:88867127-88867149 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
934502378 2:94870905-94870927 TGCCTCAGACTGCCCCCGAGGGG + Intergenic
934657821 2:96125172-96125194 TGGTTGAGGCTACCTCCGAGGGG - Intronic
935099939 2:99984445-99984467 TGGTCCAGGCTGCCACAGAAGGG - Intronic
938318577 2:130346621-130346643 TGGCCCCGCCTGCCTCTGAGTGG + Exonic
941019832 2:160396497-160396519 TGAAACAGGCTGCTTCAGAGAGG - Intronic
942909964 2:181231385-181231407 TTGTGCAGGCTGCCTCAGACAGG + Intergenic
943059534 2:183026431-183026453 TGGCTCAGGCTGCGGTACAGTGG - Intronic
944550196 2:200838541-200838563 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
945730641 2:213528627-213528649 TTGCTCAGGCTGTCAAAGAGGGG - Intronic
946097753 2:217290373-217290395 TGGCTAATGCTGCCTCAAAATGG - Intronic
947212742 2:227722828-227722850 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
947629789 2:231644715-231644737 TGGCTCAGCCTTCCTGAGACAGG - Intergenic
947796972 2:232900892-232900914 TGGCCCGCGCTGCCTGAGAGGGG - Intronic
948907406 2:240986423-240986445 TTGCTCATGCAGCCTCAGAGTGG + Intronic
1168931838 20:1630378-1630400 GGGCCCAGGCAGCCTCAGATGGG - Intronic
1169588303 20:7112225-7112247 TGGATAGGGGTGCCTCAGAGTGG + Intergenic
1169974247 20:11305669-11305691 TGGCTCAAGCTTCCTCTGGGTGG + Intergenic
1170758726 20:19230324-19230346 TGACTCAGCTTGCCTGAGAGGGG + Intronic
1171495341 20:25550961-25550983 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1172352324 20:34252745-34252767 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1172374382 20:34425347-34425369 TATCTCAGGCTGTCTCAGTGGGG - Intronic
1172447690 20:35001725-35001747 AGGCTGGGGCTGCCTCTGAGGGG + Intronic
1172624584 20:36339973-36339995 AGGCTAAGGCAGCCGCAGAGCGG + Intronic
1172716489 20:36968181-36968203 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1173178317 20:40782340-40782362 AGGCTCAGGGTGCGTCGGAGGGG + Intergenic
1173318863 20:41969829-41969851 TGGCTCAGACTGCTTCAGTGTGG - Intergenic
1175526107 20:59634833-59634855 TGGCTCATGCAACCTCAGAATGG + Intronic
1176095781 20:63343733-63343755 TGGCGCAAGCAGCCGCAGAGGGG + Intronic
1176519120 21:7811835-7811857 TGTCTCAGGCTTCCACAGAATGG - Intergenic
1176623632 21:9074259-9074281 TGCCTCAGACTGCCCCTGAGGGG - Intergenic
1176861517 21:14013809-14013831 TGGCTCTGGCTGCCTCAGCCTGG - Intergenic
1178653148 21:34441848-34441870 TGTCTCAGGCTTCCACAGAATGG - Intergenic
1178717949 21:34983980-34984002 TGCCTCAAGGTTCCTCAGAGGGG + Intronic
1178733545 21:35128715-35128737 TGGCTCAGTAGGTCTCAGAGAGG - Intronic
1179885296 21:44311680-44311702 TGGCTGAGGCTGGCTATGAGGGG + Intronic
1180971479 22:19818411-19818433 TGGTGCAGGGGGCCTCAGAGTGG - Intronic
1181184563 22:21093681-21093703 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1181535147 22:23538085-23538107 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1182263300 22:29091996-29092018 GGGCTGAGGCTGCATCACAGAGG + Intronic
1183391333 22:37546999-37547021 TGGCCCAGGCAGCCACAGGGCGG - Intergenic
1183627270 22:39012136-39012158 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1183831555 22:40420792-40420814 TGGCTCAGGGTGGCTCGGGGAGG + Intronic
1184473602 22:44709233-44709255 CTGCTCAGGCTGCTTCTGAGAGG - Intronic
1184685412 22:46094586-46094608 AGGCTCAGGCAGCCCCAGGGAGG + Intronic
949575208 3:5332139-5332161 TGGCACAGGCTAACACAGAGTGG - Intergenic
952182585 3:30933751-30933773 TGGCTCAGCAGGCCACAGAGAGG - Intergenic
952905113 3:38134825-38134847 TATCTCAGGCTGTCTCAGTGGGG - Intronic
953241570 3:41154122-41154144 TGGCTATGTCTGCCTCATAGAGG + Intergenic
953767806 3:45757356-45757378 TATCTCAGGCTGTCTCAGTGGGG + Exonic
953961170 3:47266991-47267013 TGGATCTGGCAGGCTCAGAGAGG - Exonic
956554107 3:70498720-70498742 TGGTTCAGGCTGTCTCTGGGTGG - Intergenic
956740169 3:72269527-72269549 TGGCTTAGGCTGGCCCAGGGAGG - Intergenic
957680629 3:83428578-83428600 TGCCTCAGCCTGCCTCAGCTGGG - Intergenic
959948583 3:112152629-112152651 TATCTCAGGCTGTCTCAGTGGGG + Intronic
961383172 3:126508890-126508912 TGGCTCAGGGTGCCCAAGACAGG + Intronic
962036966 3:131662248-131662270 TGTGTCAGTCTGGCTCAGAGAGG + Intronic
963130663 3:141854948-141854970 TGGCTATGGCTGCCTCCCAGTGG - Intergenic
964917868 3:161857800-161857822 TTGCTGAGGATCCCTCAGAGAGG - Intergenic
966437518 3:179905204-179905226 GGCCTCAGCCTGCCTCAGGGTGG + Intronic
967865873 3:194189286-194189308 TGACTCAGGCTGCCTGGAAGAGG - Intergenic
968142218 3:196267464-196267486 TGCCTCAGCCTGCCACAGTGTGG - Intronic
968285883 3:197508489-197508511 TGGCTCAGGCAGCCCCAGGTTGG - Intergenic
969433807 4:7172422-7172444 TGACTCTGGCTGACTCAGAAAGG + Intergenic
973162046 4:47031266-47031288 TGGCTAAGGCTGCCTGTGATTGG - Intronic
980337473 4:131495180-131495202 AGGCTCAGGTTGTCTCAGAAAGG - Intergenic
985550812 5:532701-532723 TGGCTCAGGCTGCCGGACTGGGG + Intergenic
985924673 5:3006522-3006544 TGGCGCTGGCTGCCACTGAGAGG + Intergenic
986217801 5:5737188-5737210 TGGCTCAGGCTGGCTCATCAGGG + Intergenic
987126184 5:14814995-14815017 AGGCTCAGGATTCCTCAGACTGG - Intronic
989085497 5:37672239-37672261 TATCTCAGGCTGTCTCAGTGGGG - Intronic
989411857 5:41128466-41128488 TTGCTCAGGCTCCCTAAGACAGG + Intergenic
989566464 5:42906080-42906102 TGGCTTTGGCTCCCTCAGGGTGG - Intergenic
989583795 5:43058484-43058506 TGTCTCAGGCTGTCTCAGTGGGG - Intergenic
990622794 5:57578648-57578670 TGGCCCTGCCTTCCTCAGAGAGG + Intergenic
992779087 5:80112061-80112083 TATCTCAGGCTGTCTCAGTGGGG - Intronic
993900559 5:93581551-93581573 TGGCTCCGGCTGCCACCTAGCGG - Intergenic
994091227 5:95811358-95811380 TATCTCAGGCTGTCTCAGTGGGG - Intronic
995740054 5:115346923-115346945 TGTCTCAGGCTGTCTTAGTGAGG - Intergenic
995759354 5:115546864-115546886 TGGCCCAGGCTGCAGCACAGTGG - Intergenic
997657204 5:135564197-135564219 TGGCTCCAGGTGGCTCAGAGAGG + Intergenic
997864647 5:137450362-137450384 TGGTGCAGGATGCCACAGAGTGG - Intronic
999216938 5:149943093-149943115 TATCTCAGGCTGTCTCAGTGGGG + Intronic
999419261 5:151426769-151426791 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1002009335 5:176264476-176264498 TGGCTCAGGCTGCCAATCAGAGG - Intronic
1002217390 5:177647808-177647830 TGGCTCAGGCTGCCAATCAGAGG + Intergenic
1002382438 5:178840283-178840305 TGGCTCTGGCTGCCTTTGTGGGG - Intergenic
1002382757 5:178842046-178842068 TGGCTCTGGCTGCCTTTGTGGGG + Intergenic
1002648139 5:180672393-180672415 TGGCTCTGGCTGCCTTTGGGGGG + Intergenic
1003068673 6:2926345-2926367 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1004140649 6:13014193-13014215 TGGCTCGGGCTGTCTCAGTTTGG + Intronic
1004385781 6:15171630-15171652 TTACCCAGGCTGCCTGAGAGGGG - Intergenic
1005321703 6:24662163-24662185 TATCTCAGGCTGTCTCAGTGGGG - Intronic
1005525301 6:26641837-26641859 TATCTCAGGCTGTCTCAGTGAGG - Intronic
1006922117 6:37633952-37633974 TGGCTCAGGCTGTCAGAGTGAGG - Exonic
1007167949 6:39841478-39841500 TGGCTTCGGCTGAATCAGAGAGG + Intronic
1007571483 6:42894301-42894323 TACCTCAGGCTGTCTCAGTGGGG + Intergenic
1007572505 6:42903261-42903283 TACCTCAGGCTGTCTCAGTGGGG + Intergenic
1007621128 6:43215289-43215311 TCGCTCTGGCTGCCACAGAAAGG - Exonic
1009672511 6:66774276-66774298 TGGCTCAGGATGCCTCTAGGTGG - Intergenic
1011254368 6:85405790-85405812 TGACCCAGGGTGCCTCTGAGAGG + Intergenic
1014876465 6:126667162-126667184 TAGCTCAGGCTCTCTCACAGTGG + Intergenic
1015140112 6:129921176-129921198 TCTCTCAGGCTGCATCTGAGGGG + Intergenic
1015285213 6:131479005-131479027 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1017102560 6:150861811-150861833 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1018824498 6:167398937-167398959 CTGCCCTGGCTGCCTCAGAGGGG + Intergenic
1019126740 6:169845780-169845802 TGGCTCAAGCTCACTCACAGTGG - Intergenic
1019429631 7:992700-992722 TTGCTGGGGCTCCCTCAGAGCGG + Intergenic
1019442800 7:1055936-1055958 TGGCTTTGGCTGTCACAGAGTGG - Intronic
1019555202 7:1625779-1625801 GGGCTCAGACGGCCTCAGAGGGG - Intergenic
1019895249 7:3977409-3977431 GGGCTGAGGCTGCCACACAGAGG + Intronic
1022845829 7:34209017-34209039 TGGCTCAGTCTTCCTCATTGTGG - Intergenic
1023247377 7:38219574-38219596 TAGTTCAGGATGCTTCAGAGAGG + Exonic
1023725973 7:43142911-43142933 GGTCCCAGGCTGGCTCAGAGTGG + Intronic
1023852336 7:44157444-44157466 TGGCTGGGGCTGCCTCCCAGAGG - Intronic
1026776109 7:73231957-73231979 TGGCTGGGGCTGACTCAGATGGG - Intergenic
1027016966 7:74785328-74785350 TGGCTGGGGCTGACTCAGATGGG - Intronic
1027071061 7:75160608-75160630 TGGCTGGGGCTGACTCAGATGGG + Intergenic
1027659781 7:80975178-80975200 GGCCTCAGCCAGCCTCAGAGAGG + Intergenic
1028908724 7:96183738-96183760 TGTTTCAGGCTGTCTCAGTGGGG + Intronic
1029191672 7:98776398-98776420 TGGCTCAGGCTGGAGCACAGTGG + Intergenic
1029472182 7:100761592-100761614 TGGCTCAGGCTGGAGCACAGTGG - Intronic
1030072972 7:105713459-105713481 TGGCCCAGGCTACTGCAGAGAGG + Intronic
1032165336 7:129540617-129540639 TGGATCTGGCAGCCTCAGTGGGG + Intergenic
1032205998 7:129866046-129866068 GGGCACAGGCTGCCTCAGGTGGG - Intronic
1033523012 7:142181633-142181655 TGGCTCAGGCTGTCCCTAAGAGG - Intronic
1036147400 8:6267138-6267160 TGGCTCAGGCTGGATTACAGTGG - Intergenic
1036489704 8:9213732-9213754 TGGCTAAGGCCACCTCACAGGGG + Intergenic
1038515857 8:28187218-28187240 TGGCTCGGGCTGAGTCACAGTGG - Intronic
1044747664 8:95386376-95386398 GGGGTCAGGCTGCCTCAGCGAGG - Intergenic
1048902284 8:139050473-139050495 CATCTCAGGCTGTCTCAGAGGGG - Intergenic
1049010637 8:139884770-139884792 CCACTCAGGCTGGCTCAGAGAGG + Intronic
1049283068 8:141760393-141760415 AGGCTGAGGCTGCCACAGGGTGG + Intergenic
1049517386 8:143068086-143068108 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1049632830 8:143668130-143668152 AGCCTCAGCCTGCCCCAGAGAGG + Intergenic
1049776952 8:144410577-144410599 TATCTCAGGCTGTCTCAGTGGGG - Intronic
1049980027 9:895431-895453 ATGCTCAGGCTTCCTCAGTGGGG + Intronic
1053304203 9:36972566-36972588 TGGCTCAGGCAGTCTCTTAGCGG - Intronic
1054452719 9:65412010-65412032 GGGCTCAGCGTGCCTCGGAGGGG - Intergenic
1056211356 9:84368069-84368091 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1056859455 9:90166588-90166610 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1057268595 9:93634580-93634602 TGGCTCAGGCTGGCACCAAGAGG + Intronic
1059256779 9:112938088-112938110 TGCCTGAGCCTGCCTCAGTGAGG + Intergenic
1060796800 9:126517338-126517360 TGGCTGAGGCTGCCGCACTGGGG + Intergenic
1061114928 9:128604078-128604100 TCTCTCCTGCTGCCTCAGAGAGG + Intronic
1061273050 9:129554682-129554704 TTCCGCACGCTGCCTCAGAGGGG + Intergenic
1061881294 9:133570524-133570546 GGCCTCAGGCAACCTCAGAGGGG - Intronic
1061892374 9:133629583-133629605 GGGCTATGGCAGCCTCAGAGTGG - Intergenic
1061946082 9:133908746-133908768 TAGCTGCGTCTGCCTCAGAGGGG - Intronic
1061967091 9:134021241-134021263 TGGTTCCGGCTGGTTCAGAGAGG - Intergenic
1062333122 9:136053190-136053212 GGTCTCCGGATGCCTCAGAGGGG - Intronic
1062486762 9:136780930-136780952 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1062487826 9:136789410-136789432 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1062489269 9:136796876-136796898 TATCTCAGGCTGTCTCAGTGGGG - Intronic
1062624546 9:137436845-137436867 TGCCACAGGCTGCCTGAGGGCGG - Intronic
1203563291 Un_KI270744v1:74793-74815 TGCCTCAGACTGCCCCTGAGGGG + Intergenic
1185682522 X:1900103-1900125 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1188139076 X:26526071-26526093 TATCTCAGGCTGTCTCAGTGGGG + Intergenic
1189304146 X:39974143-39974165 TGGGTCAGGAGGCCTCAGACTGG - Intergenic
1190154425 X:47976651-47976673 TACCTCATGCTGCATCAGAGAGG - Exonic
1190881708 X:54496191-54496213 TGGCTGCGGCTGCCTCTGCGAGG - Intergenic
1191633556 X:63351366-63351388 AGGCTCAGGCGGGCTCAGAGGGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1193964795 X:87972401-87972423 TATCTCAGGCTGTCTCAGTGGGG - Intergenic
1196117588 X:112014218-112014240 TGGCTCAGGCAACCTTAAAGAGG - Intronic
1197156660 X:123277572-123277594 TTACTCAGGCTTCCTGAGAGAGG - Intronic
1198684505 X:139213283-139213305 TGGCTAAGGAAGCCTCTGAGAGG - Intronic
1199612107 X:149627138-149627160 TATCTCAGGCTGTCTCAGTGGGG + Intronic
1200311684 X:155084928-155084950 TCGCTCAGGCTGGCACACAGTGG - Intronic
1201686035 Y:16703301-16703323 GGGCTCAGGCTGCCTCCTATGGG - Intergenic