ID: 1095650528

View in Genome Browser
Species Human (GRCh38)
Location 12:44603718-44603740
Sequence TTCATTTACCACTTCACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095650528_1095650531 25 Left 1095650528 12:44603718-44603740 CCTTTTGTGAAGTGGTAAATGAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1095650531 12:44603766-44603788 ATGATGCAGAAACAGAAATGAGG 0: 1
1: 0
2: 4
3: 58
4: 547
1095650528_1095650534 30 Left 1095650528 12:44603718-44603740 CCTTTTGTGAAGTGGTAAATGAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1095650534 12:44603771-44603793 GCAGAAACAGAAATGAGGGGAGG 0: 1
1: 0
2: 3
3: 45
4: 539
1095650528_1095650532 26 Left 1095650528 12:44603718-44603740 CCTTTTGTGAAGTGGTAAATGAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1095650532 12:44603767-44603789 TGATGCAGAAACAGAAATGAGGG 0: 1
1: 0
2: 6
3: 62
4: 585
1095650528_1095650533 27 Left 1095650528 12:44603718-44603740 CCTTTTGTGAAGTGGTAAATGAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1095650533 12:44603768-44603790 GATGCAGAAACAGAAATGAGGGG 0: 1
1: 0
2: 5
3: 46
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095650528 Original CRISPR TTCATTTACCACTTCACAAA AGG (reversed) Intronic
902767293 1:18625843-18625865 TTCTTTTTCCACTTGAGAAATGG + Intergenic
905616854 1:39407573-39407595 TTCATTTCTCACTTCAACAACGG - Intronic
906281647 1:44558621-44558643 TTCATTTATCATTTATCAAATGG - Intronic
908476414 1:64493129-64493151 ATGATTTCCCAGTTCACAAACGG - Intronic
909789665 1:79659872-79659894 TTCATTTACCCCAAAACAAAGGG + Intergenic
911446711 1:98003181-98003203 TTCATTGACAATTTCAGAAAAGG - Intergenic
912037550 1:105338822-105338844 TCCATGTAACACTTCATAAATGG - Intergenic
912806874 1:112763829-112763851 TTCATTTGCCTCTTCAAAAAGGG - Intergenic
913197868 1:116472984-116473006 ATCATTTACAACTTCACCATTGG + Intergenic
913563853 1:120050828-120050850 TTCTTTCAGAACTTCACAAAAGG + Intronic
913634272 1:120742735-120742757 TTCTTTCAGAACTTCACAAAAGG - Intergenic
913991151 1:143613242-143613264 TTCATTGACCAATTCATACAAGG + Intergenic
914284447 1:146210202-146210224 TTCTTTCAGAACTTCACAAAAGG + Intronic
914539502 1:148597533-148597555 TTCATTGACCAATTCATACAAGG + Intronic
914545479 1:148660943-148660965 TTCTTTCAGAACTTCACAAAAGG + Intronic
914621089 1:149409730-149409752 TTCTTTCAGAACTTCACAAAAGG - Intergenic
914697029 1:150093236-150093258 ATCATTTAACATTTCACAAAAGG + Intronic
917174453 1:172217440-172217462 TTCACTTACCGCTACACAAAAGG - Intronic
918027533 1:180766606-180766628 TTAAATTACAATTTCACAAAAGG - Intronic
918537961 1:185595368-185595390 TTCATTTACCACTTCCTCAGGGG - Intergenic
918924536 1:190764873-190764895 TTCATGTACCATTTTCCAAAAGG - Intergenic
918970762 1:191415306-191415328 TACATTTATGAATTCACAAATGG + Intergenic
921750591 1:218788648-218788670 GTCATTTATTAATTCACAAAAGG + Intergenic
1063045063 10:2383590-2383612 TTGATTTACCACTTCAGAGATGG + Intergenic
1063430186 10:5981353-5981375 TTTTTTTCCCACTTCACATATGG - Intergenic
1063607728 10:7537503-7537525 TTCAATTAACACTTTTCAAATGG - Intergenic
1064697687 10:17984456-17984478 TGCAGTTACCACTTCTAAAATGG + Intronic
1066265611 10:33773489-33773511 TTTATTTCACAATTCACAAATGG + Intergenic
1067173274 10:43924694-43924716 TTCATATTCCATTTCACACATGG - Intergenic
1067257814 10:44661393-44661415 TTCACTTCCCACTGCCCAAAAGG - Intergenic
1067712478 10:48660682-48660704 ACCATGTACCACTTCACAAGAGG + Intergenic
1068906997 10:62337705-62337727 TGCATTTACCTATTGACAAAAGG + Intergenic
1069224114 10:65920466-65920488 TTCATTCTCCACATCACAACTGG + Exonic
1071333026 10:84579890-84579912 TTCATTCACCTCTTCCCCAATGG - Intergenic
1072048294 10:91678969-91678991 TTCATTTCCCCGTTCACAGATGG - Intergenic
1075897421 10:126009085-126009107 TTCAGTTACTTCTTGACAAAGGG + Exonic
1076572880 10:131444090-131444112 TTCATTTACCCCAAAACAAAGGG + Intergenic
1077550671 11:3198778-3198800 ATCATTTCCCACTTCACAGATGG + Intergenic
1079771591 11:24467420-24467442 TTCATTTACATTGTCACAAAAGG + Intergenic
1080979848 11:37388557-37388579 TTCAATTACCACTACATACAAGG + Intergenic
1081578721 11:44336691-44336713 TTTGTTTCCAACTTCACAAATGG - Intergenic
1082949435 11:58795625-58795647 TTAATTTACCTTTTAACAAAGGG - Intergenic
1083031188 11:59594001-59594023 TTCCTTTACCTGTTCACAGAGGG + Exonic
1085566371 11:77517861-77517883 TTCCTTGCCCACTTCACAATAGG + Intronic
1085658507 11:78340037-78340059 TTTATTTACCATTTCACACCTGG - Intronic
1088189229 11:107208912-107208934 CTCATTTACCACTTCTCACTTGG - Intergenic
1088201052 11:107334973-107334995 TTCTTTTTTCACTTAACAAATGG - Intronic
1088838378 11:113599707-113599729 AACATTTACCAGATCACAAAGGG + Intergenic
1089015745 11:115163822-115163844 TTCATTTCCTACTTCCCAGAAGG + Intergenic
1089712054 11:120322556-120322578 TTCATTTACCCCAAAACAAAGGG + Intergenic
1089865307 11:121626394-121626416 TTCATTAACCACTGCACAGTTGG + Intronic
1091157531 11:133387316-133387338 TTATTTGGCCACTTCACAAAAGG + Intronic
1091529942 12:1344567-1344589 TTCATTTAACTCTTGACTAAAGG + Intronic
1092322448 12:7491629-7491651 TTTATTTATCACTAAACAAAAGG - Intronic
1093519073 12:20027044-20027066 TCCATTAATCACTTCCCAAAAGG - Intergenic
1095325021 12:40879283-40879305 TTTATTTACTACTTCTCCAAAGG + Intronic
1095650528 12:44603718-44603740 TTCATTTACCACTTCACAAAAGG - Intronic
1095937590 12:47702921-47702943 ATCTTTTACCACTTCATAAGTGG + Intronic
1097692958 12:62750992-62751014 TTGATTTGGCACTTAACAAATGG - Intronic
1098196004 12:68003212-68003234 TTCATTTTCCTCTTTAGAAATGG + Intergenic
1099530247 12:83770886-83770908 GACATTTACCATATCACAAAGGG - Intergenic
1100067689 12:90669853-90669875 TTCATTTATAGCTGCACAAAAGG + Intergenic
1100599491 12:96100671-96100693 TTGTTTTCCCACTTCACAGATGG + Intergenic
1100847231 12:98672463-98672485 CTCATTTACATCTTCACAGAAGG - Intronic
1101153498 12:101906263-101906285 TTCATTCACCACATAAGAAAGGG - Intronic
1103994698 12:124821538-124821560 TTCATTCAGCACTGCCCAAAGGG + Intronic
1104109594 12:125692194-125692216 TTCCTTTACAACTTAAGAAAAGG - Intergenic
1105752211 13:23431862-23431884 TTCATGCACCATTTCCCAAAAGG - Intronic
1106071041 13:26411172-26411194 TTCATTTAGCTCTGCTCAAATGG + Intergenic
1106273150 13:28174138-28174160 TTTATTTACCAGTTCATAACAGG - Intronic
1106812348 13:33371701-33371723 TTTATTTCTCACTTTACAAATGG - Intergenic
1107483141 13:40801904-40801926 TTCATTGACCAGTGCACAGAAGG - Intronic
1109427438 13:62183854-62183876 GTAACTTACCACTTCCCAAATGG - Intergenic
1109444635 13:62418605-62418627 TTCACCTTACACTTCACAAAAGG - Intergenic
1109608986 13:64738740-64738762 TTTATTTAAGACTTTACAAAAGG + Intergenic
1110167077 13:72455791-72455813 CTTATTTACCTCTTCAAAAATGG + Intergenic
1110381530 13:74856716-74856738 ACCATTTACCACTTCCCAAATGG + Intergenic
1111081622 13:83318228-83318250 TTGATTTAACCCTTGACAAAAGG - Intergenic
1112829618 13:103432995-103433017 TTCATATACAACTAAACAAAAGG - Intergenic
1113866214 13:113527099-113527121 GTCATGTGCCACTTCACAATGGG - Intronic
1114717889 14:24846915-24846937 TTTATTTACCCCTTCACTAAAGG + Intronic
1115170588 14:30501189-30501211 TTCATATACCATTTTTCAAAAGG + Intergenic
1115297947 14:31851342-31851364 TTTATTTTCCAATTCACAGAAGG - Intronic
1115865875 14:37746128-37746150 TCCATTTACCACTACAGATATGG - Intronic
1116993686 14:51301367-51301389 TTCATTCACCACTTTCCAAATGG + Intergenic
1117667683 14:58074282-58074304 TTCATCTACCATTTGACAAGTGG + Intronic
1118161983 14:63299739-63299761 TTATTTTACCACTACAGAAAAGG - Intergenic
1119055431 14:71414480-71414502 TTCCTTTTCCACTTCAAAAAGGG - Intronic
1119936704 14:78598634-78598656 TCCAATTATCACTTCCCAAAGGG + Intronic
1120010686 14:79410646-79410668 TTTAGTTTCCACTTCACAAATGG - Intronic
1120791156 14:88583875-88583897 TTGACTTACCACTTGAGAAAGGG + Intronic
1121547906 14:94775779-94775801 TTCCTTCAAAACTTCACAAAAGG - Intergenic
1121968218 14:98330270-98330292 ATCATTTTCCACTTCAGGAATGG + Intergenic
1125388614 15:39167100-39167122 TTCTTTTATCATTTCACAATCGG + Intergenic
1127242104 15:57127604-57127626 TTCACTCAACATTTCACAAATGG - Intronic
1129088440 15:73122617-73122639 TTCTGTTCCCACCTCACAAATGG - Exonic
1129858598 15:78842709-78842731 TGCATTTCTCACTTCACACATGG - Intronic
1130293886 15:82629197-82629219 TCCTTTTTCCATTTCACAAATGG - Intronic
1131778747 15:95831127-95831149 ATCATTAACTACTTCACACAAGG - Intergenic
1132820108 16:1862173-1862195 TTCATGTAACACTTATCAAAAGG - Intronic
1134379483 16:13710769-13710791 GTAATTTACCACTTCCCTAAGGG + Intergenic
1135110304 16:19685785-19685807 TTCAATGTTCACTTCACAAAAGG - Intronic
1135508269 16:23058552-23058574 TTCATTTACTACAGGACAAATGG + Intergenic
1136739597 16:32504709-32504731 TTCATTTAGCACTTTGGAAACGG - Intergenic
1137649352 16:50106193-50106215 CTCATTTACTTCTTCACAAAAGG - Exonic
1137923313 16:52514045-52514067 GTCATTGACCACTGCAGAAAAGG + Intronic
1138236167 16:55384728-55384750 TTTATTTGCCAAATCACAAAAGG + Intergenic
1139021011 16:62749394-62749416 TCCAGTTAGCACTTCAGAAAAGG + Intergenic
1141645025 16:85362806-85362828 ATCAATAACCACTTCAGAAACGG - Intergenic
1203013316 16_KI270728v1_random:322628-322650 TTCATTTAGCACTTTGGAAACGG + Intergenic
1203031651 16_KI270728v1_random:595787-595809 TTCATTTAGCACTTTGGAAACGG + Intergenic
1203040070 16_KI270728v1_random:738644-738666 TTCATTTAGCACTTTGGAAACGG - Intergenic
1142677041 17:1520186-1520208 TTAAATCACCACATCACAAAAGG + Exonic
1145270605 17:21402775-21402797 TGCATTTATTTCTTCACAAAGGG - Intronic
1145308810 17:21690165-21690187 TGCATTTATTTCTTCACAAAGGG - Intergenic
1148287394 17:46406707-46406729 TTCATTCACAACTGCACAATTGG - Intergenic
1148309564 17:46624287-46624309 TTCATTCACAACTGCACAATTGG - Exonic
1149123060 17:53193437-53193459 CTCATTTACCATTCCAGAAATGG + Intergenic
1149132905 17:53328441-53328463 TTGATTTTCATCTTCACAAATGG + Intergenic
1149233207 17:54560338-54560360 TTCATTTATGTTTTCACAAATGG - Intergenic
1150911257 17:69390016-69390038 TTCAGTTATAACTTCACAGATGG - Intergenic
1153181698 18:2442320-2442342 TTCATTTCCCATTTTACAGAGGG - Intergenic
1153312627 18:3691963-3691985 TTCATTTAATACTTCATATAAGG + Intronic
1153324352 18:3803007-3803029 AACATTTACCACTTTACCAATGG - Intronic
1153468725 18:5418251-5418273 GTCTTTTCCCACATCACAAATGG + Intronic
1153545914 18:6204465-6204487 TGCATATACCACCTGACAAAGGG + Intronic
1156710175 18:39934606-39934628 TTCATTTAGCATTTACCAAATGG + Intergenic
1158272173 18:55728374-55728396 TTCATAAAGCACTTAACAAATGG + Intergenic
1159189217 18:65019652-65019674 TTCATTCACATTTTCACAAATGG + Intergenic
1159989963 18:74893427-74893449 TTCTTTTACTACTGAACAAAAGG + Intronic
1162699702 19:12504780-12504802 TTCATTTTCCAATTCACAGTGGG + Intronic
926575835 2:14579928-14579950 CTAATTTACCACCTCACAATGGG + Intergenic
928911165 2:36422767-36422789 TTCATTTAATACTTCGGAAATGG + Intronic
929244165 2:39684096-39684118 TTCATTTAACATGACACAAAAGG - Intronic
929320154 2:40533305-40533327 CTCATTTACCATGACACAAAAGG - Intronic
929729565 2:44473104-44473126 TTCAGCTACCATTTCACCAATGG - Intronic
930316107 2:49798842-49798864 TTGAGCTACCACTTCAGAAAAGG - Intergenic
930551738 2:52843414-52843436 TTCATTTACATTTTCACCAATGG + Intergenic
930965318 2:57316746-57316768 TTAACTTAACACTTGACAAATGG - Intergenic
932066061 2:68562080-68562102 TTCATCTACCTTATCACAAACGG - Intronic
932330998 2:70898231-70898253 TTAATTTTTCATTTCACAAATGG - Intergenic
932694231 2:73940920-73940942 ATCATGTACCACTTAACAACAGG - Intronic
933451635 2:82460431-82460453 TTTCTTTAACACCTCACAAAAGG - Intergenic
935400441 2:102654658-102654680 GTCATTTATCACTTAACAAAGGG + Intronic
936865852 2:117075975-117075997 TTCATTTAGTACTTCATTAATGG + Intergenic
937424165 2:121784364-121784386 TTCATTTTCCACTGCAGAACTGG + Intergenic
937512862 2:122617309-122617331 TTCATTTAACATTTCACATAGGG + Intergenic
937705230 2:124912679-124912701 TTCTTTTTCCACTTGTCAAATGG - Intronic
938051162 2:128173261-128173283 TTCATTTATCCTTTCACGAATGG + Intronic
938214544 2:129499896-129499918 TTCATGTACCATTTCATGAAGGG - Intergenic
939325807 2:140686678-140686700 CTAATTTACCTCATCACAAATGG - Intronic
940519369 2:154723634-154723656 TTCATTTATCCTCTCACAAAAGG - Intronic
940917489 2:159273017-159273039 GACATTTAACACTTCAAAAAAGG - Intronic
941690334 2:168494825-168494847 TTCATTTAACCCAACACAAAGGG + Intronic
942539189 2:176997642-176997664 TTCATTTAGCACAAGACAAAAGG + Intergenic
942583057 2:177442465-177442487 TTCTTTGGACACTTCACAAATGG + Exonic
1169733435 20:8811356-8811378 TTCATTAATCTCTTCTCAAATGG - Intronic
1169888659 20:10430281-10430303 TTCACTTACCACTTTACAACTGG + Intronic
1170317093 20:15054717-15054739 GTCATTTACCACATTACAGAGGG + Intronic
1172257479 20:33531806-33531828 GTCATTAACCAGTTAACAAATGG - Intronic
1177621678 21:23603369-23603391 TTCATTTAACACTTCTGAGATGG + Intergenic
1178693175 21:34766926-34766948 AACATTTACCACTTGCCAAAGGG + Intergenic
1181446637 22:22981365-22981387 TCCAGTTCTCACTTCACAAATGG - Intergenic
1181654944 22:24288970-24288992 TTCATTTTGCACTTCATTAATGG - Intronic
1181695400 22:24590456-24590478 TTCACTTACCACTTCCCTGAGGG - Intronic
949261793 3:2110622-2110644 TTATTTTTCCAGTTCACAAATGG - Intronic
949332601 3:2938781-2938803 TTAATTTACCTCTTCTCCAAAGG - Intronic
951008189 3:17644150-17644172 TTCACTTACTCTTTCACAAAAGG + Intronic
955423865 3:58767488-58767510 TTCATCTCCCACTTCAAGAAGGG + Intronic
955597956 3:60612150-60612172 CTCTTTGACCACTTCACTAAAGG - Intronic
955837716 3:63075880-63075902 TTCATTTACCACCTCTCATTGGG + Intergenic
956177692 3:66488844-66488866 ATCATTTACAACTTCACTTATGG + Intronic
956627997 3:71285936-71285958 GTCATGTATCACTTCACAATAGG + Intronic
957888841 3:86328187-86328209 CTTATATACCACATCACAAATGG - Intergenic
958610787 3:96423504-96423526 TTCAGTTACAACATCCCAAAGGG + Intergenic
959293246 3:104501693-104501715 TTCATTTACAGCAACACAAATGG - Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
963497041 3:146077912-146077934 TTCATTTTAGACTTTACAAAGGG - Exonic
964433941 3:156632964-156632986 TTCATTTACAGCAACACAAATGG + Intergenic
965828526 3:172754973-172754995 TTCCTTTACCACTTTATAAATGG + Intronic
967597848 3:191348867-191348889 TTCATTTACTACAGAACAAAGGG - Intronic
970897102 4:21117083-21117105 TCCATTAACCATTTCACAAACGG + Intronic
971922167 4:32955183-32955205 TTCATTTACAAAATCAGAAATGG - Intergenic
971999667 4:34014639-34014661 TTCTTTCACCACTGCATAAAAGG - Intergenic
972431514 4:38987413-38987435 GTTATTAACCACTGCACAAAGGG + Intronic
972549733 4:40119501-40119523 TTCATTTACAAAGTCACAAAGGG - Intronic
972931586 4:44078044-44078066 ATCATCTACCTCTTCCCAAAGGG + Intergenic
976320518 4:83709312-83709334 TTCATTTTCCACAGCAAAAAGGG - Intergenic
976550652 4:86391514-86391536 TTCATTTTCCACTCCACACTTGG - Intronic
977670587 4:99690940-99690962 TTTATTTACCCCTTCACATTTGG + Intergenic
978300279 4:107261140-107261162 CTTATTCACCACTTCTCAAATGG - Intronic
978541858 4:109825385-109825407 TTCATTTTTCACTTCTCAAAAGG + Intergenic
979371514 4:119894007-119894029 TTCATTTACCATTTCACATATGG + Intergenic
979406752 4:120321646-120321668 TTTATTTTTCACTTCACAATGGG - Intergenic
980386738 4:132095016-132095038 TTCATTAACAACAACACAAATGG + Intergenic
980474858 4:133300149-133300171 TTTTTTTACCATTTCAGAAAAGG - Intergenic
980589087 4:134860234-134860256 TTCATTTAGCAATTGACAGATGG + Intergenic
981927186 4:150153060-150153082 CTCATTTACTCCTTCACTAATGG - Intronic
982044720 4:151432641-151432663 TACATTGATCACTGCACAAATGG - Intronic
982420416 4:155189287-155189309 ATCTTTTACCATTTCACCAAAGG + Intergenic
983280288 4:165672378-165672400 TTCAGTTTACACTTCAAAAAAGG + Intergenic
983748656 4:171234712-171234734 TACATTTACCACTTGAGAACTGG - Intergenic
983751521 4:171278920-171278942 TTTATTTAGCATTTCAGAAAAGG + Intergenic
983827556 4:172282575-172282597 TTTATTTACCACATCCTAAAAGG - Intronic
984432715 4:179668631-179668653 GTCATTTACCACTTCCCACACGG - Intergenic
985363128 4:189196875-189196897 TTCTTTTTCCAGTTCTCAAAGGG + Intergenic
987788024 5:22527165-22527187 TTCTTTTACCCTTTCCCAAAGGG - Intronic
989764714 5:45068316-45068338 TTCACTAACAACTTCACAAATGG + Intergenic
990178491 5:53133862-53133884 GCCATTTATCACTTCAAAAATGG + Intergenic
990190189 5:53250886-53250908 TTCATTTGTCCCTTCACAAAGGG + Intergenic
990675506 5:58180096-58180118 TTCATCTACCAAGTCACATATGG - Intergenic
990774675 5:59292736-59292758 TTCATTTTCCAGGTCTCAAATGG + Intronic
990890315 5:60641644-60641666 TTGATTTGCCAGTTCAGAAATGG + Intronic
991075867 5:62537234-62537256 TTCCTTTAAAAGTTCACAAAAGG - Exonic
991572322 5:68068211-68068233 TTTTTTTACCACTTCTCAAATGG - Intergenic
993485390 5:88478001-88478023 TACATTTACCAATTCTCCAAAGG - Intergenic
994071187 5:95604476-95604498 TTCCTTTCCCCCTACACAAACGG + Exonic
994113284 5:96032747-96032769 TTTATATACCACTTCTCTAAAGG + Intergenic
994585265 5:101700312-101700334 GTCATATGCCACTTCACAATGGG - Intergenic
994588999 5:101750362-101750384 TACTTTTACCAATTAACAAATGG + Intergenic
994927186 5:106131882-106131904 TTAATTTTCCACCTCACAAAAGG + Intergenic
994990308 5:106988295-106988317 TTCATTTTCCACTTCAGATAGGG + Intergenic
995432595 5:112098086-112098108 TTGATTCACCAATTCAAAAATGG - Intergenic
995948698 5:117682992-117683014 TTCATTTCCGACTTCCCATATGG - Intergenic
996418453 5:123235758-123235780 TTCATCTCCCACTTCATAAGGGG - Intergenic
997610388 5:135211885-135211907 TTCATTTCCTCCTCCACAAAGGG - Intronic
997890622 5:137673173-137673195 TTCATTTAACACAAAACAAAGGG - Intronic
998031421 5:138872821-138872843 TTCATTTAACACTTAAAATATGG + Exonic
998497995 5:142607466-142607488 TTCATTTTCCCCTTCTGAAATGG + Intronic
998548994 5:143058438-143058460 TTCCTTGACCCTTTCACAAATGG + Intronic
998959333 5:147467992-147468014 TTGATTAATCACTTCCCAAAAGG + Intronic
1000695378 5:164374704-164374726 TTCATTTGCTAGTTTACAAATGG - Intergenic
1000995381 5:167953171-167953193 TTCATTTATTACTTCAAGAAAGG - Intronic
1002326678 5:178414439-178414461 CCCATTTACCACTTCTCCAAAGG + Intronic
1002430528 5:179201076-179201098 TTAAATTACCACTGCTCAAAAGG + Intronic
1002859656 6:1069778-1069800 TGCATTTCCCATTTCTCAAAGGG + Intergenic
1004906647 6:20242749-20242771 CTTATTTACCACATCACACAGGG + Intergenic
1005099276 6:22152590-22152612 TGCTTTTATGACTTCACAAAAGG - Intergenic
1006602318 6:35234155-35234177 TTCATTTCCCCCTTCTCCAAGGG - Intronic
1007804153 6:44425654-44425676 TACATTTACTCCTTCAGAAATGG + Intronic
1007988839 6:46234049-46234071 TGCATTTACCACTTTAGAAGTGG + Intronic
1008011207 6:46469571-46469593 TTAAGTTACCAGTTCTCAAAAGG - Intronic
1009715455 6:67387434-67387456 TTCATTTATGTTTTCACAAAAGG + Intergenic
1009738836 6:67717140-67717162 TTAAGATACTACTTCACAAATGG - Intergenic
1010153871 6:72768900-72768922 TTCACTGCCCACTTCACAATTGG + Intronic
1010400896 6:75444540-75444562 TTGATTTACAACATCAAAAAAGG + Intronic
1010697894 6:79000491-79000513 TCCATTTACCAATTTATAAAGGG - Intronic
1010926215 6:81749932-81749954 CTCATTTACCACTCCATGAAGGG + Exonic
1012989075 6:105906674-105906696 TTTATTTCACACTTTACAAATGG + Intergenic
1013586137 6:111580884-111580906 TTCATTTACCTCTTCTTAAGAGG - Intronic
1014106953 6:117575862-117575884 TTTATTTACGTCCTCACAAAAGG - Intronic
1014792979 6:125695672-125695694 TTCATTTATGTTTTCACAAATGG - Intergenic
1015081701 6:129233841-129233863 TTCCTTTTCCCCTTCACTAAGGG + Intronic
1016061811 6:139638342-139638364 TTCATTTTCCCCTGCACAGAAGG - Intergenic
1016301575 6:142637460-142637482 TTCATTTACCACTTAAGCAGAGG + Intergenic
1016688754 6:146911479-146911501 TACATTCACCACCACACAAATGG + Intergenic
1016860437 6:148713018-148713040 TTCCTTGAGCACTTCGCAAAAGG - Intergenic
1018284224 6:162219651-162219673 TTCCTTCTCCATTTCACAAATGG + Intronic
1021587623 7:22226573-22226595 TTCATTTCCCAATTCTCAAGGGG - Intronic
1022426468 7:30273260-30273282 TTCATTTTCCACTACACTAACGG + Intergenic
1023696147 7:42849495-42849517 TTCATTTATATCGTCACAAATGG - Intergenic
1028039842 7:86037914-86037936 ATCATTTATCACTTCCGAAATGG - Intergenic
1028517345 7:91692693-91692715 ATCATTTATCACTTTAGAAAGGG - Intronic
1028840181 7:95421090-95421112 GGCATTTAACACTTCACAAGAGG + Intronic
1029886699 7:103880262-103880284 TTCATTTAGAACTTGAAAAAAGG + Intronic
1030864838 7:114688062-114688084 CTCATTTTTTACTTCACAAATGG - Intronic
1031106040 7:117544348-117544370 TTCCTTTACCATTTCCCTAAAGG + Intronic
1031399485 7:121314523-121314545 CTAATTTACCACTTCTCAACTGG - Intergenic
1031766859 7:125789619-125789641 TTCATTTAACACTTTATTAATGG - Intergenic
1033736608 7:144228758-144228780 TTCATTCATTGCTTCACAAAGGG - Intergenic
1033746448 7:144322192-144322214 TTCATTCATTGCTTCACAAAGGG + Intergenic
1034069584 7:148170707-148170729 CTCATTTGCCACTTCACTGATGG + Intronic
1034088567 7:148343009-148343031 TTCAATTAATACTCCACAAAGGG + Intronic
1036413875 8:8528814-8528836 TTCTTTTACTTCTTCCCAAAAGG + Intergenic
1037129746 8:15393417-15393439 TCCATTTCCCAGTTCACAATGGG + Intergenic
1037521877 8:19688080-19688102 TTCATTTCCCATTTTACACATGG + Intronic
1039579698 8:38654266-38654288 TTCATTTTCCAGTTCACCAGAGG - Intergenic
1041846006 8:62329958-62329980 TTGATTTACCACTAAACCAAGGG + Intronic
1044546280 8:93463884-93463906 TTGGTTTACAACTTTACAAATGG + Intergenic
1047001496 8:120577787-120577809 TACATATACCACTTGACACATGG - Intronic
1047162860 8:122400550-122400572 CTCATCTACTACTTCAAAAAAGG + Intergenic
1051116767 9:13704112-13704134 TTCAGTTACCACTTTAGCAAGGG - Intergenic
1051310817 9:15769371-15769393 TTCATAGACCTCTTCTCAAAAGG + Intronic
1054154469 9:61630433-61630455 TTGATTACCCACTTCACAACAGG - Intergenic
1054474243 9:65561553-65561575 GTGATTACCCACTTCACAAAAGG - Intergenic
1055001009 9:71448354-71448376 TTCATGTAACACTACACACAGGG - Intergenic
1055822929 9:80289559-80289581 TTCCTTAAAAACTTCACAAACGG - Intergenic
1058347490 9:103981139-103981161 TTCATGTCCTACTTCACAGATGG - Intergenic
1058389167 9:104475246-104475268 TTCCTATACCACTTCAGGAATGG + Intergenic
1058639257 9:107067165-107067187 TTCCTTTACCAATTCTCCAAAGG - Intergenic
1058768581 9:108207881-108207903 TTTGTTTACCATCTCACAAAAGG + Intergenic
1059091486 9:111363926-111363948 TTCATCTCCCACTTCTAAAATGG - Intronic
1059533124 9:115056287-115056309 TTCATTTACCTCTCCAGAGAAGG + Intronic
1059781993 9:117539429-117539451 TTCATTTACAACTTCTCTATTGG + Intergenic
1061296734 9:129680856-129680878 TTTATTTTCCACAGCACAAATGG + Intronic
1186562043 X:10622853-10622875 TTCATTTACAAATAAACAAATGG + Intronic
1186707556 X:12157752-12157774 TACATTAACCAGTACACAAATGG + Intronic
1187089070 X:16075054-16075076 TTCATTTACTACTTTACAAGGGG + Intergenic
1187870371 X:23760139-23760161 TTGATTTGTCACTTCACTAAAGG + Intronic
1188459007 X:30401187-30401209 TTGAATTATTACTTCACAAAAGG - Intergenic
1189684333 X:43548378-43548400 TTTTTTTACCACTAGACAAATGG - Intergenic
1194593329 X:95828125-95828147 TTAATCTCCCACTTCCCAAATGG - Intergenic
1194647052 X:96470787-96470809 ATCAATTTCCACTTCAGAAAGGG - Intergenic
1194697104 X:97066572-97066594 TTAAGTTACCACTTCAAACAAGG + Intronic
1195030806 X:100926101-100926123 TTCATTTATCATCTCACACAAGG + Intronic
1195404795 X:104501202-104501224 TTCGTTTACCACTTCACTTCTGG - Intergenic
1195667528 X:107444303-107444325 TTCATTCAGCACTTCTCAAATGG + Intergenic
1196076706 X:111585810-111585832 TTCATTTACAGCAACACAAAAGG + Intergenic
1197174913 X:123475308-123475330 TTCATTTCCCATTTCTCAGAAGG + Intronic
1198252737 X:134896704-134896726 ATCATCTACCACTTCAAACATGG - Intronic
1200947064 Y:8853278-8853300 TACATGTAGCACCTCACAAAGGG - Intergenic