ID: 1095650581

View in Genome Browser
Species Human (GRCh38)
Location 12:44604189-44604211
Sequence AAGAAGAAAGAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14831
Summary {0: 2, 1: 26, 2: 289, 3: 2356, 4: 12158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095650575_1095650581 22 Left 1095650575 12:44604144-44604166 CCTGGGACGAAGCATGGCATAAG 0: 1
1: 0
2: 1
3: 5
4: 69
Right 1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG 0: 2
1: 26
2: 289
3: 2356
4: 12158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095650581 Original CRISPR AAGAAGAAAGAGAAGGAGGG AGG Intronic
Too many off-targets to display for this crispr