ID: 1095651924

View in Genome Browser
Species Human (GRCh38)
Location 12:44621140-44621162
Sequence TAGCACATGTGGCAGCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095651924 Original CRISPR TAGCACATGTGGCAGCAAGG AGG (reversed) Intronic
901002335 1:6154972-6154994 TCGCACATGTGGCAGAGGGGTGG - Intronic
904420851 1:30390268-30390290 TAACACATGTGGCAGGGAGAGGG + Intergenic
908724617 1:67162329-67162351 TGGCACATGTGGCACCATGGTGG + Intronic
912864662 1:113246578-113246600 CAGGACCTGTGACAGCAAGGGGG - Intergenic
913037614 1:114987179-114987201 TAGCACATGTTTAAGCAAAGAGG + Intronic
913082108 1:115398240-115398262 AAGCACTTGTGGCAGGAGGGTGG + Intergenic
915932935 1:160070930-160070952 TAGCAGATGTGGGAGGAAAGAGG + Intergenic
918871454 1:189980159-189980181 TAGCAAATGTAGCAGTAAGAGGG - Intergenic
919253452 1:195091085-195091107 TGGCAAATGTGGGAGCATGGAGG - Intergenic
919979569 1:202633977-202633999 TCTCACATGTGGGAGCAAGGTGG + Intronic
922673851 1:227538247-227538269 AAGCAGAGGTGGCAGGAAGGAGG + Intergenic
924646081 1:245878349-245878371 CAACAGATGGGGCAGCAAGGGGG + Intronic
924770470 1:247075506-247075528 TCCCACATGTGGCAGGAACGTGG + Intronic
1068200810 10:53781904-53781926 TCTCACTTATGGCAGCAAGGTGG - Intergenic
1068722633 10:60263156-60263178 TAACACATTTGGAAGCAAAGAGG + Intronic
1068753990 10:60630194-60630216 TAGCACATTTTGCAGCAAATTGG - Intronic
1070379678 10:75869359-75869381 TATCACATATGGCAGCAATATGG - Intronic
1072037053 10:91572967-91572989 TAGCACTTTGGGAAGCAAGGTGG + Intergenic
1072167077 10:92824159-92824181 TAGCACATGGCCCAGCAAGGTGG + Intergenic
1081743250 11:45455544-45455566 TGGCAAATGTGGCAGCCATGAGG - Intergenic
1087652810 11:100887979-100888001 GAACCCATCTGGCAGCAAGGAGG + Intronic
1090240473 11:125177888-125177910 CAGCATAGGTGGCATCAAGGAGG + Intronic
1091357640 11:134949896-134949918 TGGGACACGTGGAAGCAAGGGGG + Intergenic
1093827236 12:23708666-23708688 TTGAACATGTGGCAGGAAAGTGG + Intronic
1094326192 12:29241981-29242003 TGGCAAATGTGGGAGCAATGTGG + Intronic
1095512645 12:42969812-42969834 TAGAGTATGTGGCAGCATGGTGG - Intergenic
1095651924 12:44621140-44621162 TAGCACATGTGGCAGCAAGGAGG - Intronic
1096006077 12:48173214-48173236 TAGCAAATGTGCCAGAAAGTGGG + Intronic
1098010754 12:66048688-66048710 TAGCACATGGGGGTGCACGGAGG + Intergenic
1100690510 12:97034280-97034302 AAGCAAATGTGGCATTAAGGAGG + Intergenic
1105775145 13:23653080-23653102 TAGCACAGGGGGCAGGAAGCTGG - Intronic
1107301166 13:38967145-38967167 AAACACATGTGGCAACATGGGGG - Intronic
1112653869 13:101428041-101428063 TAGTTCATGTGGCAGCAAGGAGG - Intergenic
1113600405 13:111564285-111564307 TAGCAAATTTGGCAGAAAGCTGG + Intergenic
1113830979 13:113295905-113295927 AAGCACAAGTGACAGCAAGGTGG + Intergenic
1119007412 14:70944228-70944250 AAGCCCATGTGCCAGCCAGGAGG + Intronic
1119424901 14:74528785-74528807 CGGCAATTGTGGCAGCAAGGAGG + Intronic
1122070092 14:99200582-99200604 TTGCCCATGAGGCAGCGAGGCGG + Intronic
1124219223 15:27834945-27834967 TAGGACATTCAGCAGCAAGGAGG + Intronic
1124495179 15:30181987-30182009 TCTCACATGTGGGAGCAAGTTGG + Intergenic
1126236369 15:46390104-46390126 TAGCACCTGTGACAGTAATGGGG - Intergenic
1126328966 15:47511513-47511535 TAACACATGTGGCAGGAGGGGGG - Intronic
1126340703 15:47637828-47637850 TGGAACATGTGGCACCAATGAGG - Intronic
1127139934 15:55964947-55964969 TAGCAAGAGTGGAAGCAAGGGGG - Intronic
1127609007 15:60618891-60618913 TTGGGCATGTGTCAGCAAGGAGG - Intronic
1130229800 15:82087894-82087916 TATCACATATTGCAGCCAGGAGG - Intergenic
1130520458 15:84657561-84657583 TGGCACAGCTGGCAGGAAGGTGG + Intronic
1132788153 16:1669683-1669705 TAGCAAGTGTGGCAGGAAGGGGG + Intronic
1137044534 16:35643195-35643217 TGGCAGTGGTGGCAGCAAGGAGG - Intergenic
1137365561 16:47856445-47856467 TATCAAATGTGGCAGCATTGAGG - Intergenic
1140199005 16:72879396-72879418 AAGCACAGTGGGCAGCAAGGAGG + Intronic
1141081710 16:81058823-81058845 TATCACATAAGGCAGGAAGGAGG - Intronic
1141829358 16:86501093-86501115 GAGCAGATGGGGCAGCGAGGTGG + Intergenic
1142613358 17:1121286-1121308 CACCCCATGTGGCAGAAAGGAGG + Intronic
1142860445 17:2757641-2757663 TAGTCCTTGTGGCAGCAAGGTGG - Intergenic
1143319344 17:6057931-6057953 TAGCACCTGGGTCAGCCAGGAGG - Intronic
1143386940 17:6536565-6536587 TAGGACATGTGGCTGGGAGGTGG - Intronic
1146413383 17:32609283-32609305 TAGCACCTGTGGTAGCCAGGAGG - Intronic
1147947969 17:44091310-44091332 CAGCACATGCTGCAGCAGGGAGG + Exonic
1154519403 18:15211208-15211230 AAGCACATGTGCCAAAAAGGAGG + Intergenic
1155398699 18:25415358-25415380 CAGCACCTGTGGAAGGAAGGAGG - Intergenic
1155859170 18:30874958-30874980 TAGAACATCCTGCAGCAAGGAGG + Intergenic
1156856884 18:41792367-41792389 TAGCACATGGAGCAGGAAGTGGG - Intergenic
1156923020 18:42545825-42545847 TAGCTCATGGGCCAGCAATGAGG - Intergenic
1157201619 18:45664442-45664464 GAGAACATGTGGCAGCAAACAGG + Intronic
1157995973 18:52556502-52556524 TAGAACATCCTGCAGCAAGGAGG + Intronic
1158932750 18:62336993-62337015 AAGCACATCTGGAATCAAGGTGG + Intronic
1159489456 18:69111994-69112016 GGCCACATGTGGCAGCAAGGTGG + Intergenic
1165494396 19:36143095-36143117 TGACACATGTCGCAGCATGGTGG + Exonic
1165772231 19:38386415-38386437 TGGCACCTGAGGCAGCAAAGAGG + Exonic
1166040388 19:40198721-40198743 TAGCACAAATGGCAACTAGGGGG + Intronic
1168472381 19:56650008-56650030 GAGCCCATGTGGAAGGAAGGTGG + Intronic
926137144 2:10344336-10344358 CAGGCCATGTGCCAGCAAGGGGG + Intronic
927701215 2:25270085-25270107 TAGGAAATGTGGCTGGAAGGTGG - Intronic
928257618 2:29737833-29737855 TAACACATGTGCCTGCATGGAGG + Intronic
929029352 2:37636214-37636236 CAGCACCTGTGGCAGGTAGGTGG + Intergenic
932092083 2:68815215-68815237 TGGCAGAGGTGGCAGCTAGGAGG + Intronic
932860895 2:75290270-75290292 TTCCACATGTGGCAGCAAGGGGG - Intergenic
932963755 2:76445697-76445719 TAGAACATTTGGCTGCAAAGTGG + Intergenic
934857579 2:97738779-97738801 TAACACATGTCGCAGGAGGGTGG - Intronic
935684530 2:105671775-105671797 CAGCATATGAGGCAGCAAGGAGG + Intergenic
939956820 2:148534293-148534315 TATCACATTTGGGATCAAGGAGG - Intergenic
940153492 2:150628731-150628753 TAGAACTTGTCTCAGCAAGGAGG + Intergenic
944884120 2:204045257-204045279 TAGCAGGGGTGGGAGCAAGGAGG + Intergenic
945331264 2:208541815-208541837 TAGCGCGTGTGGCAGCAAGCTGG - Intronic
947870825 2:233436990-233437012 TAGCACATCTGGCTGCCAGGAGG + Intronic
948111725 2:235461691-235461713 CAGCATAGGTGGCAGCAGGGTGG - Intergenic
1172624699 20:36340441-36340463 TGGCACATGTGGCAGGGAGTGGG + Intronic
1173144308 20:40511521-40511543 CAGCACATGTGGGGGCAAGATGG - Intergenic
1174932334 20:54829485-54829507 TAGCATTTGTGGCAGCACTGAGG + Intergenic
1175341488 20:58233550-58233572 TAACTCCTGTGGCAGCAGGGTGG + Intergenic
1177887475 21:26763504-26763526 TACCAAATGTAGCAGCAATGAGG + Intergenic
1178307702 21:31504181-31504203 TAACACATATGCCAGCAAGCAGG - Intronic
1178523714 21:33306908-33306930 TAGCATCTGTGGGAGCCAGGAGG + Intergenic
1183368343 22:37418818-37418840 GAGCCCATGTGGCGGGAAGGTGG - Intronic
1184858780 22:47161359-47161381 AAGCAGAGGTGGCAGCCAGGCGG - Intronic
1185078193 22:48694585-48694607 CAGCACATGGGGCAGGGAGGAGG - Intronic
950399441 3:12759279-12759301 CTGCACCTGTGACAGCAAGGAGG + Exonic
950505258 3:13390716-13390738 AAGCTCATGTGGCTGCCAGGAGG + Intronic
951160981 3:19421952-19421974 AAACACAAGTGGCAGCAAAGAGG - Intronic
954421256 3:50420203-50420225 GAGCTGATGGGGCAGCAAGGGGG + Intronic
959858521 3:111189959-111189981 TAGGACCTGGGGCAGCAAGATGG + Intronic
961219227 3:125186906-125186928 AAGCCCAGGTGGCAGCCAGGTGG - Intronic
961568314 3:127779789-127779811 TAGCACATTTCTCAGCAAGAAGG + Intronic
961603696 3:128078332-128078354 TAAGACATGTGGCAGTAAGAAGG + Intronic
962757528 3:138477378-138477400 TACCACAGGTGGCAGCCAGAAGG - Exonic
963865474 3:150356041-150356063 CAGCACATGTGTCAGCTTGGAGG - Intergenic
964709544 3:159657081-159657103 TAGCACATGTGGTAGTACAGGGG - Intronic
965467445 3:169048063-169048085 TTGCACATAGGTCAGCAAGGAGG - Intergenic
967366739 3:188695427-188695449 TTTCAAATGTGGCAGGAAGGTGG - Intronic
967890869 3:194363616-194363638 TATCACATGTGGAAAAAAGGAGG + Intronic
968207055 3:196812401-196812423 TAGCACTTCTGTCAGTAAGGCGG + Intronic
977712131 4:100138445-100138467 AGGCACACGTGGAAGCAAGGAGG - Intergenic
979239473 4:118435560-118435582 TAGCTCATCTGGCTGGAAGGGGG + Intergenic
980722386 4:136716081-136716103 AAGCAAATGAGGCAGCCAGGTGG + Intergenic
984225858 4:177033867-177033889 TCACACATATGGCAGCAAGAAGG - Intergenic
988592487 5:32561193-32561215 TATCACAAGTGACAGCAAGATGG + Intronic
990264274 5:54058854-54058876 TAGCACATAGAGGAGCAAGGCGG + Intronic
995282354 5:110350619-110350641 TAGCCCTTGTGGCAGCCAGTGGG + Intronic
995616836 5:113973920-113973942 GAGCAAGTTTGGCAGCAAGGTGG + Intergenic
995868979 5:116724542-116724564 CAGCAAATGGGGCAGCAAGAAGG - Intergenic
997256976 5:132436308-132436330 CAGCACAGGTGGAAGCAGGGAGG + Intronic
998719099 5:144922936-144922958 AAGCACATGTGGGAGGAATGGGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1001914029 5:175544459-175544481 TATCACAAGTGACAGCAAGATGG - Intergenic
1004806597 6:19210199-19210221 CAGCAGCTGTGGCAGCAAAGCGG + Intergenic
1012618181 6:101303519-101303541 TAGAACATCCTGCAGCAAGGAGG + Intergenic
1013568269 6:111392149-111392171 TAGCACATTTGAGAGAAAGGAGG + Intronic
1013764475 6:113558587-113558609 CAGCACAGGTGGCAGCCAAGTGG + Intergenic
1017418852 6:154251507-154251529 TAGCACCTGAGCCAGAAAGGTGG - Intronic
1018457621 6:163965916-163965938 AAGCAGACGTGGCAGGAAGGGGG - Intergenic
1020825043 7:13016548-13016570 CAGCACATGTGGGAGCCAGATGG - Intergenic
1022320420 7:29282993-29283015 TAGCAAAAGTGGCAGCAAAGAGG + Intronic
1022444407 7:30457950-30457972 TAGCCCATGTGGCATGAAGTGGG + Intronic
1023793533 7:43772237-43772259 GTGCCCATGTGGCAGCAAGATGG + Intronic
1025212836 7:57030780-57030802 GAGCACAGGGGGCGGCAAGGAGG - Intergenic
1025659117 7:63546044-63546066 GAGCACAGGGGGCGGCAAGGAGG + Intergenic
1026055165 7:66977399-66977421 AACCACATGTGGCAGCCTGGTGG + Intergenic
1028642015 7:93053037-93053059 TGGAACAGGTGTCAGCAAGGGGG - Intergenic
1028659747 7:93255855-93255877 TAGCACATGAGGCATGAAGCAGG - Intronic
1028714021 7:93943208-93943230 TAGGACATTTGCCAGCAAGATGG - Intergenic
1029706242 7:102277888-102277910 CAGCACCTGTGCCAGCACGGAGG + Intronic
1030333466 7:108297985-108298007 TTGCTCATGGGGCATCAAGGAGG + Intronic
1030673923 7:112365342-112365364 TGGCCAGTGTGGCAGCAAGGTGG - Intergenic
1033031038 7:137827064-137827086 TAGCACATGAAGAAGGAAGGGGG - Intronic
1034364651 7:150535996-150536018 TAGGACCTGTGTCTGCAAGGTGG - Intergenic
1037616083 8:20520118-20520140 TAGGGCATGTGTCAGCCAGGTGG + Intergenic
1039683037 8:39763363-39763385 TAGAACATCCTGCAGCAAGGAGG + Intronic
1044020303 8:87097752-87097774 TAGCACCTGGGGCACTAAGGAGG - Intronic
1047120937 8:121904000-121904022 TGGCACATGTGTCACCATGGGGG - Intergenic
1047511505 8:125519633-125519655 AAGCAGATGAGGCAGCTAGGGGG - Intergenic
1048642090 8:136375063-136375085 TAGAGCATGCTGCAGCAAGGAGG + Intergenic
1050101255 9:2122499-2122521 TAGCACATGACAGAGCAAGGTGG + Intronic
1051103578 9:13550950-13550972 TAGCAGATGGGGCAGCCAGAAGG + Intergenic
1052981984 9:34456983-34457005 AAGCACATCTGTCAGCCAGGGGG + Intronic
1053570795 9:39304164-39304186 TAGAACATCCTGCAGCAAGGAGG + Intergenic
1053836737 9:42145081-42145103 TAGAACATCCTGCAGCAAGGAGG + Intergenic
1054092417 9:60863183-60863205 TAGAACATCCTGCAGCAAGGAGG + Intergenic
1054113830 9:61138776-61138798 TAGAACATCCTGCAGCAAGGAGG + Intergenic
1054126350 9:61314848-61314870 TAGAACATCCTGCAGCAAGGAGG - Intergenic
1054593866 9:67043412-67043434 TAGAACATACTGCAGCAAGGAGG - Intergenic
1055883681 9:81033259-81033281 TGACACATGTGGCAGGAAGGAGG + Intergenic
1058909041 9:109504360-109504382 AAGCACATCTGGCAGCCATGAGG - Intergenic
1059427829 9:114232089-114232111 GAGCAGCTGTTGCAGCAAGGAGG + Intronic
1060214625 9:121731337-121731359 TGGCACATGTCACGGCAAGGAGG + Intronic
1060303772 9:122392382-122392404 GAGCACATTTGGCGGCGAGGTGG + Exonic
1061056686 9:128226379-128226401 TAGCATAGGTGCCACCAAGGAGG - Intronic
1185894505 X:3845405-3845427 CAGCAGATGTTGCAGCAAAGAGG + Intergenic
1185899623 X:3883829-3883851 CAGCAGATGTTGCAGCAAAGAGG + Intergenic
1185904739 X:3922258-3922280 CAGCAGATGTTGCAGCAAAGAGG + Intergenic
1187156595 X:16725652-16725674 AAGCAGATGTGGCAGCATGGAGG - Intronic
1187203242 X:17156281-17156303 TAGCAGATTTGGCAGAAAGAAGG + Intergenic
1187705797 X:22008180-22008202 TAGCCCAGGAGGCAGTAAGGTGG + Intergenic
1189173730 X:38933696-38933718 TTGGACATGGGACAGCAAGGAGG + Intergenic
1191722721 X:64248221-64248243 CAGCAGCTGTGGCAGCATGGTGG + Intergenic
1192506618 X:71689508-71689530 TAGCTCATGTTTCAGCAAGCTGG + Intergenic
1192520079 X:71792038-71792060 TAGCTCATGTTTCAGCAAGCTGG - Intergenic
1193671902 X:84397359-84397381 TAGAACTTGGAGCAGCAAGGAGG + Intronic
1199423245 X:147671315-147671337 TAATACATGTGACAACAAGGTGG + Intergenic
1199522680 X:148753995-148754017 TTGCACTTGAGGGAGCAAGGCGG + Intronic