ID: 1095653971

View in Genome Browser
Species Human (GRCh38)
Location 12:44647935-44647957
Sequence TAGGTGATGCATCATGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095653971 Original CRISPR TAGGTGATGCATCATGTGGT TGG Intronic
912042275 1:105407417-105407439 TATGTGATTAATCATGTTGTTGG + Intergenic
912688713 1:111787382-111787404 GAGGTGCTGCATCAGGTGGTGGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917856479 1:179105052-179105074 TAGTTCAAGCATCATGTGGACGG + Exonic
920846017 1:209593639-209593661 TAGGCGATGTGTCATATGGTGGG - Intronic
920971618 1:210748120-210748142 AGGGTGATGCATCATGTGTCAGG + Intronic
923697752 1:236270856-236270878 TAGGGGATGGATGATGGGGTAGG + Intronic
924303892 1:242667092-242667114 TAGGAAATGCATCATCTGGTTGG + Intergenic
1064038655 10:11938033-11938055 TAGTTGTTGCATCTTGGGGTTGG - Intronic
1064817278 10:19280206-19280228 CAGATGAAGCATCCTGTGGTAGG + Exonic
1065666861 10:28072353-28072375 GAGATGATGCAGCCTGTGGTGGG - Intronic
1068118622 10:52761648-52761670 TAAGTGATGCCTCTTGAGGTGGG + Intergenic
1068567088 10:58588320-58588342 TAGATGATACATCTGGTGGTGGG + Intronic
1068823432 10:61405459-61405481 TATGTGATAAATCATGGGGTGGG - Intergenic
1074198905 10:111214508-111214530 GAGTTGATGGATCATATGGTAGG + Intergenic
1075558949 10:123454521-123454543 TAGGTGCTGTATTAAGTGGTTGG + Intergenic
1080956053 11:37097183-37097205 TAGGTGATGCATTAGGTTCTTGG + Intergenic
1081083010 11:38766917-38766939 AAGGTGATGCAACATATAGTAGG - Intergenic
1082958414 11:58896248-58896270 TAGGTGATGCATGAAGAGGCTGG - Intronic
1087467959 11:98533634-98533656 AAGTTGATGCACCATGTGCTAGG + Intergenic
1088305025 11:108398695-108398717 TAGGTGATGGCACATATGGTAGG + Intronic
1091315589 11:134611745-134611767 TAGGGGAAGCATCATTTGCTGGG + Intergenic
1091332420 11:134740500-134740522 TGTGTGATGCATGATGTGGGTGG + Intergenic
1091332448 11:134740728-134740750 TGTGTGATGCATGATGTGGGTGG + Intergenic
1095653971 12:44647935-44647957 TAGGTGATGCATCATGTGGTTGG + Intronic
1096115323 12:49051753-49051775 TAGGTGATTCTTCAGGTGGTGGG + Exonic
1096115455 12:49052311-49052333 TGGGTGATTCCTCAGGTGGTGGG + Exonic
1102334469 12:112066243-112066265 TAGTTGAAGCATCAAATGGTGGG - Intronic
1102815177 12:115859590-115859612 GAGGTGGTGGAGCATGTGGTAGG - Intergenic
1106773282 13:32983749-32983771 TAGGGGATGAATCATGAGTTTGG - Intergenic
1107661940 13:42647809-42647831 TACATGATACATCATGTGCTTGG + Intergenic
1108737071 13:53295329-53295351 TAGGTGATGCATCTAGTCTTTGG + Intergenic
1112499804 13:99934119-99934141 AAGGTGATGTATCATGGGGGTGG - Intergenic
1113303329 13:109046913-109046935 TAGGTAATGTATGATGTTGTTGG + Exonic
1115167979 14:30471144-30471166 TGGGTGATGAATAATTTGGTTGG - Intergenic
1116739580 14:48737144-48737166 TACATGATGTACCATGTGGTTGG - Intergenic
1117556228 14:56887713-56887735 AAGATGATGCATCATCTGTTTGG + Intergenic
1120502207 14:85310805-85310827 GAGGTGATGGATCATGGGGGTGG - Intergenic
1120672812 14:87383929-87383951 TAGGTAATGAATCAACTGGTTGG + Intergenic
1131676436 15:94674977-94674999 TAGGACATGCATGATGTGGCTGG - Intergenic
1136012736 16:27374589-27374611 TAGATGCTGCAGCCTGTGGTAGG - Intergenic
1138114725 16:54351215-54351237 TAGGGGATGCATCATGGAGATGG - Intergenic
1140433207 16:74922540-74922562 AAGGTGATGCTTCATGTGGATGG - Intronic
1141844673 16:86599260-86599282 GAGGTGATGAATCATGGGGACGG + Intergenic
1144354724 17:14434424-14434446 TAGGAGATGCATCCTGAGGAAGG + Intergenic
1145857428 17:28174843-28174865 CAGGATATGCATCATGTGGTTGG - Intronic
1155334571 18:24750884-24750906 AAGTTGATGCATCATGTTTTTGG - Intergenic
1156069314 18:33187201-33187223 GAGATGATGGATCATGGGGTTGG - Intronic
1157411507 18:47466707-47466729 AAGGTCATGCCTCATGGGGTGGG + Intergenic
1159875219 18:73803389-73803411 TGGGTGATGCATCCTGAGGCAGG + Intergenic
1163874330 19:19854183-19854205 TGGATTATGCATCATATGGTTGG - Intergenic
1163930454 19:20385570-20385592 TAAGTTATGCATTATATGGTTGG + Intergenic
1164551525 19:29216546-29216568 GAGGTGATGGATCATGGGGGCGG - Intergenic
1165964868 19:39568179-39568201 TAGGTGACAGATTATGTGGTGGG - Intergenic
927781526 2:25943191-25943213 TAAGTGATGCGGCAAGTGGTGGG + Intronic
928416007 2:31092366-31092388 TAGGTGATGAGTCATGAGGGTGG - Intronic
929811088 2:45189866-45189888 GAGGTGATGGATCATGGGGGTGG + Intergenic
929823316 2:45290675-45290697 TAGGTAATGCAGCAGGTGTTGGG + Intergenic
945059203 2:205893737-205893759 TAGGGGATTCATTATGTGCTAGG - Intergenic
1169284412 20:4295900-4295922 GAGTTGCTGCATCATGAGGTAGG - Intergenic
1170398336 20:15952510-15952532 TAGATGATAAATCAGGTGGTTGG - Intronic
1171273023 20:23831213-23831235 TAGGTGATGCTTTCTGTGTTTGG - Intergenic
1171426593 20:25052381-25052403 CAGGTCATCCATCATGTGCTGGG - Intronic
1173191299 20:40878053-40878075 TGGGTGATCCATGATGGGGTAGG + Intergenic
1176658466 21:9611283-9611305 TAGGTGAAGCCTTATGTGTTAGG + Intergenic
1181665657 22:24394560-24394582 TAGCTGCTGGATCATGTGGTAGG + Intronic
1181985999 22:26800163-26800185 GAGGTGTTGGATCATGGGGTGGG + Intergenic
949691944 3:6650746-6650768 TAGTTGAGTCTTCATGTGGTGGG - Intergenic
951752709 3:26055148-26055170 TAGATGGTGCATAATGGGGTAGG + Intergenic
954590099 3:51775881-51775903 TTGGTGATGTATCAGGTGGGAGG + Intergenic
955557339 3:60152071-60152093 TCTGTGTTGCATCATGTTGTTGG - Intronic
959003990 3:100998320-100998342 GTTGTGAGGCATCATGTGGTAGG - Intergenic
959201240 3:103250564-103250586 TTGGTTGTGCAACATGTGGTTGG + Intergenic
960334609 3:116400932-116400954 TAGTAGATCCATCCTGTGGTAGG - Intronic
969479208 4:7438323-7438345 CAGGTCATGCATCGTGTGGGGGG + Intronic
970665089 4:18327497-18327519 TAGGTGCTGCATTATGTGTCTGG + Intergenic
977400815 4:96529639-96529661 TTGGTTATGCAACATGCGGTGGG + Intergenic
980627113 4:135387772-135387794 CAGGTGATTTATCACGTGGTTGG - Intergenic
981919380 4:150069955-150069977 TTGGTGAGACATCATGTTGTTGG + Intergenic
982146045 4:152393760-152393782 TAGGAGATGCATTACTTGGTTGG - Intronic
983370797 4:166855676-166855698 TAGTTTATGCATCATGTGCCAGG + Intronic
985085020 4:186304353-186304375 TAGCTGATTCCTCAGGTGGTGGG - Intergenic
986493745 5:8320575-8320597 TGGATGATGCATGATGTGCTTGG - Intergenic
989449856 5:41573823-41573845 TAGGTGATATATGATGTAGTTGG - Intergenic
997877037 5:137558815-137558837 GAGCTCAAGCATCATGTGGTAGG + Intronic
998789464 5:145750441-145750463 TAGGGATTGCATAATGTGGTGGG - Intronic
999370327 5:151051374-151051396 TGGGTGATGAGTCATCTGGTGGG - Intronic
1000881679 5:166705079-166705101 AACGGGATGCATCCTGTGGTAGG - Intergenic
1002971718 6:2029696-2029718 TATGTGATCCAGCATGGGGTTGG - Intronic
1007034720 6:38662633-38662655 TGGGTGGTGCAGCATGTGGTAGG + Intergenic
1007201541 6:40113943-40113965 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007201545 6:40113962-40113984 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007201549 6:40113981-40114003 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007201553 6:40114000-40114022 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007201557 6:40114019-40114041 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1007201561 6:40114038-40114060 TAGGGGATGCAAGTTGTGGTAGG + Intergenic
1010108480 6:72196000-72196022 GAGGTGATGGATCATGGGGGCGG - Intronic
1010850211 6:80766017-80766039 TTGGTCGTGCAACATGTGGTTGG - Intergenic
1012388705 6:98711366-98711388 TGGCTGCTGCATCATGTGTTTGG + Intergenic
1013304981 6:108839332-108839354 GAGGTGGCGCATCACGTGGTGGG + Intergenic
1014398800 6:120961424-120961446 AAGGTGTTGCAGCATGTGGGTGG - Intergenic
1028438668 7:90833612-90833634 TAGATAAGGCAGCATGTGGTTGG + Intronic
1039100507 8:33936797-33936819 TAGGTGAAGCAGAATTTGGTGGG + Intergenic
1044303005 8:90607171-90607193 TAGGTGATACATCAAGCGTTTGG - Intergenic
1044747893 8:95388993-95389015 GAGGAGAAGCATCATGTGCTTGG + Intergenic
1047001926 8:120581626-120581648 TGAGTGATGTATCATGTGGATGG + Intronic
1052586704 9:30438609-30438631 TAGGTGAAGGATCTTGTGATAGG - Intergenic
1053083599 9:35198199-35198221 TAGGTGATGGATCATGGGAGCGG + Intronic
1057832553 9:98418232-98418254 TAGATGATGCATGAGGTGGGAGG + Intronic
1060934191 9:127506250-127506272 TAGGGGGTGCCTCATGGGGTGGG - Exonic
1203636195 Un_KI270750v1:114860-114882 TAGGTGAAGCCTTATGTGTTAGG + Intergenic
1187169453 X:16836914-16836936 TAGGGGAAGCTTCATGTGGGAGG - Intronic
1190483251 X:50898569-50898591 TAGCTGATGCATAATATGTTAGG + Intergenic
1194637317 X:96361934-96361956 TATCTGATGCTTTATGTGGTAGG - Intergenic
1195405447 X:104508053-104508075 TAGGTGATCCAGGATGTGATTGG - Intergenic
1195962562 X:110401344-110401366 TAGGTGTTGCAGCATGTAGGTGG - Intronic