ID: 1095655350

View in Genome Browser
Species Human (GRCh38)
Location 12:44662135-44662157
Sequence CTGAGTCATTTCCACAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095655350 Original CRISPR CTGAGTCATTTCCACAACTT TGG Intronic
900488806 1:2936085-2936107 CTGTGTCATTTCTGGAACTTTGG - Intergenic
900822874 1:4902747-4902769 CAAAGTCATTTCCACATTTTTGG + Intergenic
905508562 1:38500412-38500434 CTTAGGGATTTCCACAACTTTGG + Intergenic
906421283 1:45669637-45669659 CTTAGTCATTTTCTCAATTTTGG - Intronic
906760628 1:48373868-48373890 CTGGGTCCTTCCCACAACATAGG + Intronic
907707897 1:56848411-56848433 CAAAGTCATTTCCACATTTTTGG + Intergenic
909271699 1:73629863-73629885 CAAAGTCATTTCCACATTTTGGG + Intergenic
909906666 1:81204369-81204391 CTGAGTTCTTTCCACAGCTAAGG - Intergenic
910357680 1:86378424-86378446 CAAAGTCATTTCCACATTTTTGG + Intronic
911084190 1:93962957-93962979 CTGTGGCATTTCCAAAAATTGGG - Intergenic
914392858 1:147237387-147237409 CTGAGTCATGTCCACCAACTCGG - Intronic
914768499 1:150661400-150661422 TTGAGTTATTTCCACATTTTGGG - Intronic
918079380 1:181194066-181194088 CAAAGTCATTTCCACATTTTTGG - Intergenic
918800063 1:188960236-188960258 CAAAGTCATTTCCACATTTTCGG - Intergenic
920113898 1:203606335-203606357 CTGAGTAATTTCTACAAGCTAGG - Intergenic
920843739 1:209576466-209576488 TTGAGTCCTTTCCACAAGTGGGG + Intergenic
921082819 1:211756592-211756614 CTCACTCAATTCCACCACTTTGG - Intronic
921552739 1:216558093-216558115 CTGAGCATTTTTCACAACTTTGG + Intronic
921959085 1:221015346-221015368 ATGAGTCACTTCCAAAAATTGGG - Intergenic
923155567 1:231275993-231276015 CTGAGGCCTTTCGACTACTTAGG + Intronic
923427938 1:233890768-233890790 CAGAGTCACTTCCACATTTTTGG - Intergenic
923696964 1:236262841-236262863 CTGCAGCATTTCCACAACTGAGG - Intronic
924152530 1:241143246-241143268 CAAAGTCATTTCCACATGTTTGG + Intronic
924496985 1:244600062-244600084 TTGAGTCACTCCCTCAACTTAGG + Intronic
1065029563 10:21571395-21571417 CAGCTTCATTTCCTCAACTTGGG + Intronic
1065871686 10:29961173-29961195 CAGAGTCATTTCCTCAACCCTGG - Intergenic
1067019020 10:42779210-42779232 CTGAGTCATTGATAAAACTTTGG + Intergenic
1070506494 10:77118043-77118065 CTGTTTCATTTCCAGTACTTTGG - Intronic
1072578270 10:96719793-96719815 CTGCGTCCTTTGCAGAACTTTGG - Intronic
1073161192 10:101397327-101397349 TTTAATCATTTCCACAACTGTGG - Intronic
1073457297 10:103645368-103645390 CGAAGTCATTTCCCCAAATTGGG - Intronic
1073864497 10:107786551-107786573 CAAAGTCATTTCCACATTTTTGG - Intergenic
1074475797 10:113773033-113773055 CTGCGTCATTTCCCAAACTGGGG + Intronic
1075103479 10:119522014-119522036 CTGAGTCATTCCCTCATTTTGGG - Intronic
1076483017 10:130797143-130797165 CTGAGGGAATTCCACAACCTGGG + Intergenic
1080695844 11:34602473-34602495 CTGAGTCATTTCACCTTCTTGGG + Intergenic
1081032245 11:38098673-38098695 CAAAGTCACTTCCACAATTTTGG + Intergenic
1081682788 11:45020172-45020194 TTGAGAGATTTCCTCAACTTTGG - Intergenic
1086758939 11:90603028-90603050 CAAAGTCATTTCCACATTTTTGG - Intergenic
1086928202 11:92663745-92663767 CTTACTCATTGCCACCACTTTGG + Intronic
1087341704 11:96915331-96915353 CAAAGTCATTTCCACATTTTCGG - Intergenic
1088137305 11:106572833-106572855 CTGATACTTTTCAACAACTTTGG + Intergenic
1088424771 11:109691527-109691549 TTGGGTGATTTCCACAATTTTGG - Intergenic
1088435337 11:109805716-109805738 CTGAGTCACTTCCACATTATTGG + Intergenic
1088632020 11:111782812-111782834 CTGGGTCATTTTTCCAACTTTGG - Intronic
1090431571 11:126650755-126650777 CAAAGTCACTTCCACATCTTTGG + Intronic
1090890910 11:130921702-130921724 CTGGGTCCTTCCCACAACATGGG + Intergenic
1092896382 12:13015070-13015092 CTCCGTTGTTTCCACAACTTCGG - Intergenic
1092932232 12:13326873-13326895 CTGAGTCATTTTCCCAACACAGG + Intergenic
1093624140 12:21326349-21326371 CAAAGTCATTTCCACATTTTTGG - Intronic
1094339491 12:29395106-29395128 CTGAGTCCTTTACACAGATTGGG + Intergenic
1095250311 12:39971509-39971531 CTGAGTCATGTCAACATCTCTGG + Intronic
1095623105 12:44282292-44282314 CAAAGTCATTTCCACATTTTTGG - Intronic
1095655350 12:44662135-44662157 CTGAGTCATTTCCACAACTTTGG + Intronic
1097522925 12:60690537-60690559 CAAAGTCATTTCCACATTTTTGG - Intergenic
1098889378 12:75993263-75993285 CTGAGCCTTTCCCAGAACTTTGG + Intergenic
1101023521 12:100577747-100577769 CTGAATCATCTCCCCAATTTAGG - Intronic
1102397614 12:112600729-112600751 CAAAGTCATTTCCACATTTTGGG + Intronic
1103617935 12:122166851-122166873 CTGAGTCATCTCCAGAACTGCGG + Intergenic
1107169916 13:37328654-37328676 CTGGGTTCTTTCCACAACGTGGG + Intergenic
1108690205 13:52852601-52852623 CTGGATCATTTCCAGATCTTGGG + Intergenic
1108724434 13:53164423-53164445 CAAAGTCATTTCCACATTTTCGG + Intergenic
1109097787 13:58141025-58141047 CAGAGTCACTTCCACATGTTTGG - Intergenic
1109576196 13:64262908-64262930 CAAAGTCATTTCCACATTTTTGG - Intergenic
1109785879 13:67173907-67173929 CTAACTCTTTTCAACAACTTAGG + Intronic
1109947836 13:69461934-69461956 CTAACTGATCTCCACAACTTAGG + Intergenic
1110793740 13:79613453-79613475 CAAAGTCATTTCCACAATTTTGG + Intergenic
1111072456 13:83187011-83187033 CAAAGTCATTTCCACAGTTTTGG - Intergenic
1111358688 13:87145535-87145557 CAAAGTCATTTCCACATTTTTGG - Intergenic
1111723826 13:91979512-91979534 TTGATTCAATTCCACAACTTTGG + Intronic
1113497635 13:110744464-110744486 CAAAGTCATTTCCACATTTTTGG + Intergenic
1114730541 14:24988288-24988310 GTGAGTAATTACCACAACCTGGG + Intronic
1116667285 14:47794100-47794122 TTGAGTAATTTTCACAAATTTGG - Intergenic
1116993691 14:51301411-51301433 CTATGTCAAGTCCACAACTTAGG + Intergenic
1117800437 14:59438576-59438598 TTGAGTCATTTCCACTTTTTAGG - Intronic
1120165861 14:81198919-81198941 CTAAGTAATTTCTACATCTTGGG + Intronic
1120972020 14:90215494-90215516 CAGAGTCACTTCCACATTTTTGG + Intergenic
1120994216 14:90403472-90403494 CTGAGTGATTTCCCTAACTCAGG + Intronic
1122380047 14:101296483-101296505 CAGAGTCACTTCCACATTTTCGG + Intergenic
1124626210 15:31308897-31308919 CTGACTCAGTTGCATAACTTGGG - Intergenic
1126006363 15:44261870-44261892 TTGTGTTATTTGCACAACTTGGG + Intergenic
1127025293 15:54798330-54798352 CTAAGTAATTTCCACATCTGAGG - Intergenic
1127526495 15:59797808-59797830 CTAAATCATCTCCACTACTTTGG - Intergenic
1131156640 15:90079956-90079978 CCGAGTCATTTGCACCACTAGGG + Exonic
1134853420 16:17500306-17500328 CTGAGTCATGTCCCACACTTTGG + Intergenic
1139344621 16:66294549-66294571 TTGATTCATTTTCACAACATGGG + Intergenic
1143759718 17:9092229-9092251 CTGACACATTTACACAACTTGGG - Intronic
1144225941 17:13146238-13146260 CTGATTCATTTTCACAATTCTGG + Intergenic
1148432420 17:47652636-47652658 CTTAGGAATTTCCACAACTGAGG - Intronic
1149130712 17:53297523-53297545 CTGAAACATTTCCAGATCTTGGG + Intergenic
1149158863 17:53666886-53666908 CAAAGTCATTTCCACATTTTTGG - Intergenic
1151105994 17:71617992-71618014 CAAAGTCACTTCCACATCTTTGG - Intergenic
1153047181 18:866900-866922 CTGTATCACTTCCACAACTTGGG + Intergenic
1153214927 18:2810578-2810600 CAAAGTCACTTCCACATCTTCGG + Intergenic
1153533335 18:6072370-6072392 CTGATTCATTTCCAGATATTTGG - Intronic
1158222902 18:55168595-55168617 CAAAGTCATTTCCACATTTTCGG - Intergenic
1158905247 18:62005482-62005504 CTGGGTCCTTACCACAACATGGG + Intergenic
1159261400 18:66017066-66017088 CAAAGTCATTTCCACATTTTTGG + Intergenic
1159369280 18:67510904-67510926 CTGATTCATATCCACAAAGTGGG + Exonic
1161869871 19:6861889-6861911 CTGAGTCATTCACACAGCCTGGG - Intergenic
1166987477 19:46670008-46670030 CTAATTCTATTCCACAACTTGGG + Intergenic
925805257 2:7642052-7642074 CAAAGTCATTTCCACATTTTTGG + Intergenic
928842914 2:35632590-35632612 CAGAGTCACTTCCACATTTTTGG + Intergenic
932890338 2:75590417-75590439 CTGAGTCATTATCAAAACTATGG + Intergenic
933763064 2:85687390-85687412 CTGAGTCATTTGCGCAAGCTGGG + Intronic
933798811 2:85943313-85943335 CAAAGTCATTTCCACATTTTTGG + Intergenic
933989181 2:87621461-87621483 CTGATTCATTTCCTCATCTGTGG + Intergenic
934144049 2:89074516-89074538 CAAAGTCATTTCCACATTTTTGG - Intergenic
934225195 2:90126036-90126058 CAAAGTCATTTCCACATTTTTGG + Intergenic
935281094 2:101518587-101518609 CTAAGTCCTTTCCTCTACTTTGG + Intergenic
935626085 2:105173367-105173389 CAAAGTCATTTCCACATTTTTGG + Intergenic
936304662 2:111329365-111329387 CTGATTCATTTCCTCATCTGTGG - Intergenic
938168829 2:129057102-129057124 CTGATTCATTTCCACACCTTTGG + Intergenic
938241724 2:129747546-129747568 CTGAGTCAGCTCCAGGACTTGGG - Intergenic
940948672 2:159647071-159647093 CAAAGTCATTTCCACATTTTAGG + Intergenic
941498580 2:166239691-166239713 CTGAGTCATTGCCATAGTTTCGG - Intronic
941501711 2:166286652-166286674 ATGAGTCATTTCCAAATCCTAGG + Intronic
942604578 2:177676913-177676935 CTGAATCATTTACTCACCTTGGG - Intronic
942648423 2:178141035-178141057 CTGATTCATTTAAACAACTCAGG - Intergenic
943115025 2:183658245-183658267 CTGGGTCCTTCCCACAACATGGG - Intergenic
943237930 2:185346927-185346949 CAAAGTCACTTCCACATCTTTGG - Intergenic
943587839 2:189761382-189761404 CTTAGTCATTTCCACTTTTTTGG - Intronic
944043950 2:195387704-195387726 CTAAGTCACTTCCACATTTTCGG - Intergenic
944103322 2:196052982-196053004 CTTAGTCCTTTCCACGACTATGG - Intronic
945730163 2:213523467-213523489 CAGAGTCACTTCCACATTTTTGG - Intronic
946534222 2:220608760-220608782 CAAAGTCATTTCCACATGTTTGG + Intergenic
946574365 2:221058000-221058022 CAAAGTCATTTCCACACTTTTGG + Intergenic
947240100 2:227985117-227985139 GTGAGTTATTTTGACAACTTTGG - Intronic
1170474325 20:16699947-16699969 CTGAGGCAATTCAGCAACTTCGG + Intergenic
1170820240 20:19751508-19751530 CTCAGTCTTTTCCAGAACTTGGG - Intergenic
1172214406 20:33224961-33224983 CTGAGTCCTTTCAACAAACTAGG - Intronic
1175623576 20:60471761-60471783 CACATTCATTTCCACAACTGGGG - Intergenic
1177261148 21:18732132-18732154 CTGAGTCCCTCCCACAACGTGGG - Intergenic
1177475334 21:21613199-21613221 ATTAGTCATTTCCACAATTGTGG - Intergenic
1180152852 21:45960762-45960784 CTGAGTCACTCCCACAACGTGGG + Intergenic
1180874945 22:19170876-19170898 CTGCGTCTTTTCCTCCACTTGGG - Intergenic
951692389 3:25410125-25410147 ATCAGTCATTTTCAGAACTTAGG - Intronic
952396976 3:32929762-32929784 CAAAGTCATTTCCACATTTTTGG - Intergenic
952608826 3:35182441-35182463 CAAAGTCATTTCCACATTTTTGG + Intergenic
954826714 3:53379975-53379997 CTGATTCCTTTCCAAAACTTAGG + Intergenic
957814349 3:85273800-85273822 ATGAGTCATTTTCACATCTGTGG + Intronic
958700699 3:97585430-97585452 CTGAGTTATTTTTAAAACTTTGG - Intronic
959788929 3:110333463-110333485 CAAAGTCATTTCCACATTTTTGG + Intergenic
960882052 3:122355130-122355152 CTGAGTGGTTACCACAAATTAGG - Intergenic
961123088 3:124390732-124390754 CTGTTTCATTTGCACAGCTTGGG - Intronic
963422193 3:145074158-145074180 CTAAGTCACTTCCACATTTTTGG + Intergenic
964829079 3:160863084-160863106 CTGACACATTTTCACAATTTGGG + Intronic
965102034 3:164310380-164310402 CTAAGTCACTTCCACATTTTTGG + Intergenic
965423874 3:168497854-168497876 CTGGGTCTTTTCCAAAACTCAGG - Intergenic
967488137 3:190057900-190057922 CTCAGTCATTCCCAGAACTAAGG + Intronic
967506723 3:190260914-190260936 CAGGGGAATTTCCACAACTTAGG + Intergenic
967614488 3:191548164-191548186 CAAAGTCATTTCCACATTTTTGG + Intergenic
970306203 4:14734899-14734921 CAAAGTCATTTCCACATTTTTGG + Intergenic
971754263 4:30686783-30686805 CTTAGTCTTTTCCAAAACATTGG + Intergenic
972020475 4:34307305-34307327 CAGAGACATTTCCTCAAGTTAGG - Intergenic
972887603 4:43511123-43511145 CAAAGTCATTTCCACATTTTTGG + Intergenic
974953681 4:68612905-68612927 CTGAGTTTTTTCCTCAACTCTGG + Intronic
976553390 4:86422374-86422396 ATGAGTCATTCCCACATGTTAGG - Intronic
976875713 4:89851145-89851167 CAAAGTCATTTCCACATTTTGGG + Intergenic
977197610 4:94082132-94082154 CAAAGTCATTTCCACATTTTTGG + Intergenic
980882496 4:138726710-138726732 CTGAGTCATTTCCAAGACAAAGG + Intergenic
982390020 4:154853636-154853658 CAAAGTCACTTCCACAATTTTGG + Intergenic
986273048 5:6250689-6250711 CTGAGTCATATCAACATCTCTGG - Intergenic
986640724 5:9869148-9869170 CAAAGTCACTTCCACAATTTTGG + Intergenic
986672794 5:10157785-10157807 CTGAATCATGTCCACAACTGAGG - Intergenic
987451641 5:18091869-18091891 CTGAGTCCTTGCCACAGATTAGG + Intergenic
988237800 5:28568989-28569011 ATTAGACATTTCCACTACTTCGG - Intergenic
990151913 5:52828061-52828083 TTGAGTCATTTCCACCTTTTTGG + Intronic
990291121 5:54353192-54353214 CTGAGTCTTTTCCAGACATTTGG - Intergenic
990941565 5:61207393-61207415 CAGAGTCACTTCCACATTTTTGG + Intergenic
991056530 5:62326647-62326669 CTGAGTCATTTCCATCAATATGG + Intronic
991062082 5:62387211-62387233 CTGAGTCCTTTCCAAAACAAAGG - Intronic
991409283 5:66330769-66330791 CAAAGTCATTTCCACATTTTCGG - Intergenic
992018791 5:72602111-72602133 TTGGGTCATTTCCACTTCTTTGG + Intergenic
993431061 5:87832319-87832341 CAGAGTCACTTCCACATTTTTGG + Intergenic
994278798 5:97874678-97874700 CTGACTCATCTGTACAACTTGGG - Intergenic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
995111193 5:108430198-108430220 CTGAGTAATTTCCACAGCAATGG + Intergenic
996636037 5:125691303-125691325 CAAAGTCATTTCCACATTTTCGG - Intergenic
1000030602 5:157398018-157398040 CAAAGTCATTTCCACATTTTTGG + Intronic
1003720047 6:8692031-8692053 CAAAGTCACTTCCACAATTTTGG - Intergenic
1004692992 6:18008926-18008948 CTTAATCACTTCCACAACTGTGG - Intergenic
1006057565 6:31396618-31396640 CTGAGTCAGTTCCTGAACGTGGG + Intergenic
1008438140 6:51500077-51500099 CTGATACCTCTCCACAACTTTGG - Intergenic
1011792612 6:90914880-90914902 CAAAGTCATTTCCACATCTTTGG - Intergenic
1011981793 6:93387488-93387510 CTAAGTCACTTCCACATTTTAGG + Intronic
1012005317 6:93706923-93706945 CAAAGTCATTTCCACATTTTTGG - Intergenic
1014101732 6:117518448-117518470 CAAAGTCACTTCCACATCTTCGG + Intronic
1014561566 6:122897466-122897488 CTGATCCATGTCCACAGCTTGGG + Intergenic
1017801720 6:157902154-157902176 CTGAATCATATCCAAAACTTAGG - Intronic
1018471890 6:164104940-164104962 CTGAGTCATTTTTAGACCTTGGG + Intergenic
1018585622 6:165354572-165354594 TTGAGTTATTTCTACAACTGAGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020837315 7:13169223-13169245 CTCAGTCACTTCCACATTTTTGG + Intergenic
1021392681 7:20113414-20113436 CTGAGGCATTTCTAGAACTCAGG - Intergenic
1022232212 7:28425175-28425197 TTGAGTTATTTCCACATTTTTGG - Intronic
1022703179 7:32780314-32780336 CATGGTCATTTCCACAATTTGGG - Intergenic
1022907411 7:34870448-34870470 CATGGTCATTTCCACAATTTGGG - Intronic
1024059330 7:45686363-45686385 CTGAGTCCTTGCTAGAACTTGGG - Intronic
1024482896 7:49883607-49883629 TTTTATCATTTCCACAACTTTGG - Intronic
1028493559 7:91440421-91440443 CAAAGTCATTTCCACATTTTTGG - Intergenic
1029490681 7:100868421-100868443 CAGGGTCATTTCCACAAATGTGG + Intronic
1030737179 7:113063188-113063210 CTGAGCTATTTACACAACCTTGG - Intergenic
1031674124 7:124588435-124588457 CAAAGTCATTTCCACATTTTTGG - Intergenic
1032443736 7:131962270-131962292 CTGAGTGATATCCCCACCTTGGG + Intergenic
1033832964 7:145275706-145275728 CTAACTCACTTCCACATCTTTGG - Intergenic
1034077520 7:148246768-148246790 CTGAGTCATTCCCCTAACTCAGG - Intronic
1037617856 8:20535689-20535711 CTGCCTAATGTCCACAACTTTGG - Intergenic
1038714978 8:29983397-29983419 CTAATTCATTTCCACACCTAAGG - Intergenic
1038904887 8:31889629-31889651 CTGAGCCATTTCCAAACCTGTGG - Intronic
1044008526 8:86964839-86964861 CTGAATCAATCCCACAACGTTGG + Intronic
1046065793 8:109195492-109195514 CAGAGTCACTTCCACATTTTGGG + Intergenic
1048542016 8:135350694-135350716 ATGAATCATTTCCACAACTCTGG - Intergenic
1051895625 9:21984867-21984889 CTGTGTCCTTTCCTGAACTTAGG + Intronic
1051914932 9:22197387-22197409 CAAAGTCATTTCCACATTTTTGG - Intergenic
1052019491 9:23509054-23509076 CTGGGTCCTTCCCACAACGTGGG - Intergenic
1055285472 9:74724126-74724148 CTCTGTCTTTTCCACAACATAGG - Exonic
1055786909 9:79880981-79881003 CTGAGTAATTTCCTAGACTTTGG + Intergenic
1057648045 9:96895438-96895460 CTGAATCAATTCCAAGACTTGGG + Intergenic
1059368495 9:113806049-113806071 CTGATTCATTTCCCAACCTTGGG - Intergenic
1060630155 9:125150093-125150115 CTGAGTCAAGTGCACAACTATGG + Intronic
1187555069 X:20343802-20343824 CTAAGTCACTTCCACATTTTCGG - Intergenic
1188768954 X:34130153-34130175 CTTAGCTTTTTCCACAACTTAGG + Exonic
1189486277 X:41435061-41435083 CTGAGTCAAAACTACAACTTTGG + Intergenic
1190703740 X:53007780-53007802 CAGAGTCATTTTCACATCTTCGG + Intergenic
1192935003 X:75850083-75850105 CAAAGTCATTTCCACATTTTCGG + Intergenic
1194656174 X:96576564-96576586 CTGAGTCATTTCCAGTCCTTTGG + Intergenic
1194841826 X:98753026-98753048 CAAAGTCATTTCCACATTTTTGG + Intergenic
1196690206 X:118550962-118550984 CTGAGTCATTTCCCCAATCCTGG + Intronic
1197914455 X:131520260-131520282 CTAAGTCACTTCCACATTTTCGG - Intergenic
1198651488 X:138867987-138868009 CTGAGTCATCTCTCCTACTTTGG - Intronic
1199113148 X:143958671-143958693 CTGGGTCCCTTCCACAACATGGG + Intergenic
1199362994 X:146944227-146944249 CAAAGTCATTTCCACATTTTTGG + Intergenic
1200381500 X:155842225-155842247 CAAAGTCATTTCCACATTTTCGG - Intergenic