ID: 1095658518

View in Genome Browser
Species Human (GRCh38)
Location 12:44700088-44700110
Sequence GATGTTGGTGCTGCTCACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095658518_1095658521 4 Left 1095658518 12:44700088-44700110 CCTAAGTGAGCAGCACCAACATC 0: 1
1: 0
2: 0
3: 22
4: 226
Right 1095658521 12:44700115-44700137 TATTTATTAGTCCAGAAACCTGG 0: 1
1: 0
2: 0
3: 10
4: 181
1095658518_1095658522 5 Left 1095658518 12:44700088-44700110 CCTAAGTGAGCAGCACCAACATC 0: 1
1: 0
2: 0
3: 22
4: 226
Right 1095658522 12:44700116-44700138 ATTTATTAGTCCAGAAACCTGGG 0: 1
1: 0
2: 2
3: 15
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095658518 Original CRISPR GATGTTGGTGCTGCTCACTT AGG (reversed) Intronic
900441434 1:2657479-2657501 GTTGTGGGTGCTGCTCCGTTCGG - Intronic
900442142 1:2661131-2661153 GTTGTGGGTGCTGCTCTGTTCGG - Intronic
900442437 1:2662657-2662679 GTTGTGGGTGCTGCTCTGTTCGG - Intronic
900443036 1:2665747-2665769 GTTGTGGGTGCTGCTCTGTTCGG - Intronic
900443330 1:2667273-2667295 GTTGTGGGTGCTGCTCTGTTCGG - Intronic
900443929 1:2670363-2670385 GTTGTGGGTGCTGCTCTGTTCGG - Intronic
900444220 1:2671889-2671911 GTTGTGGGTGCTGCTCCGTTCGG - Intronic
900445541 1:2678753-2678775 GTTGTGGGTGCTGCTCTGTTCGG - Intronic
901093876 1:6662898-6662920 AATCTTGCTGCTGCTCACTCTGG + Intronic
901188218 1:7388606-7388628 CCTGTTGGTGTTGCTCTCTTTGG + Intronic
901384516 1:8898749-8898771 AATCTTGCTGCTGCTCACTCTGG + Intergenic
902625757 1:17675362-17675384 GATGTTGGTGATGCCCCCTCTGG + Intronic
903132179 1:21287098-21287120 GTTATTGGTGTTGATCACTTGGG + Intronic
903413031 1:23162310-23162332 GATCTAGGTGCTGCTTACATGGG + Intronic
906293364 1:44634188-44634210 TTTGTTGATGCTGCTCAGTTAGG + Intronic
908023572 1:59923969-59923991 GATCTTGGTGCTACTTTCTTTGG - Intronic
908114391 1:60926630-60926652 GATGTTACTGCTAATCACTTAGG - Intronic
911297944 1:96140443-96140465 AATCTTGCTGCTGCTCACTTTGG + Intergenic
912180994 1:107219514-107219536 GTTTTTGGTCCTTCTCACTTGGG + Intronic
917094961 1:171390797-171390819 AATGTTGCTGCTGCTCACTCTGG - Intergenic
918961252 1:191281051-191281073 GAGGTTGGTTCTGCTGTCTTTGG - Intergenic
920317747 1:205091070-205091092 AATGTCGCTTCTGCTCACTTTGG + Intronic
920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG + Exonic
921938632 1:220817341-220817363 AATCTTGCTACTGCTCACTTTGG - Exonic
1064602913 10:17011523-17011545 AATCTTGCTGCTGCTCACTCTGG - Intronic
1065549697 10:26858296-26858318 GTAGGTGGTGCTGCTGACTTTGG - Intronic
1065572512 10:27085776-27085798 GAGGTTGGTCCTGCTGTCTTGGG - Intronic
1066045019 10:31587294-31587316 AATCTTGCTGCTGCTCACTGTGG - Intergenic
1066259755 10:33717961-33717983 GATGCTGGTGCTGCTGGCCTAGG + Intergenic
1067841409 10:49682471-49682493 AATCTTGCTGCTGCTCACTTTGG - Intronic
1068460776 10:57325292-57325314 TATGCTGATGATGCTCACTTAGG - Intergenic
1068688099 10:59889746-59889768 GATGTGGGTGCTGCCCAAGTTGG - Intronic
1069526191 10:69174142-69174164 CATCTTGCTGCTGCTCACTCTGG + Intergenic
1071771944 10:88739010-88739032 GATGTTTCTGATGCTTACTTTGG + Intronic
1072182672 10:93002427-93002449 GATGCTATTGCTGCTCATTTGGG - Intronic
1075003828 10:118816773-118816795 CATGTTGGTGCAGCTGTCTTTGG + Intergenic
1075146965 10:119890729-119890751 AATCTTGCTGCTGCTCACTCTGG + Intronic
1076258830 10:129049989-129050011 GATTCTGGTGCTGCTTTCTTGGG - Intergenic
1078532755 11:12149663-12149685 CACGATGGTGCTGCTCACTGAGG + Intronic
1079522513 11:21345076-21345098 GCTGTAGGTGCTGCTGACTGTGG + Intronic
1080251627 11:30240156-30240178 GATGCTGCTGCTTCTCACTAGGG - Intergenic
1082682533 11:56193810-56193832 GATGTTGGTGCAGCTAATTAAGG - Intergenic
1083913804 11:65727054-65727076 GCTGCTGCTGCTGCCCACTTGGG - Intergenic
1085687851 11:78640011-78640033 AATCTTGCTGCTGCTCACTCTGG + Intergenic
1086269931 11:85050416-85050438 GATCTTGGTGATGCTTTCTTTGG - Intronic
1086946027 11:92844914-92844936 TCTGTCTGTGCTGCTCACTTAGG - Intronic
1091271183 11:134312985-134313007 GCTGGTGCTGCTGCTCACCTGGG + Intronic
1091701303 12:2665166-2665188 GATGCTGGTGGAGCTCACTCTGG - Intronic
1091937902 12:4447887-4447909 TATGCTGGTGGTCCTCACTTAGG + Intergenic
1092844580 12:12572192-12572214 GATGGTGGTGCTGCTTATTTTGG + Intergenic
1093954897 12:25204918-25204940 AATGTTGCTGCTGCTACCTTTGG + Exonic
1094345821 12:29467760-29467782 GATGGTGGTGTTCCACACTTAGG - Intronic
1095065128 12:37762684-37762706 GATGTTGGTGATGCACAGATGGG - Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095658518 12:44700088-44700110 GATGTTGGTGCTGCTCACTTAGG - Intronic
1096072474 12:48782942-48782964 GGTGCTGGTGCTGCTCACAGCGG - Exonic
1098170928 12:67746552-67746574 AATGTTTGTACTCCTCACTTAGG + Intergenic
1100803869 12:98261150-98261172 GATGTTGCTGCTGCTGGCCTGGG - Intergenic
1101069741 12:101062037-101062059 GATGTTGGTGATCTTCACCTGGG + Intronic
1102189821 12:110979179-110979201 GATGTGAGTGCTGGTCACATAGG - Intergenic
1106593796 13:31120240-31120262 CATGGTGGGGGTGCTCACTTGGG + Intergenic
1106686715 13:32067970-32067992 GATGCTGGTGCTGCTGCCCTGGG - Intronic
1109037558 13:57285690-57285712 AATCTTGCTGCTGCTCACTCTGG - Intergenic
1109516330 13:63447251-63447273 GATGTTGATGCTGCTGAATTGGG - Intergenic
1111710209 13:91802436-91802458 AATCTTGCTGCTGCTCACTTTGG - Intronic
1112278091 13:98039362-98039384 GATGTGAATGCTGCTCACTCAGG + Intergenic
1114747092 14:25160686-25160708 GATGTTGATGCAGCTGGCTTGGG + Intergenic
1115317142 14:32036749-32036771 GATATTGATGCTGCTGACTCAGG - Intergenic
1115674196 14:35651014-35651036 TAGGTCGGTGCTGCTCACTATGG - Intronic
1116305292 14:43246175-43246197 AATCTTGCTGCTGCTCACTCTGG + Intergenic
1118902077 14:69994448-69994470 TATGTTGGTGTTGTTCAGTTTGG - Exonic
1119004732 14:70913321-70913343 TATGGTGGAGCTGCTTACTTAGG + Intronic
1123905633 15:24917685-24917707 GATGTTGGTGCTGCTCTTCAGGG + Intronic
1124171517 15:27377738-27377760 GTAGATGGTGCTGCTCCCTTTGG - Intronic
1124173981 15:27404676-27404698 GATGTTGGATCTCCCCACTTGGG + Intronic
1129094953 15:73196710-73196732 GAAGTTGGTGCTTCTGAATTTGG - Intronic
1129382684 15:75178032-75178054 GGGGTTGGGGCTCCTCACTTAGG - Intergenic
1130883306 15:88073351-88073373 GATGCTGCTGCTGCTGACCTGGG - Intronic
1131076316 15:89496907-89496929 GATGTTGATGATGATGACTTAGG - Intergenic
1131198375 15:90375468-90375490 AATCTTGCTGCTGCTCACTCTGG + Intergenic
1131719157 15:95148390-95148412 AATCTTGCTGCTGCTCACTCTGG - Intergenic
1132242081 15:100265811-100265833 CATGTTGGTGCTGCTGCTTTGGG - Intronic
1134272230 16:12743026-12743048 GTTGTTGAAGCTGGTCACTTAGG + Intronic
1134887604 16:17807646-17807668 GATGTTCTTACTGCTCATTTGGG - Intergenic
1135338896 16:21629737-21629759 CAGGTTGGTGCTGCTGGCTTGGG + Intronic
1137236200 16:46620784-46620806 CAAGTTGGCGCTCCTCACTTTGG + Intronic
1140627202 16:76808344-76808366 GATGTTGATGCTGCTGAGCTAGG + Intergenic
1140933414 16:79649238-79649260 GATGTTGATGCTGCTAGTTTGGG - Intergenic
1142554057 17:760758-760780 GATGTTGGTTCTGTTTAGTTTGG + Intronic
1142879988 17:2876702-2876724 GATGTTGATGCTGGTCAGCTGGG + Intronic
1144390607 17:14790184-14790206 GATGTTGATGCTGCTTATCTGGG + Intergenic
1144471362 17:15545054-15545076 GATATTGTTGCTGCTGTCTTTGG - Intronic
1144925106 17:18799638-18799660 GATATTGTTGCTGCTGTCTTTGG + Intronic
1145902545 17:28497972-28497994 GATGTCAGTGCTGCTCTCCTAGG - Intronic
1148329464 17:46804931-46804953 GGGGTTGGTGCTGCTGGCTTGGG - Intronic
1149977818 17:61284306-61284328 AATCTTGCTGCTGCTCACTCTGG + Intronic
1152558798 17:81067699-81067721 GGCGTTGCTGCTGCTCCCTTTGG + Intronic
1152881862 17:82822030-82822052 GATGTTGCTGCAGCTGCCTTGGG + Intronic
1153308658 18:3655860-3655882 CATGTTGGTGCTGCCCTCTCAGG + Intronic
1153927700 18:9848956-9848978 GATTTAGGTGCTGCTCTGTTTGG + Intronic
1157179023 18:45478979-45479001 GGTGTTGGTTCTGCCCTCTTTGG + Intronic
1158613093 18:58961230-58961252 GATGCTGATGCTGCTCATCTTGG + Intronic
1159249929 18:65862762-65862784 GGTGTTGGTGCTGCTAAGTGAGG - Exonic
1159344511 18:67182796-67182818 TATGTTGATGCAGCTGACTTGGG + Intergenic
1164281628 19:23774077-23774099 TGTGTTGGTGCTGCTCACAGGGG + Intronic
1166404479 19:42509968-42509990 GATTTGGGTGCTGCTTACCTGGG + Intronic
1168486187 19:56764469-56764491 GATGTCAGTGCTGCTAACTGAGG - Intergenic
1168666172 19:58206889-58206911 GCTGTTGGACCTGCTCACTGGGG - Exonic
926764753 2:16314551-16314573 GATGTTGGTGAAGCTCCCTAGGG + Intergenic
927843224 2:26458096-26458118 GCTGTTGGGGCTGCTCATGTTGG - Exonic
928326669 2:30324684-30324706 GATGTTTGTTCTTCTCACTATGG + Intergenic
928878321 2:36067305-36067327 GATATTGGTGCTGATAACATAGG + Intergenic
933581115 2:84128125-84128147 AATCTTGCTGCTGCTCACTCTGG + Intergenic
935094751 2:99933932-99933954 GATGGTCGTGGTGCTCAGTTGGG - Intronic
935346020 2:102109246-102109268 GATGTTTGTGCTGTTTATTTGGG + Intronic
937119167 2:119430261-119430283 GATGTTGGTGCTGCTGGCCTGGG - Intronic
937292621 2:120790687-120790709 CTTGTTGGTGCTGCTCTCTGGGG + Intronic
938242650 2:129755250-129755272 GGTGTAGCTGCTGCTCTCTTAGG + Intergenic
941884877 2:170517613-170517635 GCTCTTGGTGCTGCTGATTTGGG + Intronic
942392955 2:175515182-175515204 GATGGTGGTGCTTGTCACTGAGG + Intergenic
943064568 2:183072349-183072371 GAAGCTGCTGCTGCCCACTTGGG + Intergenic
944467073 2:200012905-200012927 GAGGTGGGTGCTGCTCTTTTAGG - Intergenic
945069763 2:205978072-205978094 AATGTTGCTACTGCTCACTCTGG + Intergenic
946704356 2:222443677-222443699 GGTTTTGGTGCTGTTGACTTAGG + Intronic
947101776 2:226628786-226628808 GATGTTGATGTTGCTCATCTGGG - Intergenic
947325462 2:228970555-228970577 GATTTTGGTACTTCTGACTTGGG + Intronic
947716237 2:232340269-232340291 GCTGTTGCTGCTGCTGGCTTTGG - Intronic
948348887 2:237322251-237322273 GCTGTGTGTGCTGCTAACTTAGG - Intergenic
1172289970 20:33769265-33769287 GATGCTGGTGCTGCTGGCCTGGG - Intronic
1173227954 20:41172875-41172897 GAGGTGGGTGCTGCTCATCTGGG + Exonic
1173292601 20:41727692-41727714 AATCTTGCTGCTGCTCACTCTGG - Intergenic
1175547150 20:59785736-59785758 GATGCTGGTGCTGCTGACCACGG - Intronic
1176694519 21:9958689-9958711 GCTGTTGTTGCTACTCACTACGG - Intergenic
1179146878 21:38775774-38775796 GAGTATGATGCTGCTCACTTTGG + Intergenic
1182799132 22:33016387-33016409 AATGTTGCTGCTGCTACCTTTGG + Intronic
1185228948 22:49669325-49669347 AATCTTGCTGCTGCTCACTCTGG - Intergenic
1185420937 22:50734037-50734059 CAAGTTGGTGCTTCTCACCTTGG + Intergenic
949746188 3:7294713-7294735 GATGCTGATGCTGCTAGCTTAGG - Intronic
950254222 3:11491622-11491644 GATGTTGGTGATGTACAGTTGGG + Intronic
950876321 3:16277765-16277787 GATGTTTATGCTTCTTACTTGGG + Intronic
951628309 3:24690995-24691017 GATATGGGTGGTGCTCACATGGG - Intergenic
951908255 3:27724015-27724037 GATGTTGGTGCTGCTGTGGTTGG - Intergenic
954772369 3:52983147-52983169 GAGGTTGGTGTTGCTGTCTTAGG - Intronic
955639733 3:61069296-61069318 TAGGTTGGTGCTTCTCAATTTGG + Intronic
956129646 3:66040805-66040827 GATGTTGATGCTTCTCTCTTGGG + Intergenic
956920102 3:73919108-73919130 GATGCTGATGCTGCTAATTTGGG + Intergenic
958208465 3:90435807-90435829 GATGTTGGTGATGTTCAGATGGG + Intergenic
960595240 3:119402248-119402270 GCTGTTGGTGCTGATGACTGCGG - Exonic
963041637 3:141074702-141074724 GGTGAAGGTGCTGCTCATTTGGG - Intronic
963631847 3:147742749-147742771 GAAGTTGGTGGTGCTCACCAAGG - Intergenic
964119489 3:153167813-153167835 AATGTTGATTCTGATCACTTAGG - Intergenic
964802753 3:160573455-160573477 AATCTTGCTGCTGCTCACTCTGG - Intergenic
965139940 3:164819339-164819361 AATCTTGCTGCTGCTCACTCTGG + Intergenic
965605635 3:170495556-170495578 GAAGCTGCTGCTGCTCACTCGGG - Intronic
970166099 4:13240160-13240182 GATCTTGGTGCTGGCCAATTTGG - Intergenic
974226045 4:59046422-59046444 GATGTTGGTGCTGTTGCTTTAGG + Intergenic
974509752 4:62823395-62823417 AATCTTGCTGCTGCTCACTTTGG - Intergenic
976520465 4:86020841-86020863 GATGTTGCTACTGCTCACTCTGG - Intronic
979506340 4:121502149-121502171 GATGTTGGCCTTGATCACTTGGG + Intergenic
980075920 4:128292639-128292661 GAAGTTGGTACTGATTACTTTGG + Intergenic
980264298 4:130495093-130495115 GATGTTGGTGGTGTGCTCTTGGG - Intergenic
981586559 4:146309516-146309538 GATGCTGCTGCTGCTGACTTGGG + Intronic
982024419 4:151236976-151236998 CATGTTGCTGCTGCTGGCTTGGG - Intronic
984198101 4:176684479-176684501 GAGGGTGGGGCTGCTCACTGAGG - Intronic
984324258 4:178231431-178231453 AATCTTGCTGCTGCTCACTCTGG + Intergenic
988286820 5:29229339-29229361 TATGTTGATTCTGCTAACTTAGG - Intergenic
988357493 5:30197975-30197997 CAGGTTGCTGCTGCTCACTGGGG - Intergenic
989069529 5:37496307-37496329 AATCTTGCTGCTGCTCACTCTGG + Intronic
989260983 5:39420102-39420124 GATGTTGATGCTGCTGGTTTGGG + Intronic
989607449 5:43258019-43258041 GATGTTGGTGGTGCTTCCATGGG - Intronic
989721242 5:44531062-44531084 AATCTGGCTGCTGCTCACTTTGG + Intergenic
989750117 5:44883507-44883529 CAGGTTGCTGCTGCTCACTTGGG + Intergenic
990056783 5:51591681-51591703 CTTGTTGAAGCTGCTCACTTTGG + Intergenic
991172549 5:63645750-63645772 GATATTGATGCTGCTGACTGGGG + Intergenic
992233474 5:74685335-74685357 GATGTTGGCGCTGCTGACTCAGG + Exonic
993972813 5:94441193-94441215 GATGTTGATGCTGCTGGTTTGGG - Intronic
994207281 5:97049504-97049526 GATCTTGGAGCTTCTCCCTTAGG - Intergenic
994207913 5:97056609-97056631 GATGTTGGTGCTGATGAGTTAGG - Intergenic
994713433 5:103293917-103293939 AATGTTTGTTCTGCTCACTGTGG + Intergenic
995806627 5:116059921-116059943 GATGTTGATGCTGCTGATGTGGG + Exonic
996211674 5:120818400-120818422 AATCTTGCTGCTGCTCACTCTGG + Intergenic
996588578 5:125119646-125119668 GATGTTTATGCCGCTCACCTGGG + Intergenic
997844949 5:137277847-137277869 GCTCTTGGGGCTGCTCTCTTTGG - Intronic
999032385 5:148308078-148308100 GATGTTGGTGGTGTGCTCTTGGG - Intergenic
999091393 5:148939347-148939369 GATGCTGTTGCTGCTGATTTGGG - Intronic
1001083307 5:168682518-168682540 GATGCTGGTGCTGCTGCCTTGGG + Intronic
1003855915 6:10274564-10274586 GTTGTTGTTGCTGTTCAGTTTGG - Intergenic
1005282888 6:24293432-24293454 GATTTGGTTGCTGCTCTCTTGGG - Intronic
1006088569 6:31614456-31614478 GATGGTGGTGCTGGTCACTGTGG - Intergenic
1006185608 6:32180054-32180076 GGTGTTGGTGCTTTTCCCTTTGG + Exonic
1006498280 6:34439943-34439965 AATCTTGCTGCTGCTCACTCTGG + Intergenic
1008230692 6:48982913-48982935 AATCTTGCTGCTGCTCACTCTGG - Intergenic
1010190838 6:73194833-73194855 GTTGTTGGGGCTGCTGGCTTGGG - Exonic
1011882137 6:92042208-92042230 GATGTTGATGCTGCTGATTTGGG - Intergenic
1016132792 6:140497645-140497667 AATGTTGTAGCTGCCCACTTTGG + Intergenic
1016941722 6:149487859-149487881 GCAGTTGGTGCTGCCCACTGTGG - Intergenic
1017358650 6:153540935-153540957 GCTGCTTGTGCTGCTAACTTGGG - Intergenic
1017876118 6:158525499-158525521 GATGTTGGTGCAGCTGCCTGTGG + Intergenic
1020013808 7:4819906-4819928 GCTGTTGGAGCTGCTGCCTTTGG - Intronic
1020375071 7:7476278-7476300 GTTGTTGATGCTGCTCATTTTGG + Intronic
1020422013 7:8017554-8017576 GATGATGCTGCTGCTCATTTGGG + Intronic
1021458364 7:20856689-20856711 GTTTTTGTTGCTACTCACTTTGG + Intergenic
1022216313 7:28265661-28265683 GATGTTGATGCTGCTGATCTAGG + Intergenic
1023289520 7:38655320-38655342 GAAGCTGGTGCTGCCCACTCGGG - Intergenic
1028038093 7:86011136-86011158 GAAGATGATGCTGCTTACTTAGG + Intergenic
1030256803 7:107518630-107518652 AATCTTGGTGCTCCTCTCTTGGG - Intronic
1031341117 7:120603359-120603381 CATGTAGGTGCAGCCCACTTGGG - Intronic
1032852070 7:135803677-135803699 GATGTTTGTAATCCTCACTTGGG + Intergenic
1033476527 7:141698443-141698465 GATGGTGGTGCTGATCATCTGGG - Intronic
1033516661 7:142113409-142113431 CCTGTTTGTGCTGGTCACTTGGG + Intronic
1033586944 7:142781066-142781088 GATTTTGGTGTTGCTGGCTTAGG - Intergenic
1034398637 7:150846784-150846806 GAGGTTGGGGCTGGTCACGTAGG + Intronic
1035425513 7:158769478-158769500 GATGTGGATGCTGCTCCCCTAGG + Intronic
1038703128 8:29869848-29869870 GATGTTGGTGATGCTGACTGTGG - Intergenic
1039068892 8:33632702-33632724 AATCTTGCTACTGCTCACTTTGG + Intergenic
1039572782 8:38600809-38600831 GGTGTTGGTGCTTTTCCCTTTGG - Intergenic
1040419056 8:47222164-47222186 GATGTTGGTGATGATGACCTTGG - Intergenic
1041588518 8:59548130-59548152 AATCTTGCTGCTGCTCACTCTGG + Intergenic
1042222404 8:66486505-66486527 GATGCTGATGCTGCTCTCTGGGG + Intronic
1042827733 8:72995454-72995476 GATGTTGGTCCTACCTACTTGGG - Intergenic
1044413785 8:91913341-91913363 AATCTTGCTGCTGCTCACTCTGG - Intergenic
1045437215 8:102175245-102175267 GATTTTGGTGCTTCTCTCTACGG - Intergenic
1045565354 8:103309207-103309229 GATGCTGATGCTGCTCACTCAGG + Intronic
1047969081 8:130069640-130069662 GATCTTTGTTGTGCTCACTTCGG - Intronic
1049228428 8:141469343-141469365 GATGTTGGTGGTGATGACTGTGG + Intergenic
1049701017 8:144012590-144012612 GAAGTTGGTGCGGCTCATTCGGG + Exonic
1049832655 8:144712184-144712206 AATGTTGCTGCTACTCACTCTGG - Intergenic
1050516982 9:6454974-6454996 GATGTTGATGCTGCTGATCTTGG + Intronic
1051341981 9:16120488-16120510 GTTGTTGGATCTGCTCAGTTAGG - Intergenic
1051774304 9:20618714-20618736 CATGAGGGTGCTGCTCACATAGG - Intronic
1051871617 9:21744465-21744487 GATGCTGATGCTGCTGGCTTGGG - Intergenic
1054312589 9:63542763-63542785 GCTGTTGTTGCTACTCACTACGG - Intergenic
1055331413 9:75187790-75187812 GATGCTAGTGCTGCTGATTTGGG + Intergenic
1056737623 9:89223253-89223275 CACGTGGCTGCTGCTCACTTTGG - Intergenic
1058424271 9:104862807-104862829 GATGCTGATGCTGCTGACCTGGG + Intronic
1059488754 9:114648883-114648905 CATGTTGATGTTGCTCAGTTTGG + Intergenic
1060656863 9:125378001-125378023 GCTGTAGCTGCTGCTCCCTTAGG + Intergenic
1061516571 9:131093559-131093581 GATGTTGGAGCTGCTCAGTCAGG + Intronic
1185808657 X:3084274-3084296 GATGGTGGCACTGGTCACTTCGG - Exonic
1187638090 X:21255520-21255542 GATGTTGATGCTGCTTGTTTTGG - Intergenic
1187904173 X:24050795-24050817 AATGTTGCTACTGCTCACTCTGG + Intergenic
1188189327 X:27155703-27155725 GATGTTGATGCTGCTAGTTTGGG - Intergenic
1191808636 X:65162917-65162939 GATGATGGTGATGCACACATGGG + Intergenic
1193615898 X:83688065-83688087 GATGTTGGTGAAGTTCACATGGG + Intergenic
1193720109 X:84975695-84975717 TATCTTGCTGCTGCTCACTCTGG + Intergenic
1197078881 X:122388511-122388533 AATCTTGCTGCTGCTCACTCTGG - Intergenic
1199189151 X:144950415-144950437 GCTGTTGGTGCTGATTACTCAGG - Intergenic
1199394641 X:147320883-147320905 GATGTTGGTGCTGCTAGTTGAGG + Intergenic
1200880233 Y:8205108-8205130 AATCTTGCTGCTGCTCACTCTGG - Intergenic