ID: 1095663462

View in Genome Browser
Species Human (GRCh38)
Location 12:44765814-44765836
Sequence GACTCATTTCAGTTTAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095663462_1095663467 26 Left 1095663462 12:44765814-44765836 CCATCTTTAAACTGAAATGAGTC 0: 1
1: 0
2: 1
3: 24
4: 192
Right 1095663467 12:44765863-44765885 GCCTGTAATCTGAGCACTTTGGG 0: 248
1: 13980
2: 254667
3: 280135
4: 172728
1095663462_1095663466 25 Left 1095663462 12:44765814-44765836 CCATCTTTAAACTGAAATGAGTC 0: 1
1: 0
2: 1
3: 24
4: 192
Right 1095663466 12:44765862-44765884 CGCCTGTAATCTGAGCACTTTGG 0: 103
1: 6683
2: 150060
3: 296460
4: 215179
1095663462_1095663469 29 Left 1095663462 12:44765814-44765836 CCATCTTTAAACTGAAATGAGTC 0: 1
1: 0
2: 1
3: 24
4: 192
Right 1095663469 12:44765866-44765888 TGTAATCTGAGCACTTTGGGAGG 0: 354
1: 19631
2: 334924
3: 260601
4: 136769
1095663462_1095663465 -2 Left 1095663462 12:44765814-44765836 CCATCTTTAAACTGAAATGAGTC 0: 1
1: 0
2: 1
3: 24
4: 192
Right 1095663465 12:44765835-44765857 TCTGAATTGGCAGGATGCAGTGG 0: 1
1: 0
2: 2
3: 43
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095663462 Original CRISPR GACTCATTTCAGTTTAAAGA TGG (reversed) Intronic
900655757 1:3756028-3756050 CCCTCCTCTCAGTTTAAAGATGG + Intronic
902157121 1:14497554-14497576 AATTTATTTCAGTTTAAAGTTGG + Intergenic
903470393 1:23582857-23582879 TACTCATTTCATTTTCTAGATGG + Intronic
904462940 1:30691214-30691236 GAATCATTTCAGGTTGAACATGG - Intergenic
905616846 1:39407509-39407531 CACCCCTTTCAGTTTACAGATGG + Intronic
907096649 1:51787608-51787630 AACTCATTTCAGTCTAATGGCGG + Intronic
908365312 1:63416692-63416714 GACTTGTGTCAGTTTGAAGATGG + Intronic
909427072 1:75537604-75537626 GACACAGTTCAGTTTGATGATGG - Intronic
910538513 1:88327799-88327821 GACTCTGCTCAGTTTAATGAAGG + Intergenic
911430537 1:97780695-97780717 GCTTCTTTTCAGTTAAAAGAAGG - Intronic
912011770 1:104974897-104974919 GACTCATTTAGTTTTAAACATGG + Intergenic
913722115 1:121607229-121607251 AACTCATTCCATTTTAAAGAAGG - Intergenic
913741900 1:121854809-121854831 AACTCATTCCATTTTAAAGAAGG - Intergenic
914204893 1:145518315-145518337 GGCTCTTTCCAGTTCAAAGAAGG - Intergenic
914370675 1:147021912-147021934 GGCTCTTTCCAGTTCAAAGAAGG + Intergenic
917180707 1:172294237-172294259 GAGTCATTTCAATTAAAAGAGGG - Intronic
917241277 1:172951238-172951260 AACTCATTTAAGGTTAAAAAAGG - Intergenic
917346232 1:174030781-174030803 GACTCACTTCACCTTAAAGCAGG + Intergenic
917824760 1:178806918-178806940 AACTGATTTCCTTTTAAAGAAGG - Intronic
918819252 1:189230020-189230042 GGCTCCTTTCTGTTTCAAGAGGG - Intergenic
919117780 1:193302564-193302586 GATTCATGTTAGTTTAAACAAGG + Intergenic
920412764 1:205775040-205775062 GCCTCACTTCAGTTTGAAGAGGG - Exonic
1063086768 10:2826561-2826583 AATTTATTTCAGTTTAAACAAGG - Intergenic
1063953045 10:11242217-11242239 AACCCATTTCAGGTTAAAAATGG + Intronic
1064017659 10:11785086-11785108 GACACAATTCAGTCTATAGAAGG + Intergenic
1064215023 10:13393061-13393083 TTCTGATTTCAGTATAAAGAAGG + Intergenic
1067399992 10:45963224-45963246 GACTCATTTCTGTTTTGAGAAGG - Intergenic
1067868323 10:49932513-49932535 GACTCATTTCTGTTTTGAGAAGG - Intronic
1068322247 10:55434408-55434430 AACTCATTTCAATATAAATATGG - Intronic
1068571012 10:58629236-58629258 GAATCAATGCAGTTTAAAGCTGG + Intronic
1069027598 10:63560622-63560644 GCCTCATTTCCGTCTAAAGAGGG - Intronic
1070285601 10:75081268-75081290 GACTGAGTTCAGTTTTAGGAAGG + Intergenic
1072084214 10:92062514-92062536 AATTCATTTCAGTTTTAATAAGG - Intronic
1072308526 10:94131725-94131747 TCCTCATTTCAGTTTAAGCATGG + Intronic
1073307345 10:102513863-102513885 AATTCATATCAGTTTAAAAAAGG - Intronic
1073857952 10:107699037-107699059 GAATCATTTCAGTTTTAGGATGG - Intergenic
1077929373 11:6714486-6714508 TACACATTTCATTTTAAACATGG + Intergenic
1078920527 11:15826388-15826410 GAATCCTGTCTGTTTAAAGAAGG + Intergenic
1080071700 11:28096698-28096720 GATTCATTTCAGTTTTATCATGG - Intronic
1083180594 11:60982325-60982347 GACTCTGTTCATTTTACAGAAGG + Intronic
1085381022 11:76118733-76118755 GTCTCATTTCAGTTTGCAGATGG - Intronic
1086518057 11:87637060-87637082 AACTAATTTGACTTTAAAGATGG - Intergenic
1086542855 11:87933439-87933461 GACTCAGTGCAGTTTAAAAATGG + Intergenic
1086567942 11:88248395-88248417 CTCACATTTCAATTTAAAGATGG + Intergenic
1086722050 11:90133349-90133371 GAAGCATTTCTCTTTAAAGATGG - Intronic
1088067562 11:105739133-105739155 GATTCCATTCAGTGTAAAGACGG - Intronic
1089400261 11:118160367-118160389 GACTCATGTCAGTTTGCATATGG - Intergenic
1089569464 11:119394357-119394379 GATTCAATCCAGTTTATAGATGG + Intergenic
1089823964 11:121255588-121255610 AACTCAATTCATTTAAAAGAAGG + Intergenic
1089936901 11:122373958-122373980 GAATCATTTCAGTGTAGTGATGG - Intergenic
1090623244 11:128580824-128580846 GACTCATTTCCATTTAAGCAAGG - Intronic
1092995644 12:13947935-13947957 GAACAATTTCAGTTTAAAAATGG - Intronic
1094081554 12:26541605-26541627 TACTCATTTCAGTTTCTAGCAGG - Intronic
1095493963 12:42765368-42765390 AACTCATTTTAATTTAAAAAGGG + Intergenic
1095663462 12:44765814-44765836 GACTCATTTCAGTTTAAAGATGG - Intronic
1095893746 12:47259475-47259497 GTCTATTTTCAGATTAAAGATGG + Intergenic
1099554129 12:84088924-84088946 GAATTATTTCTGTTTACAGATGG - Intergenic
1105538318 13:21291040-21291062 CAGTCATTTCAGTTTAGGGAGGG + Intergenic
1107383347 13:39880289-39880311 TACTTATTCCACTTTAAAGATGG - Intergenic
1109923776 13:69106583-69106605 GACTCATTTCAATTGGGAGAAGG + Intergenic
1113175842 13:107562953-107562975 TACTCATGTAAGTTTTAAGAAGG - Intronic
1113192210 13:107761680-107761702 GAGTGATTTCATTTCAAAGATGG - Intronic
1114723803 14:24911861-24911883 GGCTGATTTCAATTTAAAAAAGG - Intronic
1115102779 14:29723204-29723226 GACTCATTTCCATTTAAGTATGG - Intronic
1115402275 14:32975485-32975507 GACTCCTTTCAGTTTCTAGAAGG + Intronic
1116006999 14:39304279-39304301 GAAGCATTTAACTTTAAAGAAGG - Exonic
1118037234 14:61881233-61881255 GAGTGATTTCAGATTTAAGATGG - Intergenic
1121790409 14:96695404-96695426 CACTCTTTTCATTTTGAAGAGGG + Intergenic
1124674574 15:31673135-31673157 GACTTATTTCAGCTTTAAGATGG - Intronic
1127642052 15:60925357-60925379 GTCTCCTTTCAGTTTGAATATGG - Intronic
1129157406 15:73727356-73727378 GACTCAGTTCAGATCAAGGAAGG - Intergenic
1130001629 15:80052893-80052915 GACAAATTTCAGTTTAACAAGGG + Intergenic
1133563452 16:6970765-6970787 GACCCAATTCAGGTTAAAGGGGG - Intronic
1137819922 16:51434533-51434555 GACTCACAACACTTTAAAGAGGG - Intergenic
1139600040 16:67980885-67980907 ATCTCATTTCAGTTTTGAGACGG + Intergenic
1139685717 16:68602107-68602129 AAGCTATTTCAGTTTAAAGAAGG + Intergenic
1140603685 16:76508466-76508488 CAATCATTTCAGTTTAATAAAGG - Intronic
1145761216 17:27426280-27426302 CACTCATTTCAGTGGAGAGAGGG - Intergenic
1146161259 17:30560437-30560459 CACTCATTTCAGTGCAGAGAGGG - Intronic
1146960917 17:36977782-36977804 TACTCTTTTCTGTTTAAAGGGGG + Intronic
1146980465 17:37156360-37156382 GCCTCATTTCATTTTCAACAGGG + Intronic
1149138773 17:53404039-53404061 GACTCATTAAAGTTTTATGAGGG - Intergenic
1152446059 17:80344876-80344898 GACACGTTTCAGTATCAAGAAGG + Exonic
1155214098 18:23627550-23627572 GACTCATTTTAGGTTTAAGTGGG + Intronic
1156591696 18:38497004-38497026 GAATCATTTCAGTCAAAATATGG - Intergenic
1156628016 18:38933176-38933198 GAATCATTTCAGTAAATAGAAGG - Intergenic
1156765761 18:40653056-40653078 GACTCAATTTAGTTTTCAGATGG - Intergenic
1159644733 18:70904171-70904193 GTCTCATTTAATCTTAAAGAAGG - Intergenic
1161422572 19:4184043-4184065 GACTGATTTCAGTTTCTGGAAGG - Intronic
1162137583 19:8565193-8565215 GGCTCATTTCATTTTCAAGATGG + Intronic
1162394397 19:10408333-10408355 TTTTCATTTCATTTTAAAGACGG + Intronic
1162512459 19:11127807-11127829 GACTCAATTCCGGTTTAAGAAGG - Intronic
1164263497 19:23591495-23591517 GTCTTATTTCAGTTCACAGAGGG - Intronic
1167823025 19:51947262-51947284 GACTCATTTCTGTCATAAGAGGG + Intronic
1168635615 19:57994108-57994130 GAGTGATTTCAGTATAAAGTGGG + Intronic
928117038 2:28552916-28552938 GTCTCATTTCAGGTAAGAGAAGG + Exonic
929362047 2:41103604-41103626 CAATCATTTCAGTTGAAAGGAGG + Intergenic
937042126 2:118830761-118830783 AACTCACTTCATTTTAAAAAAGG + Intergenic
937115927 2:119404933-119404955 GACCCAAATCAGTATAAAGAGGG + Intergenic
938589381 2:132722031-132722053 GACTCACTTCATTTTGCAGAAGG + Intronic
940102726 2:150060495-150060517 TATTCATTTCAGTTTAGGGAAGG - Intergenic
942343065 2:174970298-174970320 TAGTCATTTCACTTGAAAGAAGG + Intronic
942361486 2:175177048-175177070 GCCTCATTTCACTTTACAGAAGG + Exonic
942570231 2:177306712-177306734 GACTCACTTCAGTTTTTGGAAGG - Intronic
943917469 2:193654811-193654833 GACTCTTTTCACCTTAAACATGG + Intergenic
944956635 2:204819851-204819873 GACTCTCTTCAGTTTAACGAAGG + Intronic
947360928 2:229344595-229344617 TACTCTTTTCACTTTACAGATGG - Intergenic
947934494 2:233992172-233992194 GACTCATTCCAGAATAAATAAGG - Intronic
948798164 2:240416843-240416865 GATTCAATCCAGTTTATAGATGG - Intergenic
1169179109 20:3546726-3546748 TACTCATTTCAGATGGAAGAAGG - Intronic
1169905660 20:10600735-10600757 GACCAATTTCTTTTTAAAGATGG - Intronic
1170120260 20:12903819-12903841 GAGTCATTTAAGTTTGAAAAAGG + Intergenic
1175772172 20:61630755-61630777 GAGTCATTTCAGTTTCAAATGGG - Intronic
1176877036 21:14141411-14141433 AACTGATTGCAGTTAAAAGAAGG - Intronic
1177453432 21:21302401-21302423 GAATCATTTCAGCTTCAACAAGG - Intronic
1177580276 21:23013314-23013336 GATTGTTTTCAGTTTAAAGCTGG - Intergenic
1177963169 21:27694695-27694717 AACACATTTCAGTTTTAAGGGGG - Intergenic
1178027537 21:28485266-28485288 GACTAAAATCAGTTTCAAGATGG + Intergenic
1178163416 21:29945020-29945042 GACTCATCACAGGCTAAAGAAGG + Intergenic
950201565 3:11048259-11048281 GCCTCATTAGACTTTAAAGAGGG + Intergenic
951188893 3:19746485-19746507 CATTCATTACAGTTTAAATATGG - Intergenic
953061537 3:39432217-39432239 GACACCTTTCATTTTAAAGAAGG + Intergenic
953488988 3:43331566-43331588 GACACATTTCAGCTAAAAAATGG - Intronic
955951586 3:64248091-64248113 AACACATTTCAGTTTTAAAAAGG + Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956619864 3:71211084-71211106 TACTCTTTTCTGTTTGAAGATGG + Intronic
957472140 3:80671864-80671886 GACTCACCTCAGGTTAAAGGAGG + Intergenic
957579720 3:82055362-82055384 GAATCATTTGAGTATAAATAAGG - Intergenic
957831908 3:85532264-85532286 GAATTATTTCAGTTTGAGGAGGG - Intronic
957963899 3:87296975-87296997 TACTCCTTTCATTTTAAAGAAGG + Intergenic
958457549 3:94350400-94350422 GTATCATTGCTGTTTAAAGAAGG - Intergenic
960312992 3:116139823-116139845 GACTCATTTCAGTATAGAGAGGG + Intronic
961925613 3:130476394-130476416 GACACATTTCAGTTTATAGCAGG + Intronic
963028080 3:140939878-140939900 TACTCTTTTCAGTTAAGAGAAGG + Intergenic
963526282 3:146418508-146418530 GAGGCATTTCTGTTCAAAGAGGG + Intronic
964064913 3:152565417-152565439 CACTCATTTCAGATTCAATATGG + Intergenic
967331263 3:188292055-188292077 GACTCATTGCTGTTTAAACTTGG - Intronic
967494478 3:190127616-190127638 GACTCATTTCAGAGGAAATAGGG - Intergenic
971061129 4:22971145-22971167 GATTGATTTTAGTTTAAATAGGG - Intergenic
973056487 4:45665788-45665810 GACTAATTTCAGTTAAGAGAGGG + Intergenic
973557155 4:52095268-52095290 GAATCATTTTAGTTTGCAGATGG + Exonic
974425432 4:61736911-61736933 GACTTATTGCAGTTTAGAGGTGG + Intronic
975089367 4:70383142-70383164 GACTCTTGCCAGTTGAAAGACGG - Exonic
979707865 4:123742546-123742568 GAAAAATTTCAATTTAAAGATGG + Intergenic
979814539 4:125084296-125084318 GACGTATTTCAGGTTAAATAAGG - Intergenic
980092893 4:128460651-128460673 CACTCATTTCTGTTAAAAGATGG - Intergenic
980483236 4:133417233-133417255 GACTCATTTCTGTGATAAGAAGG - Intergenic
981115555 4:140986362-140986384 GACTTATTTAAGTTTAGAAATGG + Intronic
982578718 4:157151038-157151060 GAATAATTTCAGATTATAGAAGG - Intronic
983773354 4:171577028-171577050 GATTCAATTCAGTTTACAGTTGG + Intergenic
984275536 4:177605820-177605842 TATTCATTTTAGTTTAAAAATGG + Intergenic
984434624 4:179693520-179693542 TACTCATTTCTCTTTTAAGAAGG - Intergenic
984711298 4:182887600-182887622 AACTCATTTTAATTTAATGAAGG + Intergenic
985300520 4:188483772-188483794 GTCTCCCTTCAGTTTAAATATGG + Intergenic
987195829 5:15525103-15525125 CACTCTTCTCATTTTAAAGATGG - Intronic
987353703 5:17043893-17043915 GACTCAGCTGAGTGTAAAGATGG - Intergenic
988113305 5:26851453-26851475 CACTAATTTCAGAATAAAGAAGG - Intergenic
988521759 5:31952153-31952175 TACTGTTTTCAGTTTAAAGTTGG + Intronic
988950385 5:36252508-36252530 GAATAAAATCAGTTTAAAGAAGG + Intronic
990137202 5:52660462-52660484 CACTCATTTCACTTCAAAGCTGG + Intergenic
991302956 5:65146680-65146702 GACTTATTACTTTTTAAAGAAGG - Intergenic
993397527 5:87408898-87408920 TACTCATTTCAGTTGAACAAAGG - Intronic
993536379 5:89091922-89091944 TACACATTTGATTTTAAAGAAGG + Intergenic
993566698 5:89485223-89485245 GACTCATTTCACTGTCATGATGG + Intergenic
996566758 5:124887961-124887983 GTCTCATTTAAGTTTACAGTGGG + Intergenic
996584558 5:125070291-125070313 GACTATTTTCAGTTTGAAGCTGG + Intergenic
998276313 5:140757328-140757350 GAACCATTTCAGATTAAATAGGG - Intergenic
999186628 5:149715474-149715496 GAATCATTTCAGTTAAAGGATGG - Intergenic
999703662 5:154251246-154251268 CACTCTTTTCATTTTAAAAATGG + Intronic
999768682 5:154758039-154758061 TACCCTTTTGAGTTTAAAGAGGG - Intronic
1005801850 6:29433449-29433471 GACTTATTTCAGTTAATATAAGG + Intronic
1006482323 6:34306589-34306611 GACTCATTTCATTTCGCAGAAGG + Intronic
1008323217 6:50143696-50143718 AACTCATTTCCTTTTAAATATGG - Intergenic
1008741329 6:54612562-54612584 AACTCAGTTGAGTTTAAAAATGG + Intergenic
1009586505 6:65613067-65613089 GAGGCATCTCAGTTTATAGATGG + Intronic
1010045630 6:71439963-71439985 GTCTCATTTCAGTTCTCAGAGGG - Intergenic
1011572175 6:88750024-88750046 GACTCATGTCCTTATAAAGAAGG - Intronic
1012449771 6:99342933-99342955 ATCTCCTTTCTGTTTAAAGATGG - Exonic
1015279248 6:131415527-131415549 GACTAATTTTAGTCAAAAGAGGG - Intergenic
1015865761 6:137724910-137724932 GACTCATTCCATTTGGAAGATGG - Intergenic
1016311795 6:142741324-142741346 TACTCATTCCACTTTAAACAAGG - Intergenic
1021939007 7:25660796-25660818 GACTCAATTCTGTTAAAAGTTGG - Intergenic
1024100915 7:46031849-46031871 GTCTCATTACAGTTTACAAAAGG - Intergenic
1026266166 7:68797757-68797779 GGCTCATCCCAGTTTACAGATGG - Intergenic
1030186879 7:106771642-106771664 GACTTATTTATGTTAAAAGATGG + Intergenic
1030766778 7:113420173-113420195 AACACATTTCAGTTAAATGATGG + Intergenic
1032773062 7:135079154-135079176 GAATCATTTCACTTAAGAGATGG + Intronic
1039686064 8:39802486-39802508 GATTCAGTTCAGTTTATAGGTGG - Intronic
1040746084 8:50643988-50644010 GACTCATTTACTTTCAAAGATGG - Intronic
1040901230 8:52419035-52419057 TCCTCATATCAGTTTTAAGATGG - Intronic
1043052693 8:75403684-75403706 GAGTAAGTTCAGTTTAAGGAAGG - Intergenic
1043790588 8:84462966-84462988 GACTAATATCTGTTTAAAAATGG - Intronic
1043910446 8:85857911-85857933 GACTGATTTCAATTTAAGGAAGG + Intergenic
1044398870 8:91746264-91746286 CACTCATTTCATTTTAATCAGGG + Intergenic
1044959248 8:97514458-97514480 AACTCATTTTACTTGAAAGAAGG - Intergenic
1047886155 8:129252338-129252360 GATTCCTTTCAGTCTACAGATGG - Intergenic
1050286113 9:4104065-4104087 TACTCATTTCACTTTAAATTAGG + Intronic
1051010930 9:12413327-12413349 GACTTTTGTCAGTTTAAAAAAGG + Intergenic
1051432181 9:16990913-16990935 AACTTATTTCAGTTTACTGAAGG + Intergenic
1053335423 9:37266126-37266148 AAATCATTTTAGTTTAAAAAAGG - Intronic
1053420400 9:37973953-37973975 GCCTGATTTCAGTTTTCAGAAGG - Intronic
1055207842 9:73753984-73754006 GACATATTTCAGTATAGAGAAGG + Intergenic
1055346796 9:75348209-75348231 GACTCATATAAACTTAAAGAGGG - Intergenic
1055563415 9:77544391-77544413 AACTCATTTCATTTGTAAGAAGG + Intronic
1057784288 9:98074847-98074869 GAGTGCTTTCTGTTTAAAGAAGG - Intronic
1057885325 9:98825401-98825423 AACTCATTACAGGTTAAAGCAGG - Intronic
1059475618 9:114544848-114544870 CACTCAATGCAGTTTAATGAAGG + Intergenic
1059844905 9:118264314-118264336 GACTAATTTCAGAGTACAGAGGG - Intergenic
1060736167 9:126067688-126067710 GAATCTTTCCATTTTAAAGAAGG + Intergenic
1185680246 X:1883004-1883026 CACACATTTCTGTTTAATGATGG + Intergenic
1186829960 X:13380083-13380105 AACAGATTTCAGTTTTAAGAAGG - Intergenic
1187822537 X:23303612-23303634 GACTAACTTCATTTTAAAGATGG + Intergenic
1188990321 X:36811024-36811046 GACTAATTTTGGTTTAAAGAAGG - Intergenic
1191033581 X:56001545-56001567 GACTGATTTTATTTTTAAGATGG - Intergenic
1191587351 X:62843096-62843118 GCCTCATTTGATTTAAAAGAAGG + Intergenic
1191714059 X:64182006-64182028 GACACATCTGAGTTTGAAGATGG + Intergenic
1194540259 X:95161256-95161278 GTCTCATTCCAGTTTTCAGAGGG - Intergenic
1197446504 X:126556354-126556376 GAATTTTTTCAGTTTGAAGAGGG - Intergenic