ID: 1095664234

View in Genome Browser
Species Human (GRCh38)
Location 12:44776793-44776815
Sequence TATACACTGCTTACTACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095664234 Original CRISPR TATACACTGCTTACTACAGG AGG (reversed) Intronic
905462439 1:38130470-38130492 TATACACTGTTGTCTCCAGGAGG + Intergenic
905538334 1:38741212-38741234 TATTCAGTGCTTAGGACAGGAGG - Intergenic
909971272 1:81993266-81993288 TATAAACTACTTGCTAAAGGAGG + Intergenic
912621907 1:111169195-111169217 GATACACTTCTTAGTACAGTCGG - Intronic
914426212 1:147579405-147579427 TATACACTGCTTGACACAGATGG + Intronic
915284980 1:154846802-154846824 TTTACTGTGCTTACTAGAGGAGG + Intronic
918137993 1:181693636-181693658 TAGACACTGGGTACTACTGGAGG + Intronic
1067575834 10:47407724-47407746 CATACCCTTCTTACTACAGCGGG - Intergenic
1067702904 10:48586569-48586591 TATACACTGCCTTCTAGAGATGG + Intronic
1073618919 10:105026808-105026830 TATATACTGCGGACTACAAGAGG + Intronic
1083562370 11:63682739-63682761 TATACAATGCAAACTAAAGGAGG - Intronic
1086247820 11:84775723-84775745 TAGACACTGGGTACTACTGGAGG + Intronic
1086846492 11:91755955-91755977 TATACACTGGTGACTACTTGAGG - Intergenic
1092209944 12:6639537-6639559 TTTTCCCTGCTAACTACAGGAGG + Intronic
1094463432 12:30723852-30723874 TATATACTGCTCACTAAAGCTGG + Intronic
1095664234 12:44776793-44776815 TATACACTGCTTACTACAGGAGG - Intronic
1099921030 12:88957429-88957451 TCTCCACTGCTTATTCCAGGAGG + Intergenic
1103929587 12:124442672-124442694 GGTACACTGCCTAGTACAGGTGG + Intronic
1115960401 14:38830119-38830141 GAGAAACTGCTTACTACAGAGGG + Intergenic
1124517008 15:30375147-30375169 TCTACACTGGTGACTACCGGAGG + Intronic
1124725910 15:32155570-32155592 TCTACACTGGTGACTACCGGAGG - Intronic
1125839774 15:42789227-42789249 GATACAGTGGTTACCACAGGGGG - Intronic
1130787296 15:87114499-87114521 TAGACACTGCTAACTTCAGATGG + Intergenic
1135837289 16:25837946-25837968 TAGACACTGCGGACTACAAGAGG - Intronic
1137373999 16:47936071-47936093 TAGACACTGGGGACTACAGGAGG - Intergenic
1143575032 17:7787241-7787263 TACACAGTGCTTACAACAGAGGG - Intronic
1146342454 17:32032830-32032852 TATAAAGTGCTTAGTAAAGGTGG - Intronic
1158362230 18:56688030-56688052 TAGAGACTGCTTACCACAGGAGG + Intronic
1164745125 19:30606511-30606533 CATGCCCTGCTTACTTCAGGTGG - Intronic
929903560 2:46026757-46026779 GATACACAGCTGACTACAGAAGG + Intronic
930338048 2:50075548-50075570 TAGGCACTGCATATTACAGGAGG + Intronic
931944920 2:67295611-67295633 TTTACACTGCTTACTCCTTGGGG - Intergenic
936882613 2:117272537-117272559 CATGCACTGCTTACCACAGGAGG - Intergenic
938820573 2:134954398-134954420 TATATACTGCTTAACAGAGGAGG - Exonic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
947124483 2:226853108-226853130 TTTACACTGCATATTACAGATGG + Intronic
1168898602 20:1341168-1341190 TATACAATGCTTATTACAGGTGG + Intronic
1171221563 20:23402734-23402756 TATAAACTTCTTAATACAGTAGG - Intronic
1175043714 20:56081784-56081806 TAGACACTGCGGACTACTGGTGG + Intergenic
957826563 3:85453957-85453979 TTAATACTGCTTACTACATGTGG - Intronic
959039525 3:101405156-101405178 TGTACTCTGCTTCCTTCAGGAGG - Intronic
962938316 3:140102142-140102164 TATAAACTGCTGTCTACAGTTGG + Intronic
963193679 3:142502446-142502468 TAGACACTGCAGACTACAAGGGG + Intronic
978711929 4:111793219-111793241 TATACACTGCTGATAAGAGGTGG - Intergenic
981406494 4:144375797-144375819 TAAACACTGCTCACTGTAGGTGG + Intergenic
989278428 5:39615291-39615313 TATAGACTCCATACAACAGGAGG - Intergenic
994211671 5:97094213-97094235 GATACACTGCAAACTACAGTGGG - Exonic
994513686 5:100742239-100742261 TAGACACTGCAGACTACTGGGGG + Intergenic
995439830 5:112178068-112178090 TGTACACTGTTTACAAGAGGTGG + Intronic
995942874 5:117606260-117606282 TCAACACTGAATACTACAGGAGG - Intergenic
1004085599 6:12445358-12445380 TATACACTGTTTTCTCCATGGGG + Intergenic
1004342130 6:14817167-14817189 GATACACTGATTACTAAATGAGG - Intergenic
1010347794 6:74833097-74833119 TATATACTACTTTCTTCAGGCGG + Intergenic
1010550264 6:77213179-77213201 AATACACTGCTTAGAACAGCAGG - Intergenic
1010895173 6:81353114-81353136 TTTTCTCTGCTTACTATAGGAGG - Intergenic
1013515292 6:110879634-110879656 TAAAGACTGCTTACTACCTGGGG + Intronic
1015003934 6:128255446-128255468 TATACACTCTTTATTAAAGGAGG - Intronic
1016399439 6:143662872-143662894 TAGACACTGTGTACTATAGGGGG - Intronic
1024423650 7:49200301-49200323 TATACACACTTTACTAAAGGGGG - Intergenic
1028091712 7:86710706-86710728 AATACACTGTTTACTAGAGTTGG - Intronic
1032861823 7:135887215-135887237 TAAACACTGCTGACTACTAGAGG + Intergenic
1044354681 8:91207317-91207339 TAAACAGTGCTTAGTACAGTGGG + Intronic
1046715125 8:117558905-117558927 TATAGACTGCTGACCAAAGGTGG + Intergenic
1047127155 8:121975239-121975261 TAGACACTGGGTACTAGAGGCGG + Intergenic
1047528110 8:125650977-125650999 TAGAGGCTGCTTACCACAGGTGG + Intergenic
1048433225 8:134390164-134390186 CCTACAGTCCTTACTACAGGAGG + Intergenic
1048691900 8:136975243-136975265 TATAGGATGCTTACCACAGGAGG + Intergenic
1052296158 9:26897736-26897758 TACAAACTGCTTTCTACATGGGG + Intergenic
1053261819 9:36673082-36673104 TATAGACTGCTTCCTAAAAGAGG - Intronic
1187384284 X:18833256-18833278 TAGACACGGCTAACTTCAGGCGG + Intergenic
1189290371 X:39880896-39880918 TGTCCACTGCCCACTACAGGGGG + Intergenic
1193630798 X:83885590-83885612 TATTCACTGCTGACTTCAGAAGG + Intronic
1194439664 X:93916449-93916471 TATACACTGCAGACTCCTGGGGG + Intergenic
1194700060 X:97103151-97103173 TATGCACTGCCTACTTTAGGTGG + Intronic
1197233556 X:124032596-124032618 TAGACACTGCGGACTACTGGGGG - Intronic
1199932276 X:152535538-152535560 CCTACACTGCTCACTACAGGTGG + Intergenic
1202071077 Y:20992008-20992030 TATACCCTGCCTACCACAGCAGG - Intergenic