ID: 1095666294

View in Genome Browser
Species Human (GRCh38)
Location 12:44803115-44803137
Sequence GATGAGTAACAAGTAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095666290_1095666294 30 Left 1095666290 12:44803062-44803084 CCAGATGTGGTATACTAAGAAGA 0: 1
1: 0
2: 3
3: 14
4: 142
Right 1095666294 12:44803115-44803137 GATGAGTAACAAGTAAACACTGG 0: 1
1: 0
2: 0
3: 16
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095666294 Original CRISPR GATGAGTAACAAGTAAACAC TGG Intronic
904980269 1:34494980-34495002 GAAGTTTAACAAGAAAACACAGG - Intergenic
905164564 1:36071278-36071300 GAAGAGTAAAATGTAAATACAGG + Exonic
906444520 1:45883564-45883586 GCTTAGTAAGAAGAAAACACAGG - Intronic
906775994 1:48530054-48530076 GCAGAATAACAAGTAAACAATGG - Intergenic
912983461 1:114401577-114401599 GTTGAGTATCTAGTAAACAGGGG - Intronic
917137898 1:171805288-171805310 AATGAGTTACAAGTATAGACTGG + Intronic
917497056 1:175550096-175550118 GATGAGAAACAGGTAGACATAGG + Intronic
918914026 1:190611533-190611555 GATGATCAATAATTAAACACAGG - Intergenic
921037180 1:211391916-211391938 GATGAGGAAGAAGGAAACATAGG - Intergenic
923243051 1:232104600-232104622 GCTGAGTAACAAGCAAAATCCGG + Intergenic
1065874041 10:29981846-29981868 GATGAGTAAGAATTAACCACAGG + Intergenic
1068484703 10:57642922-57642944 TAGGAGTAAGAAGTAAACATGGG + Intergenic
1068810248 10:61247632-61247654 GATAAGTACCAAATAAACATTGG - Intergenic
1069934150 10:71903711-71903733 GATCAGGAAAAAGTAAATACTGG - Intergenic
1072303953 10:94088535-94088557 GATGATGAACAAGAAAACCCAGG - Intronic
1072478805 10:95790558-95790580 GATGGGTAATAAGTATACAGTGG - Intronic
1075008165 10:118845293-118845315 GATGATTAACAAGAAAGGACCGG + Intergenic
1077826377 11:5812742-5812764 GATAATCAACAAGGAAACACTGG + Intronic
1079218557 11:18538010-18538032 GATGAGAAACAGGTGAACATTGG - Intronic
1079489131 11:20967920-20967942 GATGGGAAAAGAGTAAACACTGG - Intronic
1079901149 11:26186620-26186642 CATGAGTAACAAGTTTACACAGG + Intergenic
1080278553 11:30530440-30530462 GCAGAGAAACAAGTAAACAATGG + Intronic
1080605969 11:33865028-33865050 GATGTCTAAGAAGTAAACACAGG + Intronic
1081472825 11:43392736-43392758 GATGAGTAATAAGAGAAAACTGG + Intronic
1093262903 12:16962959-16962981 GATGAAAAACAAGTAAATTCTGG - Intergenic
1095666294 12:44803115-44803137 GATGAGTAACAAGTAAACACTGG + Intronic
1095897989 12:47300028-47300050 GATAACTGAAAAGTAAACACTGG - Intergenic
1099073370 12:78074811-78074833 GATGAATATGAAGTAAAAACAGG + Intronic
1100514357 12:95312719-95312741 AAGGAATAACAAGTAATCACAGG - Intergenic
1101631553 12:106499985-106500007 GATTTGGAACAAGTAAACTCTGG - Intronic
1101722688 12:107364088-107364110 CATGAGTGACAAGTACACATTGG - Intronic
1103282145 12:119767480-119767502 TAAGAGTAACAAGGCAACACTGG + Intronic
1105388143 13:19951184-19951206 AATGAATAACAAGAAAGCACAGG + Intergenic
1107087176 13:36437809-36437831 GATGTGTATGAAGTAGACACCGG + Exonic
1107285446 13:38785230-38785252 AATGAATAACTAGTAAACATAGG + Intronic
1107407123 13:40125389-40125411 GCTGAGTAATGAGGAAACACAGG + Intergenic
1110311280 13:74052330-74052352 AATGAGTAGCAGGTAAACCCAGG - Intronic
1111493471 13:89016989-89017011 AAAGAGTGACTAGTAAACACAGG - Intergenic
1111554991 13:89868671-89868693 AATGAGTAAAAAGTAAAGAGGGG - Intergenic
1111817169 13:93168452-93168474 CATGACTAACAAGTCAACATTGG - Intergenic
1114904660 14:27112030-27112052 AATGAGAAATAAGAAAACACTGG - Intergenic
1120161309 14:81148072-81148094 GATGTTGAACAAGTAAACAAAGG + Intergenic
1120495711 14:85232368-85232390 GATAAGCAATAAGGAAACACAGG - Intergenic
1120880128 14:89409174-89409196 GATCAGAAACATGTCAACACAGG + Intronic
1123139067 14:106057719-106057741 GATGAAGAACAAATATACACTGG + Intergenic
1127544816 15:59982069-59982091 GATGATTAACTAGTATACATGGG + Intergenic
1131325738 15:91442337-91442359 GATGTATACCAAGTAAACAATGG - Intergenic
1131856736 15:96605361-96605383 GCTGAGTAAGAAATAAAGACTGG + Intergenic
1132192484 15:99879166-99879188 GAAAAGTAAAAAGAAAACACTGG - Intergenic
1133537711 16:6718081-6718103 GATGGGTAAGAAGTAGCCACTGG - Intronic
1143301931 17:5916864-5916886 AATGAGGAACAAGGAAACAGAGG - Intronic
1143440356 17:6967207-6967229 GAATAGTAACTAGTAAGCACTGG - Intronic
1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG + Intronic
1147940545 17:44044290-44044312 GCTGAGTAACAATGACACACTGG + Intronic
1155279915 18:24228898-24228920 GATAAATAAAAAGCAAACACAGG + Intronic
1159424605 18:68269168-68269190 GATGAGGCAATAGTAAACACGGG - Intergenic
1161815528 19:6497564-6497586 CATGATTAACAAGAAAACACAGG - Intronic
1165594317 19:36999227-36999249 GGTGAGTAAAAACTAAACATTGG - Intergenic
1166964401 19:46519477-46519499 AATGAGTACAAAGAAAACACAGG - Intronic
926785460 2:16513742-16513764 GATGAATAGTAAATAAACACAGG + Intergenic
928286711 2:29996339-29996361 CATGAGGTAGAAGTAAACACAGG - Intergenic
928407663 2:31027098-31027120 GATGAGAAACTAGGAAACACAGG + Intronic
930444643 2:51454661-51454683 GATGAGTAAAAAATATACATAGG - Intergenic
931748363 2:65309973-65309995 GGTGAGTAACAGGTAAACTGCGG - Intergenic
931915508 2:66950728-66950750 GATGAGTAACAAGTGATCATTGG + Intergenic
933904644 2:86879160-86879182 GATGAGTAACAAAAAAAGACTGG - Intergenic
935983944 2:108654347-108654369 GAAGAGTTATAACTAAACACTGG + Intronic
936136379 2:109898000-109898022 GAAGAGTTATAACTAAACACTGG + Intergenic
936208318 2:110473485-110473507 GAAGAGTTATAACTAAACACTGG - Intergenic
936367591 2:111872999-111873021 GATGAGTAACAAAAAAAGACTGG + Intronic
936950555 2:117973796-117973818 GGTGAGTTACAAGAGAACACGGG + Intronic
937193779 2:120131730-120131752 GATGTGTAACAGGTATACACAGG - Intronic
939217989 2:139264674-139264696 GGTCAGTAACAGGTAAAAACAGG - Intergenic
940375732 2:152956137-152956159 GATGAGTAATAATTAAAAAGGGG + Intergenic
941122089 2:161542142-161542164 GAAGATTAATAAGGAAACACTGG + Intronic
943795893 2:191993402-191993424 AATGTTCAACAAGTAAACACAGG + Intronic
944635889 2:201675758-201675780 GAAGAGGAACAAGTCAACAGAGG - Intronic
947044129 2:225959177-225959199 GATGTGGAACACGTAGACACTGG - Intergenic
948267009 2:236642473-236642495 CATGTGAAAAAAGTAAACACCGG + Intergenic
948652543 2:239457482-239457504 GTTGAGAAACAGGTAAACAGAGG + Intergenic
1173560740 20:44003716-44003738 GATGAGTAGGAACTAACCACGGG + Intronic
1174873811 20:54207371-54207393 TATGAGTGACAGCTAAACACTGG + Intergenic
1177003369 21:15640617-15640639 GATGATTAAAAATTAAAAACAGG - Intergenic
1179139660 21:38713511-38713533 GATGTGCAACAATTGAACACAGG + Intergenic
1180725537 22:17944217-17944239 TATGACGCACAAGTAAACACTGG - Intronic
1183993785 22:41618000-41618022 GATGAGGAAGAAGTAGCCACAGG - Intronic
1184454862 22:44604001-44604023 CATGAGTCACAAGTTAGCACAGG + Intergenic
949985092 3:9534250-9534272 GATGTGTAATAAGTAAACATTGG + Intronic
954726223 3:52613296-52613318 GATGGGTAACAAGTATATACAGG + Intronic
955486433 3:59439114-59439136 GAAGAATACCAAGTAGACACAGG + Intergenic
955487680 3:59451082-59451104 GAATTGTAACAAGTATACACAGG + Intergenic
959136483 3:102428809-102428831 AATGTGTAACAAGTAAACAATGG - Intronic
960195999 3:114769206-114769228 CATGATTAACAATAAAACACAGG - Intronic
960714947 3:120565658-120565680 GAAGAGTAGCTAGGAAACACAGG + Intergenic
961913077 3:130341427-130341449 GCTGTCTAACAAATAAACACTGG - Intergenic
963699358 3:148604911-148604933 GATGAGTAACAAGTAATTCCTGG - Intergenic
963739612 3:149063730-149063752 GATGAGTACAAAGAAAAGACTGG - Intronic
964025311 3:152066524-152066546 AATGAGAAAAAAGTAAACAAAGG - Intergenic
969894645 4:10292143-10292165 GCTGAGGACCAAGTAAACTCGGG - Intergenic
971627042 4:28934674-28934696 TATGAGTATCAAGCAATCACTGG - Intergenic
972122338 4:35719824-35719846 GTAGAGTAATAAGTACACACTGG - Intergenic
975447560 4:74483701-74483723 GATGAGTAACAATTATAACCTGG - Intergenic
975488790 4:74966002-74966024 GATGAGTAAGATGTTAACAATGG + Intronic
976962211 4:90991581-90991603 GAAGAGGAAAATGTAAACACAGG - Intronic
977781875 4:100990284-100990306 TATTTGTAACAACTAAACACTGG - Intergenic
980702991 4:136457036-136457058 GGAGAGTCACAAGTAAGCACAGG + Intergenic
981857935 4:149317441-149317463 TATGAGGAACAAGTTAACAGAGG - Intergenic
982077748 4:151755074-151755096 GATAATTAACAAGTAATAACAGG - Intronic
983020841 4:162674243-162674265 GATGTTTAATCAGTAAACACAGG - Intergenic
983126089 4:163951953-163951975 AATGAAAAACAAGGAAACACGGG - Intronic
983436927 4:167727747-167727769 GATGATTAGCAAGCAAATACTGG + Intergenic
983763327 4:171442117-171442139 GATTAGGAACAAGGAAAAACTGG + Intergenic
984072182 4:175129005-175129027 AATGAGCCACAAGAAAACACAGG + Intergenic
986221478 5:5772513-5772535 GATCAGTAACAAATAAACTGAGG + Intergenic
986949247 5:13061523-13061545 ACTGGGTAACAAGTAGACACTGG - Intergenic
988121342 5:26966875-26966897 GATGAGACACAAGTAGACAATGG - Intronic
989124440 5:38038058-38038080 GAAAAGTAACAAGTAAACGATGG + Intergenic
989129618 5:38093721-38093743 GACGAGTAATAAGGAAAAACAGG - Intergenic
989467744 5:41776455-41776477 GATGAAAAACAAAAAAACACAGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992568253 5:78024170-78024192 TAAGAGAAACATGTAAACACTGG + Intronic
993846509 5:92951113-92951135 GAAAATTAACAAGGAAACACTGG - Intergenic
994716951 5:103333354-103333376 GATAAGTGACAAGCAAATACTGG + Intergenic
995491837 5:112701650-112701672 GAGGAGAAGGAAGTAAACACTGG + Intergenic
996962311 5:129265785-129265807 GATGAATAATAAATAATCACAGG + Intergenic
1001364666 5:171124076-171124098 GATAAGATACAAGAAAACACAGG + Intronic
1001461235 5:171916536-171916558 GATGAAGAACAAGGAAACAAAGG + Intronic
1004781785 6:18916512-18916534 GATGAATAAAAAGTAATAACGGG + Intergenic
1005316515 6:24607738-24607760 GATGAGAAATAAGTAAAACCTGG - Intronic
1010167988 6:72939870-72939892 GATGAGTAAAATGTAAAAATGGG + Intronic
1011192182 6:84740837-84740859 GATAATTAACAAGCAACCACTGG + Intronic
1011733341 6:90288918-90288940 TGTGAGTTACAAGTAAACCCTGG + Intronic
1016316677 6:142796979-142797001 GATGAGAGACATGTAAACACAGG - Intronic
1017062452 6:150497377-150497399 GAGGAGTAACAAAAATACACTGG - Intergenic
1023162464 7:37310356-37310378 GATGAGTCCCCAGAAAACACAGG - Intronic
1024468499 7:49740327-49740349 GTTGAGTAAAATGTAACCACTGG + Intergenic
1027997486 7:85443591-85443613 GTTGAGTTACATATAAACACAGG + Intergenic
1032897444 7:136266838-136266860 GATGAGGCTCAAGTCAACACAGG - Intergenic
1036389141 8:8309409-8309431 GATGGGTAGCCAGTAAACACTGG + Intergenic
1036458774 8:8933192-8933214 GATGAGTAACAAGTAGATAATGG - Intergenic
1038393379 8:27226557-27226579 GATGAGAAACAAGAATACCCAGG + Intergenic
1038735565 8:30166066-30166088 GATGAGTAAAAAGAACACAGAGG - Intronic
1039667850 8:39555275-39555297 ATTGAGTAACAAGTAAAGGCTGG + Intergenic
1039701406 8:39965688-39965710 GAAGAGGAAAAATTAAACACAGG + Intronic
1039997497 8:42546549-42546571 GATAACTATCAAGTAAACATTGG - Exonic
1040960471 8:53026982-53027004 GATGAGTAAAAAGAAACCAAAGG - Intergenic
1041871329 8:62637808-62637830 GATGAGGAATAAGAACACACAGG + Intronic
1042093611 8:65187474-65187496 GATGAGAAAGAAGAAAAAACTGG - Intergenic
1045472725 8:102526825-102526847 GAAGAGCAATAAATAAACACAGG + Intergenic
1047173713 8:122520401-122520423 CATGACTAGCAAGTAAGCACAGG - Intergenic
1047232922 8:123012510-123012532 GTTAAGAAAGAAGTAAACACAGG + Intergenic
1047688830 8:127329985-127330007 TATGATTAACAAATAAATACAGG + Intergenic
1050078110 9:1886342-1886364 GATGAGCAAAAAATATACACTGG - Intergenic
1050147240 9:2582398-2582420 GATAATTAACAAGGAAAGACTGG + Intergenic
1051093597 9:13438901-13438923 GATAAGTAAAAAGTAAACTGAGG + Intergenic
1052867630 9:33474375-33474397 GCTAAGTAATAAGTAAAAACTGG - Intergenic
1056933233 9:90895922-90895944 GATGAGTAACAAATGCACCCCGG - Exonic
1058644237 9:107115897-107115919 GAAGAGTAACAAGAAGAGACTGG + Intergenic
1059547949 9:115197859-115197881 GAAGAGAAAGAAGTAAAAACTGG - Intronic
1060742684 9:126109985-126110007 AATGACTAAGAAATAAACACAGG - Intergenic
1185693053 X:2172567-2172589 AAAGACTAACAAGAAAACACCGG + Intergenic
1186881376 X:13869983-13870005 CATGAAAAACAAGTAAAGACTGG - Intronic
1189247062 X:39571499-39571521 GAAGGGGAACAAGTCAACACAGG - Intergenic
1189736307 X:44073167-44073189 GTTCTGTCACAAGTAAACACTGG + Intergenic
1192336392 X:70223880-70223902 GGTGAGTAACAAGTAGAGAAAGG - Intergenic
1194393847 X:93355019-93355041 GACGAGTAACAATAAAACTCTGG + Intergenic
1195429755 X:104775595-104775617 GATGAATAGCAAGGAAACAAAGG + Intronic
1198644471 X:138790674-138790696 GATGAATAAGAAGCAAACATAGG - Intronic
1202165999 Y:21988830-21988852 GATTTGCAACAAGCAAACACTGG + Intergenic
1202225359 Y:22597543-22597565 GATTTGCAACAAGCAAACACTGG - Intergenic
1202317754 Y:23598118-23598140 GATTTGCAACAAGCAAACACTGG + Intergenic
1202553012 Y:26071940-26071962 GATTTGCAACAAGCAAACACTGG - Intergenic