ID: 1095666987

View in Genome Browser
Species Human (GRCh38)
Location 12:44814140-44814162
Sequence CCTCAGGAGGAGCAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 614}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095666979_1095666987 1 Left 1095666979 12:44814116-44814138 CCCATTGAAATGCTGCCTGACAA 0: 1
1: 0
2: 0
3: 6
4: 142
Right 1095666987 12:44814140-44814162 CCTCAGGAGGAGCAGATGGAGGG 0: 1
1: 0
2: 2
3: 62
4: 614
1095666980_1095666987 0 Left 1095666980 12:44814117-44814139 CCATTGAAATGCTGCCTGACAAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1095666987 12:44814140-44814162 CCTCAGGAGGAGCAGATGGAGGG 0: 1
1: 0
2: 2
3: 62
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095666987 Original CRISPR CCTCAGGAGGAGCAGATGGA GGG Intronic
900123288 1:1058702-1058724 CTGCAGGGGGAGCAGAGGGAGGG + Intergenic
900136737 1:1120971-1120993 CCTCAGGAGGAGCTGCTGTTTGG - Intergenic
900833343 1:4980605-4980627 CCTGAGGAGGGGCAGCTGGGTGG + Intergenic
901212949 1:7536761-7536783 CCGCGGGTGGAGCAGAGGGAAGG - Intronic
901526559 1:9826577-9826599 CGTCAGGTGGGGCAGATAGACGG + Intergenic
901866774 1:12111656-12111678 CCTCAGGAGGAACAGTGGGCAGG + Intronic
902184704 1:14716646-14716668 CCTCAGGCGGAGCACCTGAAAGG + Intronic
902305524 1:15535624-15535646 ACTCAGGAGGCTGAGATGGAAGG + Intronic
902374174 1:16022593-16022615 CCCCTGGAGAAGCAGATGGAGGG - Exonic
902463484 1:16598586-16598608 CCTCATTAGGAGCAGATGCGGGG - Intronic
902506519 1:16942117-16942139 ACTCAGGAGGCTGAGATGGAAGG - Intronic
902598566 1:17525548-17525570 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
902959637 1:19953902-19953924 CATCAGGGGAATCAGATGGAGGG + Intergenic
903031453 1:20466904-20466926 CTTCAGGAGGGACAGCTGGATGG - Intergenic
903158036 1:21462117-21462139 CCTCATTAGGAGCAGATGCGGGG + Intronic
903473068 1:23600745-23600767 TCACAGGAGCTGCAGATGGATGG - Intronic
903493810 1:23750912-23750934 CAGAAGGAGGAGGAGATGGAGGG + Exonic
905319379 1:37105122-37105144 CCTCAGTAGCAGCAGGTGGCAGG - Intergenic
905345405 1:37307853-37307875 CCTCAGGATGGCCAGCTGGATGG + Intergenic
905475204 1:38221478-38221500 CATTAGGAGGAGCACAAGGAAGG - Intergenic
905541690 1:38765114-38765136 CCTCAGGAGGAGGAGAAAGTGGG - Intergenic
906128251 1:43440753-43440775 CCTCAGGAGGATGAAATGGGAGG + Intronic
906137362 1:43508727-43508749 CGTGAGTAGGAGGAGATGGATGG - Intergenic
906318225 1:44801550-44801572 CCTCAGGGAGCACAGATGGAGGG + Intronic
907233919 1:53027161-53027183 ACTCAGGAGGCTGAGATGGAAGG - Intronic
907883500 1:58572836-58572858 CCTCAGGAGGCTCAGAAGGCAGG + Intergenic
907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG + Intergenic
908431264 1:64060752-64060774 GCAGAGAAGGAGCAGATGGAGGG + Intronic
908486692 1:64601368-64601390 CCTCAGAAGCCACAGATGGAGGG - Intronic
908938360 1:69402444-69402466 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
910129941 1:83891934-83891956 CCTCAGGAGGCTGAGATGGGAGG - Intronic
910482531 1:87674226-87674248 CCTTGGGAGGAGTAGATGAAAGG + Intergenic
910895048 1:92060303-92060325 ACTCAGGAGGTTCAGGTGGAAGG + Intronic
911168516 1:94746174-94746196 ACCCAGGAAGAGCAGATGTAAGG - Intergenic
911993995 1:104739204-104739226 CCACAGGAGGAGAAGAGAGAAGG - Intergenic
913470461 1:119180852-119180874 GATCAGGAGGAGCAGGAGGAAGG - Intergenic
913678282 1:121163582-121163604 ACTCAGGAGGCGGAGGTGGAAGG - Intergenic
913689200 1:121262387-121262409 CCTCTGGAGGTGGAGAGGGAAGG + Intronic
914030121 1:143951222-143951244 ACTCAGGAGGCGGAGGTGGAAGG - Intronic
914148399 1:145017894-145017916 CCTCTGGAGGTGGAGAGGGAAGG - Intronic
914159329 1:145116729-145116751 ACTCAGGAGGCGGAGGTGGAAGG + Intergenic
915065349 1:153220053-153220075 CCTCATGAGGAAGAGGTGGAGGG + Intergenic
915098842 1:153484155-153484177 CCTCAGGAGAACCAAATGGAAGG + Intergenic
915244071 1:154543968-154543990 CCTCAGGAGCAGCACCAGGAAGG - Exonic
915280689 1:154820260-154820282 CCTCAGGAGCATCAGAGGGAGGG + Intronic
915641787 1:157233144-157233166 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
915855427 1:159379788-159379810 CCTGAGGAGAAGCAGAAAGATGG + Intergenic
916038778 1:160944595-160944617 CCTCAGGAGGCTGAGGTGGAAGG - Intergenic
916149111 1:161768670-161768692 ACTCAGGAGGCTCAGATGGAAGG - Intronic
916535996 1:165703759-165703781 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
916728990 1:167549791-167549813 ACTCAGGAGGATGAGATGGGAGG - Intronic
917345208 1:174022254-174022276 CCTCAGCAGCAGCAGGTGGGAGG - Exonic
917368276 1:174258391-174258413 CCTCAGGAGGCTGAGATGGGAGG - Intronic
917458294 1:175204771-175204793 CCTCCTGAGGAGCTGCTGGATGG - Intergenic
917850962 1:179063477-179063499 ACTCAGGAGGCTGAGATGGAAGG + Intronic
917896304 1:179491200-179491222 ACTCAGGAGGTTAAGATGGATGG + Intronic
917966727 1:180183498-180183520 CCTCAGGGCGAGCTTATGGATGG + Intronic
918127453 1:181596936-181596958 GCTCAGGAGGAGCAGAAATAGGG + Intronic
919478192 1:198054804-198054826 ACTCAGGAGGATCACTTGGAGGG - Intergenic
919961404 1:202473737-202473759 ACTAAGGAGGAGGAGAAGGAAGG - Intronic
920152995 1:203924484-203924506 ACTCAGGAGGCTCAGATGGGAGG - Intergenic
920240194 1:204541356-204541378 ACTCAGGAGGCTGAGATGGAAGG + Intronic
920294917 1:204950184-204950206 CCTCAGTGGCATCAGATGGAGGG + Intronic
920465589 1:206182106-206182128 ACTCAGGAGGCGGAGGTGGAAGG - Intergenic
920476523 1:206280862-206280884 CCTCTGGAGGTGGAGAGGGAAGG + Intronic
920530473 1:206698220-206698242 CATCAGGAGGCCCAGATGGCAGG + Intronic
920744240 1:208611036-208611058 ACTCAGGAGGATAAGGTGGAAGG - Intergenic
920955674 1:210618569-210618591 CATCTGGAGGAGCAGATGGCCGG - Intronic
921166479 1:212511500-212511522 ACTCAGGAGGCTCAGATGGGAGG + Intergenic
921324560 1:213978039-213978061 TCTAAGGAAGAGAAGATGGAAGG + Intergenic
921388346 1:214594055-214594077 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
922619506 1:226981321-226981343 ACTCAGGAGCAGCAGAAGGCCGG - Intronic
922634698 1:227156259-227156281 ACTCAGGAGGATGAGATGGGAGG - Intronic
922778463 1:228229378-228229400 CCTCAGGAGGCTGAGATGGGAGG - Intronic
923006706 1:230055703-230055725 CCTCAGGAGGAGGTGATTCATGG + Intergenic
923164257 1:231344396-231344418 GCTCAGGAGGATGAGATAGAGGG + Intronic
923164393 1:231345919-231345941 ACTCAGGAGGCGGAGATGGGAGG - Intronic
923389030 1:233495487-233495509 ACTCAGGAGGATGAGGTGGAAGG - Intergenic
924459217 1:244243459-244243481 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
924463448 1:244279823-244279845 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1063159296 10:3408199-3408221 CCTCAGGAGCAGAGGATGCAGGG + Intergenic
1063236235 10:4119296-4119318 CCTTAGGAGGAAGCGATGGATGG - Intergenic
1063600744 10:7478946-7478968 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1063688832 10:8264148-8264170 CCTGAGGTCGAGGAGATGGAAGG + Intergenic
1064092518 10:12396835-12396857 CCTCAGGAAGAGCAGAAGGTAGG - Intronic
1065349137 10:24780259-24780281 CCTCAGGAGGCTGAGGTGGAAGG - Intergenic
1065495385 10:26322083-26322105 CTTCAGGAGTAGAAGATGGATGG + Intergenic
1065608913 10:27451251-27451273 ACTCAGGAGGCTCAGATGGGAGG - Intergenic
1065707691 10:28486271-28486293 ACTCAGGAGGCTCAGGTGGAAGG + Intergenic
1065762101 10:28991916-28991938 CACCAGGAGGAGCTGTTGGATGG - Intergenic
1065963869 10:30755051-30755073 TCCCAGGAGGAGCACAGGGATGG - Intergenic
1066408436 10:35142712-35142734 ACTCAGGAGGGTGAGATGGAAGG - Intronic
1066671507 10:37845128-37845150 CCTCAGGAAGTTCAGGTGGAAGG - Intronic
1067551970 10:47242614-47242636 CCTCAGGGGCAGCTGAGGGAGGG + Intergenic
1067559086 10:47292061-47292083 CCTCACCAGGAGCAGATGCTAGG + Intergenic
1068191383 10:53657088-53657110 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1068540217 10:58284225-58284247 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1068650674 10:59519242-59519264 CCTAAGGCTGAGAAGATGGAGGG - Intergenic
1069852822 10:71421334-71421356 CCTCAGGTGGGGCAGGTGGTGGG - Intronic
1070024350 10:72617721-72617743 GCTCAGGAGGTTGAGATGGAAGG + Intronic
1070351422 10:75596309-75596331 CCTCAGCAGGAGCAAACGTAAGG - Intronic
1071420509 10:85492642-85492664 CCTGAGGAGGGGCTGCTGGAAGG + Intergenic
1071439321 10:85676469-85676491 CCTCAGGAGAAGCAGAATGAGGG - Intronic
1071815679 10:89230413-89230435 ACTCAGGAGGTTGAGATGGAAGG - Intronic
1072362465 10:94673445-94673467 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1072455932 10:95575774-95575796 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1072593196 10:96846361-96846383 CCTCAGGAGGCTCAGGTGGGAGG - Intronic
1072728884 10:97831518-97831540 TCTCATTAGGAGCAGATGGAGGG + Intergenic
1072774082 10:98171819-98171841 GCTCAGGATGATAAGATGGAAGG + Intronic
1073201404 10:101738753-101738775 ACTCAGGAGGGGAAGATGGGAGG - Intergenic
1074106086 10:110390640-110390662 CTTCAGAAGGCGGAGATGGAAGG + Intergenic
1074397256 10:113108268-113108290 CCTCAGGCGGAGCAGAGGCTGGG - Intronic
1074580345 10:114712939-114712961 ACTCAGGAGGACAAGATGGGAGG + Intergenic
1074789186 10:116869103-116869125 CCTTTGGGGGACCAGATGGAAGG - Intronic
1074968112 10:118511299-118511321 CCTGAGGAGGAGGAAAGGGAGGG + Intergenic
1075593570 10:123710449-123710471 GATCAGGTGGAGCAGGTGGAGGG + Intronic
1076698173 10:132257032-132257054 CCTGGCCAGGAGCAGATGGATGG + Intronic
1077777231 11:5285028-5285050 GATGAGGAGGATCAGATGGATGG - Intronic
1077917517 11:6621245-6621267 CCTCAGGAGGCACAGAGGGGTGG - Intergenic
1077927454 11:6695972-6695994 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1078002166 11:7505720-7505742 ACTCAGGAGGAGAAGGTGGGGGG + Intronic
1078064219 11:8067315-8067337 CCTCATGAGGAGCAGAGCCAGGG - Intronic
1079036962 11:17028305-17028327 TCTCAGGAGGATGAGATGGAAGG + Intergenic
1079301723 11:19284520-19284542 CCTCAGGGGTGGCAGAAGGAAGG - Intergenic
1079588824 11:22157684-22157706 CCTCAGAAGGAGCATCTGGAAGG + Intergenic
1079602573 11:22328026-22328048 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1080577946 11:33617030-33617052 ACTCAGGAGGGTGAGATGGAAGG + Intronic
1080780647 11:35426509-35426531 CCTCATGAGGAGCAAAAGAATGG + Intergenic
1081632978 11:44701886-44701908 AGGCAGGAGGAGTAGATGGATGG - Intergenic
1082788949 11:57334042-57334064 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1082797292 11:57387473-57387495 GCTCAGTAGGAACAGATGAAAGG + Exonic
1083322115 11:61854199-61854221 CCTCTGGAGGAGGAGATGTGTGG + Intronic
1083674804 11:64319302-64319324 CCTCAGGAGGAGGAAGAGGAAGG - Intronic
1083851148 11:65367987-65368009 CCTCAGGAGGCTGAGATGGGAGG - Intergenic
1083960809 11:66013869-66013891 CCCCAGGAGGAGCTCATGGGTGG + Intergenic
1083962000 11:66019806-66019828 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1084044627 11:66561491-66561513 TCTCTGGAGGAGCAGATGGCTGG + Exonic
1084298765 11:68231433-68231455 CCTCAGGAGGCTGAGATGGGAGG + Intergenic
1084788862 11:71460457-71460479 ACTCAGGAGGCTGAGATGGACGG - Intronic
1084943232 11:72625448-72625470 CCTGAGGAGTGGGAGATGGAGGG + Intronic
1085130485 11:74033834-74033856 CCTGACGAGGTGCAGAGGGAAGG - Exonic
1085203165 11:74713911-74713933 CCTCATGTGGAGAAGACGGATGG + Intronic
1085475033 11:76784022-76784044 CCTCAGGAGGGGGAGGGGGAGGG - Intronic
1087802198 11:102516526-102516548 AGTTAGGATGAGCAGATGGATGG + Intergenic
1088435469 11:109807338-109807360 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1089198787 11:116710973-116710995 CATATGGAGGAGCACATGGAAGG + Intergenic
1089565452 11:119368883-119368905 GCTAGGGAGGAGCAGCTGGAGGG + Intronic
1089746014 11:120617486-120617508 CCTCAGGAGGCTGAGATGGGAGG - Intronic
1089791482 11:120948094-120948116 CCTCAGCAGGATCCCATGGATGG - Intronic
1090070412 11:123539492-123539514 CCTCAGGAGGCTGAGGTGGAAGG + Intronic
1090813108 11:130265103-130265125 CCTGAGGAGGAGGAGAGAGATGG - Intronic
1091755832 12:3050889-3050911 ACTCTGGAGGATGAGATGGAAGG - Intergenic
1092098267 12:5861963-5861985 CCTCAAATGGAGCAGATGGGAGG - Intronic
1092151394 12:6251403-6251425 CCTCATGAGGAAGAGAGGGAGGG - Intergenic
1093084860 12:14855820-14855842 ACTCAGGAGGCTGAGATGGAGGG - Intronic
1093172069 12:15872573-15872595 ACTCAGGAGGTGCAGGTGGGAGG + Intronic
1094636364 12:32230289-32230311 CCTTAGGAGGCTGAGATGGAAGG + Intronic
1095376183 12:41531455-41531477 CCTCAGGAGGAGCAGATTGGCGG - Intronic
1095666987 12:44814140-44814162 CCTCAGGAGGAGCAGATGGAGGG + Intronic
1096600404 12:52724715-52724737 CTTCAAGGGGAGCACATGGATGG + Intergenic
1096830128 12:54307349-54307371 TCTAAGGAGGAGCAGAGGGTGGG - Intronic
1096859227 12:54511513-54511535 ACTCAGGAGGAGGAGATAGGAGG - Intronic
1097666229 12:62480455-62480477 ACTCAGGAGGCTGAGATGGATGG + Intronic
1097689023 12:62716633-62716655 CCTCAGGAGGCTGAGGTGGAAGG - Intronic
1098111848 12:67130953-67130975 CCTCAGGAGGATGAGGTGGGAGG - Intergenic
1098754579 12:74343707-74343729 TCTCAGAAGAAGCAGATAGAAGG - Intergenic
1101629563 12:106479920-106479942 ACTCAGGAGGCTGAGATGGAAGG - Intronic
1102403388 12:112650835-112650857 ACTCAGGAGGCTAAGATGGAAGG - Intronic
1102496470 12:113322839-113322861 ACTCAGGAGGAGGAGGTGGGAGG + Intronic
1102503271 12:113367639-113367661 ACTCAGGAGGCGTAGGTGGAAGG + Intronic
1102703669 12:114862561-114862583 CCTCAGTTGGATCAGATGGCTGG + Intergenic
1103083923 12:118046878-118046900 ACTCAGGAGGCTGAGATGGAAGG - Intronic
1103281674 12:119762935-119762957 ACTCAGGAGGATAAGATGGGAGG + Intronic
1103555786 12:121765777-121765799 CCTGAGGAGGAGCTGGAGGAGGG - Intronic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1104415026 12:128590883-128590905 CCTCAGGAGGCTGAGATGGGAGG - Intronic
1105633310 13:22193452-22193474 CCTCAGGAGGAGGTGAAGAAAGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106482377 13:30146577-30146599 ACTCAGGAGGCTGAGATGGAGGG + Intergenic
1106519994 13:30488590-30488612 ACTCAGGAGGCTCAGATGGGAGG - Intronic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1107664494 13:42674895-42674917 CCTCAGTGAGAGCAGGTGGAAGG - Intergenic
1108530499 13:51323260-51323282 GCTCAGGAGGGGCAGAAGCAAGG - Intergenic
1108585262 13:51865420-51865442 CTTCAAGGTGAGCAGATGGATGG + Exonic
1108975998 13:56443826-56443848 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1109151483 13:58853475-58853497 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1109332198 13:60943639-60943661 CCTCACCAGGAGCAGATGCCAGG + Intergenic
1110754076 13:79151334-79151356 CCTCAAGAAAAGCAGATAGACGG - Intergenic
1110931678 13:81226410-81226432 CTTCAGAAGGAGCAGATGGGAGG + Intergenic
1111561623 13:89957334-89957356 CCTCAAGAGGCTGAGATGGAAGG - Intergenic
1112352550 13:98648686-98648708 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1112439131 13:99412860-99412882 CCTCAGGATGGGTGGATGGATGG + Intergenic
1113649739 13:112027112-112027134 ACTCAGTAGGGGCAGATGGAAGG + Intergenic
1114100609 14:19376511-19376533 ACTCAGGAGGATGAGATGGGAGG + Intergenic
1114409807 14:22490036-22490058 CCTCAGGAGCAGAGAATGGAGGG + Intergenic
1116369523 14:44111312-44111334 CCTCAAGAGGATAAGGTGGAAGG - Intergenic
1117428232 14:55623486-55623508 CCTCAGGAGGGTGAGATGGAGGG - Intronic
1117951660 14:61089331-61089353 CCACAGGAGGAGGAGGAGGAGGG - Intergenic
1117970729 14:61248454-61248476 CCTGTGGAAGGGCAGATGGAGGG + Intronic
1118258446 14:64225381-64225403 CAGCAGGAGGAGCAGCTGCAGGG - Exonic
1118569898 14:67183960-67183982 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1118638459 14:67769742-67769764 CATCAGGAGGAGAAGAAAGAGGG + Intronic
1118675928 14:68184342-68184364 ACTCAGGAGGCTGAGATGGAAGG - Intronic
1118768013 14:68922903-68922925 CCCCAGGATGAGGAGAAGGAGGG - Intronic
1118872263 14:69753305-69753327 ACTCAGGAGGCGGAGATGGGAGG - Intronic
1119009726 14:70972231-70972253 ACTGAGGAGGAGCAGATTCAGGG + Intronic
1119026832 14:71159535-71159557 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1119243450 14:73082398-73082420 ACTCAGGAGGATGAGACGGATGG - Intronic
1119475758 14:74926844-74926866 ACTCAGGAGGCTAAGATGGAAGG - Intergenic
1119644615 14:76339452-76339474 CCCCAAGAGGTGCAGGTGGAAGG - Intronic
1120678994 14:87456600-87456622 CCTCAGGAGGTTCAGGTGGTAGG + Intergenic
1120880014 14:89408364-89408386 ACTCAGGAGGCTGAGATGGAAGG - Intronic
1122344905 14:101052379-101052401 CCTCAGGCGGACTAGCTGGAAGG + Intergenic
1122651422 14:103229085-103229107 CCTCGGGAGGCCCAGAAGGATGG - Intergenic
1122750260 14:103928045-103928067 CCTCAGGGTGAGGAGATGGAAGG - Intronic
1123043521 14:105500164-105500186 CCTTAGGAGGAGCTGGCGGAGGG - Intergenic
1202868106 14_GL000225v1_random:136029-136051 CCGCAGCAGGGGCAGATGCAAGG - Intergenic
1124373391 15:29115886-29115908 CCTGAGGAGGGGCAGATGCACGG + Intronic
1124486722 15:30123985-30124007 CTTTAGGAGGACAAGATGGAAGG - Intergenic
1124541800 15:30592962-30592984 CTTTAGGAGGACAAGATGGAAGG - Intergenic
1124756807 15:32414338-32414360 CTTTAGGAGGACAAGATGGAAGG + Intergenic
1125095177 15:35842367-35842389 GTTCAGGAGGAGCAGCTGTAGGG + Intergenic
1126244224 15:46485195-46485217 CCTGAGGAAGAACAGATAGATGG - Intergenic
1128135345 15:65259159-65259181 TTTAAGAAGGAGCAGATGGAAGG + Exonic
1128818854 15:70634325-70634347 CTTAAGGAGAAGCAGCTGGAGGG + Intergenic
1129126072 15:73442609-73442631 CCGAAAGAGGAGCAGATGGGTGG - Intergenic
1129609103 15:77038825-77038847 CCCCAGGTGGAGGAGCTGGAGGG + Intergenic
1129717771 15:77862147-77862169 ACCCAGGAGGAGCAGACTGAAGG + Intergenic
1129790071 15:78335249-78335271 CCTCTGGATGAGCAGCAGGACGG - Intergenic
1129899911 15:79139066-79139088 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1130176661 15:81578874-81578896 CCTCAGGAGAAAGAGATGGATGG + Intergenic
1130460998 15:84158114-84158136 ACCCAGGAGGAGCAGACTGAAGG - Intergenic
1130698798 15:86158142-86158164 CCTCAGGAGGGACATATGCATGG + Intronic
1130699261 15:86162621-86162643 ACTCATGAGGAGCCGAAGGAAGG - Intronic
1131173790 15:90197279-90197301 ACTCAGGAGGCTCAGGTGGAAGG + Intronic
1131374457 15:91912171-91912193 CCTGAGGAAGAGCATGTGGAAGG - Intronic
1132538878 16:498280-498302 CCTCAGGAGGAGGAGGTGGGAGG - Intronic
1132573578 16:654853-654875 CTTCAGGATGAGAAGATGGAGGG + Intronic
1132589124 16:718742-718764 CCTGAGGAGGGGCAGAAGGTGGG - Exonic
1132605161 16:790568-790590 CCTGAGGAGGAGCCGACTGACGG + Exonic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1133120858 16:3606479-3606501 CCTCAAGAGGAGATGATGGCGGG - Exonic
1133411118 16:5569749-5569771 CATCAGAAAGATCAGATGGAGGG - Intergenic
1133785344 16:8968839-8968861 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1134557174 16:15175329-15175351 CCTCAGGCACAGCTGATGGAGGG + Intergenic
1134637914 16:15807068-15807090 GCTCAGGAGGCTGAGATGGAAGG - Intronic
1135082514 16:19448508-19448530 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1135565420 16:23508015-23508037 CCTCAGGTGGAGGAGATAAAAGG - Intronic
1135566669 16:23516507-23516529 CTTAAGCAGGAGCAGATGGAAGG - Intronic
1136028397 16:27484977-27484999 CCAGAGCTGGAGCAGATGGAGGG + Intronic
1136108400 16:28048117-28048139 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1136452325 16:30360321-30360343 CCTCAAGAAGAGCAGATCTAGGG - Intronic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1138461118 16:57148430-57148452 CCCAAGGAGGAGCAGATGGGTGG - Intergenic
1138476327 16:57272438-57272460 TCTCTGGAGGGGCCGATGGAAGG - Intronic
1138853252 16:60656111-60656133 CCTCACCAGAAGCAGATGCATGG - Intergenic
1139673151 16:68505390-68505412 CACCAGGATGAGCGGATGGAAGG - Intergenic
1139964305 16:70737063-70737085 GCTCAGGAGGAGGAGATGGGTGG + Intronic
1140212740 16:72983596-72983618 ACTCAGGAGGATGAGATAGAAGG + Intronic
1140285434 16:73598524-73598546 ACTCAGGAGGGTGAGATGGAAGG - Intergenic
1140346363 16:74217003-74217025 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1140483300 16:75274533-75274555 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1140634870 16:76900377-76900399 GCACAGGAGGAGCATATGGTAGG - Intergenic
1141181070 16:81753830-81753852 CTCCAGGAGAAGCAGCTGGAGGG + Intronic
1141968539 16:87463926-87463948 ACTCAGGAGGCTCAGGTGGAAGG - Intronic
1142133406 16:88441130-88441152 CCCCAGGAGGAACAGACGGGAGG + Intergenic
1142273694 16:89104604-89104626 CGGCAGGAGAAGCAGAGGGAAGG - Intronic
1142286342 16:89173062-89173084 CCTCAGGGGCAGCTGCTGGAGGG - Intronic
1142771401 17:2099969-2099991 ACTCAGGAGGCTGAGATGGAAGG - Intronic
1142812096 17:2400210-2400232 CCTCGGGAAGAGCAGATGAACGG - Intronic
1142965283 17:3577230-3577252 GCCCAGGAGGAGCTGAGGGAAGG + Intronic
1143288893 17:5813683-5813705 CAGCTGGAGGAGCAGTTGGAAGG - Intronic
1143390059 17:6555134-6555156 CCTCAGGAGGGGAAAAGGGAGGG + Intronic
1143705280 17:8693449-8693471 CCACTGGCGGAGCGGATGGAGGG - Intergenic
1144562174 17:16329768-16329790 CCTGAGGAGGCTCAGAAGGAGGG + Intronic
1145283483 17:21486211-21486233 ACTCAGGAGGCCGAGATGGAAGG - Intergenic
1145817059 17:27803000-27803022 ACTCAGGAGGATCAGGTGGGAGG + Intronic
1145886346 17:28384833-28384855 CCCCAGGAGCAGCAGGTGGATGG + Exonic
1146147877 17:30437574-30437596 CCTCAGGAGGGTGAGGTGGAAGG + Intronic
1146285115 17:31569203-31569225 CTTTAGGAGGATCAGGTGGAAGG - Intergenic
1146721263 17:35125328-35125350 ACTCAGGAGGTGGAGGTGGACGG + Intronic
1146957669 17:36946245-36946267 CCGCAGGAGGCGCAGCAGGAGGG + Intergenic
1147184787 17:38707200-38707222 CCTGAGGTGGGGCAGAGGGAGGG - Intronic
1147329682 17:39690192-39690214 ACTCAGGAGGCTGAGATGGAAGG - Intronic
1147424455 17:40339357-40339379 CCTGAGAAGGAGCTGAGGGAGGG + Intronic
1147899745 17:43776328-43776350 CAACAGGATGAGCAGAGGGATGG + Intronic
1148189150 17:45666765-45666787 CCACAGGCAGAGCACATGGAAGG - Intergenic
1148536490 17:48443329-48443351 CCTCAGGAGGAGAAGACAGGTGG - Intergenic
1148637709 17:49161453-49161475 ACTCAGGAGGCGGAGATGGGAGG + Intronic
1148876911 17:50693601-50693623 CCTCCAGAGGAGCAGCTGCAGGG - Exonic
1149560510 17:57604885-57604907 GCTGAGGAGGAGCAGCTGGAAGG - Intronic
1150118330 17:62575803-62575825 ACTCAGGAGGCTGAGATGGAAGG - Intronic
1150193324 17:63266956-63266978 ACTCAGGAGGCTCAGATGGGAGG - Intronic
1150231769 17:63556917-63556939 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1150423182 17:65056634-65056656 CCGCCGGAGGAGGAGGTGGAGGG - Exonic
1150717673 17:67585694-67585716 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1151851665 17:76694214-76694236 CCTCAGGACAAGCACATGGTAGG - Intronic
1152321000 17:79608867-79608889 CCGCAGGAGGCGGAGAAGGAAGG + Intergenic
1152580259 17:81162631-81162653 CCTCAGGATGAGCCTATTGATGG - Intronic
1152638377 17:81439447-81439469 CCTGGGGAGCAGCAGTTGGACGG + Intronic
1153029270 18:698727-698749 ACTCAGGAGGCGGAGGTGGAAGG - Intronic
1153181635 18:2441767-2441789 CCTGAGGAGGAACAGAGGGCTGG - Intergenic
1154022226 18:10674252-10674274 CCTCAGGAAGAGCTTGTGGAGGG + Intronic
1154027601 18:10723450-10723472 CTGCAATAGGAGCAGATGGAGGG + Intronic
1154307554 18:13241636-13241658 AGTCAGGAGGAGGAGCTGGAAGG - Intronic
1154953748 18:21235038-21235060 ACTCAGGAGGCTCAGGTGGAAGG - Intergenic
1155629735 18:27878413-27878435 CTTCAGGAGGAACAGATTCAGGG + Intergenic
1155835004 18:30569829-30569851 CCTCAGTAGGAAGAAATGGATGG - Intergenic
1156074285 18:33254724-33254746 GAAGAGGAGGAGCAGATGGAAGG + Intronic
1156257431 18:35411118-35411140 AATGAGGAGGAGGAGATGGAAGG + Intergenic
1156329882 18:36110880-36110902 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1156485393 18:37462382-37462404 CCTCCGGAGGAGCAGACACAAGG - Intronic
1156737778 18:40282401-40282423 ACTCAGAAGGTGAAGATGGAGGG + Intergenic
1157831368 18:50859779-50859801 CCTGCAGAGGAGGAGATGGAAGG - Intergenic
1157937659 18:51891094-51891116 CCTCATGGGGAGGTGATGGAAGG + Intergenic
1158608261 18:58915418-58915440 CCTTAGGTGGAGTAGAGGGATGG + Intronic
1158852692 18:61511253-61511275 ACTCAGGAGGATGAGGTGGAAGG + Intronic
1158923918 18:62230217-62230239 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1158968428 18:62643921-62643943 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1159649060 18:70955693-70955715 ACTCAGGAGGCGGAGATGGAAGG - Intergenic
1160074119 18:75655589-75655611 CCTCTGGAGGAGGAGCGGGAGGG + Intergenic
1160621094 18:80171238-80171260 CCACAGGAGGAGGACTTGGAGGG - Exonic
1160663869 19:313781-313803 GCCCAGGAGGAGCACAGGGATGG - Intronic
1160691461 19:462151-462173 CCGCGGGAGGAGCAGATCGTGGG + Intergenic
1162118509 19:8446516-8446538 ACTCAGGAGGCTGAGATGGAAGG - Intronic
1162677446 19:12310332-12310354 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1162776993 19:12985897-12985919 CCTATGGAGGGGAAGATGGAGGG - Intergenic
1163121574 19:15221570-15221592 CCTCAGGAGGCTGAGATGGGAGG - Intergenic
1163373242 19:16914364-16914386 GCACTGGAGGAGCAAATGGAAGG - Intronic
1163402253 19:17101284-17101306 CCTCAGGAGGCTGAGATGGGAGG - Intronic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1163561949 19:18024508-18024530 ACTCAGGAGGATGAGGTGGAAGG - Intergenic
1165421839 19:35725897-35725919 TCTCAGGAGGAGCAGAGGTTGGG + Intronic
1165422197 19:35727798-35727820 CACCAGGAGGAGCAGGTGGGTGG + Intronic
1165753723 19:38278691-38278713 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1166146129 19:40836952-40836974 CCTCAGGAGGATGAGGTGGGAGG - Intronic
1166657225 19:44621172-44621194 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1166671902 19:44715265-44715287 CAGCAGGAGGGGCAGAAGGAGGG + Intergenic
1167065248 19:47180712-47180734 ACTCAGGAGGATGAGATGGGAGG + Intronic
1167115823 19:47488499-47488521 TCTGAGGAGGAGTAGAGGGAGGG + Intronic
1167457029 19:49601708-49601730 CCTCAGGAGGAGCAGCCAGTGGG - Exonic
1167463060 19:49636396-49636418 CCTCAGGAGAGGCTGCTGGACGG - Intronic
1167761120 19:51450001-51450023 GCTCAGGAGGGACAGAGGGAGGG - Intergenic
1168339856 19:55616664-55616686 CCGCAGGAGGAGCAGCGGAAGGG - Exonic
1202679145 1_KI270711v1_random:36033-36055 CCTCATTAGGAGCAGATGCGGGG - Intergenic
925190232 2:1876490-1876512 GCTCAGGAGCCCCAGATGGACGG - Intronic
925642234 2:5996729-5996751 ACTCTGGAGGATAAGATGGAAGG + Intergenic
926028999 2:9569269-9569291 ACTCAAAAGGAGCAGCTGGAAGG + Intergenic
926186153 2:10692445-10692467 ACTCAGGAGGATAAGGTGGAAGG - Intergenic
926191832 2:10734234-10734256 GCTCAGCAGGGGCAGATGGGAGG - Intronic
926309642 2:11666228-11666250 CCTCTGGGGCAGCAGCTGGAAGG - Intronic
926707039 2:15844235-15844257 CCTCAGGTGGAACTGATGGATGG + Intergenic
927377345 2:22433389-22433411 CTTCAGAAGGAGCACATGGCAGG - Intergenic
928016662 2:27664041-27664063 CCTGAGGAGGTACAGAAGGAAGG + Exonic
929018661 2:37527941-37527963 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
929192443 2:39151924-39151946 TTTCAGGAGGAGAACATGGATGG - Intergenic
930639226 2:53838247-53838269 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
931116803 2:59174197-59174219 CCACAGGAGGAGGGAATGGAGGG + Intergenic
931278914 2:60770730-60770752 ACTCAGGAGGCTCAGGTGGAAGG - Intronic
931724028 2:65091632-65091654 ACTCAGGAGGCTCAGGTGGAAGG - Intronic
931846999 2:66214324-66214346 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
932283284 2:70512923-70512945 AATCAGGAGGAGCAGGAGGAAGG + Intronic
932446619 2:71785690-71785712 CCCCAGGAGGGGCAGAAGAAAGG - Intergenic
932623019 2:73277228-73277250 CCTCAGCTCCAGCAGATGGAGGG - Intronic
932735880 2:74254323-74254345 GCTAAGGAGGAGCAGGAGGAAGG - Intronic
933105919 2:78325081-78325103 ACTCAGGAGGTGGAGGTGGAAGG - Intergenic
933638640 2:84735048-84735070 ACTCTGAAAGAGCAGATGGAGGG - Intronic
933744003 2:85557376-85557398 ACTCAGGAGGCTGAGATGGAAGG + Intronic
934030818 2:88044965-88044987 ACTCAGGAGGCTGAGATGGAAGG - Intronic
935346591 2:102113773-102113795 CATCATGGGGAGGAGATGGATGG - Intronic
935978434 2:108602872-108602894 GCTCAGGAGGATGAGATGGGAGG - Intronic
936376546 2:111946062-111946084 CCTCAGGGAGCACAGATGGAAGG + Intronic
936612053 2:114011011-114011033 ACTCAGGAGGTGGAGCTGGAAGG + Intergenic
937084552 2:119162025-119162047 GCTCAGGAGGAGCAGAAGCCAGG - Intergenic
937922720 2:127143228-127143250 CCTTTGGAGGAGCAGAAGGATGG - Intergenic
938894591 2:135737683-135737705 CCTCAGGAGGCTAAGGTGGAAGG - Intergenic
939081988 2:137673684-137673706 CCTCAGGAGGAGGAGCTGAGGGG - Intronic
939196358 2:138978186-138978208 ACTCAGGAGGCTAAGATGGAAGG - Intergenic
939636402 2:144587942-144587964 ACTCAGGAGAAGAAGAAGGAAGG + Intergenic
939704286 2:145432595-145432617 CCTAGGGGGGAGCAAATGGATGG - Intergenic
940284918 2:152024212-152024234 ACTCAGGAGGCTGAGATGGAAGG + Intronic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
941795825 2:169597400-169597422 ACTCAGGAGGATCAGGTGGGAGG - Intronic
943354817 2:186839898-186839920 GTTCAGGAGTAGGAGATGGAAGG - Intronic
943507139 2:188775355-188775377 ACTCAGGAGGCTGAGATGGAAGG - Intronic
944643654 2:201755145-201755167 ACTCAGGAGGCTGAGATGGAAGG + Intronic
945051118 2:205825138-205825160 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
946154160 2:217796287-217796309 GCACAGGAGGGGCAGAGGGATGG - Intergenic
947570491 2:231230252-231230274 ACTCAGGAGGCTGAGATGGAAGG + Intronic
948454154 2:238097001-238097023 CCCTAGGAGGGGCAGAGGGAGGG + Intronic
948472240 2:238191061-238191083 GCTCAGGAGGCTGAGATGGAAGG - Intronic
948502084 2:238402785-238402807 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
948596594 2:239083311-239083333 CCTTAGGAGGAGCTGAGGGAGGG + Intronic
948599422 2:239099901-239099923 CCTGAGGAAGAACAGCTGGAGGG + Intronic
948787546 2:240360118-240360140 CCACACAAGGAGCAGAGGGATGG + Intergenic
1169402838 20:5297850-5297872 CCCCAGGAAAAGCAGGTGGAGGG - Intergenic
1169614168 20:7420676-7420698 ACTCAGGAGGCTAAGATGGAAGG - Intergenic
1170648920 20:18221564-18221586 ACTCAGGAGAAACAGAGGGAGGG - Intergenic
1171213048 20:23331606-23331628 ACTCAGGAGGAAGAGACGGAGGG + Intergenic
1171519002 20:25761326-25761348 CCTCAGAAGAAGCAGAGGGAGGG - Intergenic
1171793029 20:29545840-29545862 ACAGAGGAGGAGCAGATGGTAGG + Intergenic
1172085953 20:32382675-32382697 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1172257217 20:33529628-33529650 CCTCAGGAGGCTGAGATGGGAGG + Intronic
1172958873 20:38782898-38782920 ACTCAGGAGGATCAGATGGGTGG + Intergenic
1173265610 20:41477130-41477152 ACTCAGGAGGAGTAGGTGGGAGG + Intronic
1173372174 20:42446864-42446886 TCTCAGGATTACCAGATGGAAGG - Intronic
1174454748 20:50641321-50641343 ACTCAGGAGGCGGAGATGGGAGG - Intronic
1174549428 20:51351306-51351328 CCTCAGGAGGCTGAGGTGGAAGG - Intergenic
1174805653 20:53602233-53602255 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1174917874 20:54672209-54672231 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1175750711 20:61495341-61495363 CCCCAGGAGGAGCTGTGGGAGGG + Intronic
1176044513 20:63085415-63085437 GCTCAGGAACAGCAGAGGGAGGG + Intergenic
1176052775 20:63129286-63129308 CCTCCTGAGGAGCAGGTGGACGG - Intergenic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1177785466 21:25666643-25666665 CCTCAGGAGGATGAGGTGGGAGG - Intronic
1179494085 21:41760739-41760761 CCCCAGGAGGAGCAGCTGGGGGG + Intronic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1180136407 21:45865186-45865208 CGTCAGGTGGAGCAGAAGAATGG - Intronic
1180942527 22:19668659-19668681 TCTAAAGAGGAGGAGATGGAGGG - Intergenic
1181105983 22:20575626-20575648 CCTCAGGAGGCCGAGATGGGAGG + Intronic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1181280141 22:21714010-21714032 TCTCAGGAGGAGCAGGTGTGAGG - Intronic
1181636010 22:24175232-24175254 CCTCAGGCAGAGCAGCTGGATGG + Intronic
1181947645 22:26530645-26530667 AATCAGCAGGAGCAGGTGGAAGG + Intronic
1182236937 22:28883579-28883601 CCTCACGTGGAGCAGATGAAAGG + Exonic
1182681088 22:32080475-32080497 CCTCAGGAGCAGCAATGGGATGG + Intronic
1183455216 22:37918869-37918891 CCCCAGGAGGGGCAGAGGGCAGG - Intronic
1183500100 22:38173648-38173670 CCCCTGGAGGAGCTGAAGGACGG + Intronic
1184122079 22:42458206-42458228 CCTTAGGCAGAGGAGATGGAAGG + Intergenic
1184426792 22:44413731-44413753 CCTCAGGAGGAGGAGGAGGAGGG + Intergenic
1184835136 22:47016507-47016529 CCTCAGGATGAGCCAATGGAGGG - Intronic
1184863324 22:47189153-47189175 CCTCAGGAGGGACAGAGGGGCGG + Intergenic
949983508 3:9519665-9519687 GCTCAGGAGGATGAGGTGGAAGG - Intronic
950020943 3:9787270-9787292 CTGCTGGAGGAGCAGAAGGATGG - Exonic
950107513 3:10397638-10397660 CCTCAGCAGAGGCAGATTGAAGG + Intronic
950634091 3:14303045-14303067 CCTCAGGGTGGGCAGAAGGAAGG - Intergenic
951551206 3:23876933-23876955 ACTCAGGAGGCTGAGATGGAAGG + Intronic
952250004 3:31644092-31644114 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
952443264 3:33355036-33355058 ACTCAGGAGGTGGAGATGGTAGG - Intronic
953311827 3:41887918-41887940 CTTTAGGAGGATGAGATGGAAGG + Intronic
954423037 3:50428663-50428685 CCCCATGAGGCTCAGATGGATGG - Intronic
955678777 3:61478213-61478235 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
955743249 3:62114751-62114773 GCTCAGGAGGTTGAGATGGAAGG - Intronic
956758591 3:72416056-72416078 ACTCAGGAGGTCAAGATGGAAGG + Intronic
957687480 3:83520755-83520777 AAAAAGGAGGAGCAGATGGAGGG - Intergenic
959048665 3:101502805-101502827 ACTCAGGAGGCTGAGATGGAAGG + Intronic
960218028 3:115066702-115066724 CCACAGGAGATGAAGATGGAGGG - Intronic
960391427 3:117081774-117081796 CCTCAGGAGGCTGAGATGGGAGG + Intronic
960667300 3:120122654-120122676 ACTCAGGAGGCTCAGGTGGAGGG - Intergenic
960782612 3:121336386-121336408 ACTCAGGAGGCTGAGATGGAAGG + Intronic
961128281 3:124441715-124441737 ACTCAGGAGGCTGAGATGGAAGG + Intronic
962732710 3:138298664-138298686 CCTAAGGAGAAGAGGATGGAGGG - Intronic
963025268 3:140913096-140913118 CCCCAAGAGGAGCAGTTTGAGGG - Intergenic
963313553 3:143734086-143734108 TCTCAGGAGGCTGAGATGGAAGG + Intronic
963616798 3:147549709-147549731 CCTCACGAGAAGCAGATGCCAGG + Intergenic
963740346 3:149073583-149073605 ACTCAGGAGGCTCAGGTGGAAGG + Intronic
963781960 3:149495374-149495396 CATCTGGAGGGGCAGATGCAAGG - Intronic
963907891 3:150788412-150788434 TCTCAGGAGGAGGTGATGGCAGG + Intergenic
964054493 3:152436027-152436049 CCTCAGGAGGAGGAAATAAAAGG - Intronic
964215029 3:154270418-154270440 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
964341136 3:155709724-155709746 ACTCAGGAGGTTGAGATGGAAGG - Intronic
965347732 3:167572920-167572942 CCTGAGGAGAAGCAGAGGTAGGG + Intronic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966734803 3:183179968-183179990 CCTGAGGAGGGGGAGAGGGATGG + Intronic
967653348 3:192014496-192014518 CCTCAGGAGGTGGAGGTGGGAGG - Intergenic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
967846362 3:194046221-194046243 CACGAGCAGGAGCAGATGGATGG + Intergenic
968268133 3:197378349-197378371 CGACAGGAGGAGCAGACGGCAGG - Intergenic
968679404 4:1906345-1906367 ACTCAGGAGGCTGAGATGGAAGG - Intronic
968690476 4:1987420-1987442 AATCAGGAAGGGCAGATGGAGGG + Intronic
969031913 4:4222412-4222434 CGGCAGGAGGAGCAAAAGGAGGG - Intronic
969109643 4:4835775-4835797 CCTCAGGAGGCTGAGGTGGAAGG + Intergenic
969115653 4:4869238-4869260 CCTGATTAGGGGCAGATGGAAGG + Intergenic
969171920 4:5370862-5370884 ACTCAGGAGGCTGAGATGGATGG + Intronic
969209742 4:5677675-5677697 GCTCAGGAGGAGGAGGTGGCTGG - Intronic
969666005 4:8557980-8558002 GATCAGGAGGGGCAGATGGGAGG - Intergenic
969717906 4:8877336-8877358 CCTGAGGAGGAGGAGATGGGAGG + Intergenic
970056799 4:11983060-11983082 CCTCAGGAGAATCAGATGGAAGG - Intergenic
970939964 4:21620391-21620413 ACTCAGGAGGCTGAGATGGAAGG + Intronic
971228952 4:24782104-24782126 CCTTAGGAGGAAGAGAAGGATGG - Intergenic
971326349 4:25647628-25647650 CCTCAGGAGGCTGAGATGGAAGG - Intergenic
971407103 4:26331846-26331868 CCTCTGGAAGGGAAGATGGAAGG + Intronic
971909965 4:32783259-32783281 CCTCAGTATGTGCACATGGAGGG + Intergenic
972305046 4:37822876-37822898 TCACATGAGAAGCAGATGGAAGG + Intergenic
972469457 4:39389713-39389735 CTTTAGGAGGTGGAGATGGAAGG - Intergenic
972473196 4:39426794-39426816 ACTCAGGAGGATTAGATGGAAGG - Intronic
972482128 4:39506912-39506934 ACTCAGGAGGCTCAGGTGGAAGG + Intronic
972513825 4:39794277-39794299 CCTCAGGAGGCTCAGATGGGAGG - Intergenic
972551546 4:40139906-40139928 ACTCAGGAGGGGGAGATGGGAGG - Intronic
972730506 4:41789999-41790021 CTTAAGGAGGAGAAGAAGGAAGG - Intergenic
975175368 4:71282689-71282711 ACTCAGGAGGCTGAGATGGAAGG - Intronic
975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG + Intergenic
975863819 4:78705245-78705267 GCTCAGGTGAAGCAGAAGGATGG - Intergenic
976245352 4:83001439-83001461 ACTCAGGAGGCTCAGGTGGAAGG + Intronic
976300909 4:83514649-83514671 CCTCAGTATGAGCAGTTGGCTGG - Intronic
977024660 4:91802129-91802151 CCTCAGGAGAAGGAGAGGGATGG - Intergenic
978345374 4:107762155-107762177 CCGGGGGAGGAGGAGATGGAAGG + Intergenic
980627257 4:135389565-135389587 CCTCACCAGGAGCAGATGCTGGG + Intergenic
983198116 4:164830775-164830797 ACTCAGGAGGGCCAGGTGGAAGG - Intergenic
983523598 4:168736871-168736893 CCTCAGGAGAAACAGTGGGAGGG + Intronic
984588711 4:181592292-181592314 TTTGAGGAGGAGCAGATAGAAGG - Intergenic
985074184 4:186196336-186196358 ACTCAGGAGGTCCTGATGGACGG + Intronic
985121752 4:186650155-186650177 CCTCAGGAGGAGGAGAGAGCAGG + Intronic
985563488 5:603672-603694 CCTCTGTCTGAGCAGATGGAGGG + Intergenic
985693553 5:1326969-1326991 CCTGTGGAGGAGGAGCTGGATGG - Intronic
986280095 5:6315703-6315725 GCTCAGCAGGAGCAGGAGGAAGG - Intergenic
986473100 5:8095027-8095049 CCTCAGGAAGAGCAGAGGCCAGG - Intergenic
986591216 5:9372916-9372938 CCGCAGGAGGAGCAGGTGGCAGG + Intronic
987143818 5:14971630-14971652 CCTCAGGAGGCTGAGATGGGAGG + Intergenic
987687323 5:21221303-21221325 ACTCAGGAGGATCAGACTGAAGG + Intergenic
988213263 5:28236473-28236495 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
990632789 5:57689071-57689093 GCTCTGCAGGAGCAGGTGGATGG + Intergenic
991114619 5:62939750-62939772 ACTCAGGAGGTTGAGATGGAAGG + Intergenic
991981530 5:72236583-72236605 TCTCAAGAGGAGGAAATGGAAGG - Intronic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
992816499 5:80445834-80445856 ACTCAGGAGGATGAGATGGGAGG - Intronic
993844037 5:92917907-92917929 CCTCATCAGGAGGAGATGAAAGG + Intergenic
993961283 5:94299323-94299345 ACTCAGGAGGCTGAGATGGAAGG - Intronic
994095276 5:95842207-95842229 CCTCAGGAGGAACAAGTGGGTGG + Intergenic
994261960 5:97669983-97670005 CTTCAGGAGGCTGAGATGGAAGG - Intergenic
995004897 5:107180682-107180704 ACACAGCAGGAGCAGAAGGAAGG + Intergenic
995391450 5:111644771-111644793 CCTGAGGATCAGCAGATGGGTGG - Intergenic
996564188 5:124862648-124862670 ACTCAGGAGGCTCAGGTGGAAGG + Intergenic
996629722 5:125612893-125612915 CTTCAAAAGGAGCAGATGAATGG + Intergenic
997049668 5:130364766-130364788 ACTCAGGAGGTGAAGATGGGAGG - Intergenic
997299884 5:132795673-132795695 ACTCAGGAGGCTGAGATGGAAGG - Intronic
997958556 5:138300089-138300111 TCTCAGGAGGCGGAGGTGGAAGG + Intronic
997966610 5:138361960-138361982 CTTGGGGAGCAGCAGATGGAGGG + Intronic
998943639 5:147313124-147313146 ACTCAGGAGGCTGAGATGGAAGG + Intronic
999408359 5:151326919-151326941 CCTCAGGAGGCTGAGATGGGAGG - Intronic
999721217 5:154400525-154400547 CCCCAGGTGGAGCAGTTGGAAGG + Intronic
999880553 5:155859167-155859189 CCTCAGGAGGCTAAGGTGGAAGG - Intergenic
1001598917 5:172916288-172916310 CCTCAGGAGGAGGAGATACCAGG + Intronic
1002005119 5:176226288-176226310 CCTCAGGAGCAGCAGATATGAGG + Intergenic
1002221257 5:177684337-177684359 CCTCAGGAGCAGCAGATATGAGG - Intergenic
1002434304 5:179221635-179221657 CCTCAGGAGGCGCAGGGGCATGG - Intronic
1002465067 5:179404133-179404155 CTGGAGGAGGAGCAGATGGATGG + Intergenic
1002466157 5:179409952-179409974 ACTCAGATGGCGCAGATGGAGGG - Intergenic
1002842406 6:917617-917639 TGTCAAGAGGAGGAGATGGATGG + Intergenic
1003110576 6:3249321-3249343 CCTCAGGAGGCTCAGGTGGGAGG - Intronic
1003949059 6:11101495-11101517 CTTCCGAAGGAGGAGATGGAAGG + Intronic
1004456079 6:15792619-15792641 CATCAGCAGGAACACATGGAGGG + Intergenic
1004960023 6:20777504-20777526 CCTCAGGAGGCTGAGATGGAAGG + Intronic
1005389301 6:25317237-25317259 ACTCAGGAGGTTGAGATGGAAGG - Intronic
1005686334 6:28256318-28256340 ACTCAGGAGGCTCAAATGGAAGG + Intergenic
1005802950 6:29445589-29445611 CCACAGGAGGAGCTGATGCAGGG - Intronic
1005881476 6:30065362-30065384 GCTCAGGAGGAGGAAAAGGAGGG - Intergenic
1006020527 6:31115121-31115143 CCTCTGTGGGAGCAGCTGGAAGG + Exonic
1006633751 6:35447622-35447644 CCTCAGGAGGAGAAAAAAGAGGG + Intergenic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1006878027 6:37315446-37315468 ACTCAGGAGGTTGAGATGGAAGG + Intronic
1009408517 6:63337693-63337715 ACTCAGGAGGCTCAGATGGGAGG + Intergenic
1010048938 6:71481003-71481025 CCTCAGGAGGTGGAGATAGTGGG - Intergenic
1010414044 6:75593541-75593563 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1011106196 6:83784331-83784353 TCACAGGAGGAACAGATGGGAGG + Intergenic
1011679477 6:89768943-89768965 GCTCAGGAGGCTGAGATGGAAGG + Intronic
1012190871 6:96277942-96277964 ACTCAGGAGGATGAGATGGGAGG - Intergenic
1012857987 6:104525973-104525995 CCTCAGGAGGAATAAATAGAAGG + Intergenic
1015132971 6:129835287-129835309 ACTCAGGAGGTGGAGATGGGAGG + Intronic
1015369655 6:132436531-132436553 ACTCAGGAGGATGAGATGGGAGG + Intergenic
1015874351 6:137808021-137808043 GCTCTGGAGGAGCAACTGGATGG - Intergenic
1015924669 6:138296843-138296865 CCCCAGGCGGAACAGGTGGAGGG - Exonic
1017007738 6:150040072-150040094 CCTCAGGAGGCTAAGGTGGAAGG - Intergenic
1018504322 6:164448195-164448217 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1018662390 6:166100274-166100296 CCTCAGGAGGCTGAGGTGGATGG - Intergenic
1019136617 6:169912460-169912482 CCTCAAGGGGAGCAGACAGATGG - Intergenic
1019376601 7:696075-696097 ACTCAGGAGGCTGAGATGGAGGG - Intronic
1019400952 7:853538-853560 GCTCGGGTGGACCAGATGGAAGG + Exonic
1020155410 7:5719264-5719286 ACTCAGGAGGTTGAGATGGAAGG + Intronic
1021523747 7:21563315-21563337 CCTCAGGAGGCTGAGGTGGAAGG - Intronic
1022230003 7:28405519-28405541 ACTCAGGAGGCTGAGATGGAAGG - Intronic
1022272307 7:28820710-28820732 ACTCAGGAGGCGGAGGTGGAAGG - Exonic
1023433602 7:40119449-40119471 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1023700198 7:42884226-42884248 ACTCAGGAGGCTCAGGTGGAAGG + Intergenic
1025025259 7:55511273-55511295 CCTCAGGGAGAGCAGTCGGACGG + Intronic
1025251038 7:57351697-57351719 ACTCAGGAGGTGGAGATGGGAGG - Intergenic
1025724120 7:64042320-64042342 CCTCAGGTGGTGCCAATGGAAGG + Intronic
1025887776 7:65614526-65614548 AAGGAGGAGGAGCAGATGGAAGG - Intergenic
1026158963 7:67852272-67852294 AGTGAGGAGGAGCAGAAGGATGG + Intergenic
1026228847 7:68465974-68465996 ACTCAGGAGGATAAGATGGGAGG + Intergenic
1026610647 7:71856844-71856866 ACTCAGGAGGCTCAGGTGGAAGG + Intronic
1027178791 7:75922861-75922883 GCAAAGGAGGAGCAGAGGGAAGG + Intronic
1027274978 7:76547957-76547979 ACTCAGGAGGCCGAGATGGAAGG - Intergenic
1028408333 7:90500551-90500573 CCTCAGGAGTAACACATGTAAGG + Intronic
1029000455 7:97149036-97149058 ACTCAGGAGGCGCAGGTGGGAGG - Intronic
1029486766 7:100847709-100847731 CCACAGGAGGAGCAGGTGGTGGG + Intronic
1029530323 7:101121244-101121266 CCTCAGGAGGCTGAGATGGGAGG + Intergenic
1029701128 7:102247710-102247732 ACTCAGGAGGCTCAGATGGGAGG + Intronic
1030280557 7:107770363-107770385 ACTCAGGAGGTTGAGATGGAAGG - Intronic
1030317366 7:108129644-108129666 ACTCAGGAGGTTGAGATGGAAGG - Intronic
1031854601 7:126907184-126907206 AAGGAGGAGGAGCAGATGGAAGG + Intronic
1031957353 7:127955925-127955947 GCTCAGGAAGAGCGGATGGTGGG - Intronic
1031975288 7:128089786-128089808 CCTCAGCAGGAACAGCAGGATGG - Intronic
1033298927 7:140168457-140168479 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1034313336 7:150109534-150109556 CGTCAGGCTGAGTAGATGGATGG - Intergenic
1034607543 7:152331197-152331219 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1035010843 7:155713911-155713933 CCACAGCTGGGGCAGATGGATGG + Intronic
1038044433 8:23754136-23754158 ACTCAGGAGGCTGAGATGGAAGG - Intergenic
1038159875 8:25026306-25026328 ACTCAGGAGGTTGAGATGGAAGG + Intergenic
1038239769 8:25797730-25797752 CCAGAGGAGGAACAGAAGGATGG + Intergenic
1038393011 8:27222852-27222874 CCTCAGGATGAGAATATGGGAGG - Intergenic
1038553473 8:28489589-28489611 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1038631877 8:29253233-29253255 TCTCAGGAGGCTGAGATGGAAGG + Intronic
1039038063 8:33381026-33381048 ACTCAGGAGGCTGAGATGGAAGG + Intronic
1040500982 8:48004934-48004956 ACTCAGGAGGATGAGATGGGAGG - Intergenic
1040505488 8:48044267-48044289 CCTCAGGAGGCTGAGGTGGAAGG - Intronic
1040592957 8:48812449-48812471 CCTCGGGAGGCTGAGATGGACGG - Intergenic
1041063808 8:54061671-54061693 ACTCAGGAGGATGAGGTGGAAGG + Intronic
1041235116 8:55793381-55793403 CCTCAGGAGGCTGAGATGGGAGG + Intronic
1041260880 8:56019602-56019624 CCTCAGGTGGGGCCGGTGGATGG + Intergenic
1041269117 8:56093676-56093698 CAGCAGAAAGAGCAGATGGAGGG - Intergenic
1041384082 8:57280132-57280154 GCACAGGAGGAGCAGCTGCAGGG + Intergenic
1041701543 8:60795082-60795104 CTTCAGGAGGAGGAGATGGTGGG - Exonic
1042104127 8:65306545-65306567 CCTCAGGAGGCAGAGGTGGAAGG - Intergenic
1043405432 8:79927661-79927683 CCCCAGGAGGCAAAGATGGAGGG + Intronic
1043440838 8:80275935-80275957 CCCCAGGAGTAGCAGCTGGCAGG - Intergenic
1043844053 8:85143528-85143550 CCTCAGGAGGCTGAGATGGGAGG + Intronic
1045696570 8:104815553-104815575 ACTCTGGAGGAGGAGATGGGAGG - Intronic
1046020945 8:108663954-108663976 TCTCAGGTTGAGCAGAGGGAGGG + Intronic
1047238973 8:123068392-123068414 CACCAGGTGGATCAGATGGATGG + Intronic
1048001140 8:130380425-130380447 CCTCAGGAGCAGCAGCCTGAGGG + Intronic
1048592574 8:135834399-135834421 CAGCATGAGGAACAGATGGAGGG + Intergenic
1049100766 8:140577593-140577615 CTTGAGGAGGAGCAGCTGGAGGG + Intronic
1049543780 8:143220251-143220273 CCTAAGGAGGAGGAAAGGGATGG - Intergenic
1049908091 9:237544-237566 ACTCAGGAGGCCAAGATGGAAGG + Intronic
1050342432 9:4654359-4654381 CCTCTAGAGGAGCAGACAGACGG + Intronic
1051031454 9:12684989-12685011 CCTCCGGAGGAGGACTTGGAAGG - Intergenic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1051294258 9:15578341-15578363 ACTCAGGAGGCTGAGATGGAAGG - Intronic
1051731175 9:20144592-20144614 TCAGAGGAGGAGGAGATGGATGG + Intergenic
1052165136 9:25317347-25317369 CTTTAGGAGGAGCTCATGGAGGG + Intergenic
1053221388 9:36316071-36316093 CCCCAGGAGGAGCCAAAGGAGGG + Intergenic
1055196210 9:73597332-73597354 CCTCAGGTCAAGCAGATGGAGGG + Intergenic
1055478458 9:76686839-76686861 ACTCAGGAGGCGAAGATGGGAGG - Intronic
1055639698 9:78310083-78310105 CCTCAGCAGGAGCAGACACAAGG + Intronic
1056673926 9:88656860-88656882 CTTCAGGAGGCCAAGATGGATGG - Intergenic
1056974240 9:91236063-91236085 CATCAGGAAGTACAGATGGATGG + Intronic
1057391664 9:94645892-94645914 CATGAGGTGGAGCAGATGGGTGG - Intergenic
1057570468 9:96200585-96200607 CCTCAGGAGGATCAAAGGGAAGG - Intergenic
1058685731 9:107478044-107478066 CCTCAGGAGGCTGAGATGGGAGG + Intergenic
1059740217 9:117142857-117142879 CCTCTGGAGACACAGATGGAGGG - Intronic
1060269486 9:122130758-122130780 TCTCAGGAGGTGCGGAGGGATGG - Intergenic
1061496974 9:130980697-130980719 TCTAATGAGGAGCAGGTGGATGG - Intergenic
1061556266 9:131371461-131371483 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1062319901 9:135985810-135985832 ATTCAGGAGGAGCAGGAGGAAGG - Intergenic
1062364823 9:136203526-136203548 CCTCGGGAGCAGCAGATGGTCGG + Intronic
1062610019 9:137369430-137369452 CGGCAGGAGGAGCAGAGGGCGGG - Intronic
1203736669 Un_GL000216v2:144238-144260 CCACAGCAGGGGCAGATGCAAGG + Intergenic
1186101625 X:6163557-6163579 CCACAGAAGGAGCAGGTGGGAGG - Intronic
1186826928 X:13349693-13349715 CTTCAGGAGACGCAGATGGAAGG + Intergenic
1187082165 X:16002323-16002345 TCTCAGGAGGAGGAGATTAAGGG + Intergenic
1187293954 X:17981081-17981103 CAGCAGGAGGAGGAGAGGGAGGG - Intergenic
1188006962 X:25022277-25022299 GAGCGGGAGGAGCAGATGGAAGG + Intergenic
1189050995 X:37645381-37645403 CATCAGGAAAACCAGATGGAAGG + Intronic
1189993329 X:46614948-46614970 TCTCTAGAGGAGGAGATGGAAGG + Intronic
1190571028 X:51781661-51781683 ACTCAGGAGGCTGAGATGGAAGG + Intergenic
1192184832 X:68939935-68939957 CCTCAGGAGAAGCAGAAGGTGGG - Intergenic
1193288500 X:79742475-79742497 ACTCAGGAGGCTAAGATGGAAGG - Intergenic
1194975468 X:100392055-100392077 CCTCAAGAGGAGATCATGGAAGG - Intronic
1195051585 X:101101980-101102002 CCTCAGGAGGCTGAGATGGGAGG - Intronic
1195453078 X:105037458-105037480 GCTCAGGATGAGCAGAAGGGCGG + Intronic
1195628523 X:107029572-107029594 ACTCAGGAGGCTCAGGTGGAAGG + Intergenic
1196242024 X:113353208-113353230 CCTCAAGAGGAGAAGATTGGCGG + Intergenic
1196864852 X:120061537-120061559 ACTCAGGAGGATGAGGTGGAAGG + Intergenic
1196878249 X:120174795-120174817 ACTCAGGAGGATGAGGTGGAAGG - Intergenic
1197342535 X:125289933-125289955 ACTCAGGAGGATGAGATGGAAGG - Intergenic
1197377307 X:125697119-125697141 ACTCAGGAGGATGAGATGGGAGG + Intergenic
1197396439 X:125932968-125932990 GCTCAGGAGAAACAGAGGGATGG - Intergenic
1197571575 X:128156725-128156747 CATCAGGAGAAGCACATGGAAGG + Intergenic
1199643024 X:149881732-149881754 ACTCAAGAGGAGCAGAGGGAGGG + Intronic
1199976550 X:152897966-152897988 CCCCAGGAGGGGCAGAGGAAGGG + Intergenic
1200056961 X:153466627-153466649 CTACAGGAGAATCAGATGGATGG - Intronic
1200060804 X:153482923-153482945 CCTCAGCAGAAGCAGAGGCAGGG - Intronic
1201400017 Y:13594850-13594872 GGGCAGGAGGAGCAGACGGAAGG + Intergenic
1201914584 Y:19168512-19168534 CCTCAGGAGGTCCTGATGGTGGG - Intergenic
1202073279 Y:21014724-21014746 CATCAGGAGTAGAAAATGGAAGG - Intergenic
1202077979 Y:21056578-21056600 CATCAGGAGTAGAAAATGGAAGG - Intergenic
1202296564 Y:23364651-23364673 ACTAAGGAGGAGGAGAAGGAAGG - Intergenic
1202574243 Y:26305946-26305968 ACTAAGGAGGAGGAGAAGGAAGG + Intergenic