ID: 1095667709

View in Genome Browser
Species Human (GRCh38)
Location 12:44821459-44821481
Sequence TTTTAGTTCTTTAAGTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 443}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095667708_1095667709 24 Left 1095667708 12:44821412-44821434 CCAACACAGAAAATAATTCAGAA 0: 1
1: 0
2: 6
3: 72
4: 627
Right 1095667709 12:44821459-44821481 TTTTAGTTCTTTAAGTAAGTAGG 0: 1
1: 0
2: 1
3: 39
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095667709 Original CRISPR TTTTAGTTCTTTAAGTAAGT AGG Intronic
903407792 1:23113083-23113105 TTCTAGTTCTTTATGTAATTTGG - Intronic
903920970 1:26800454-26800476 TTTTTGTTCTTTAATGAAGGTGG + Intergenic
905697226 1:39983734-39983756 TTTTTGTACTTTAAGTAGATAGG + Intergenic
906802180 1:48747958-48747980 TTTTACTTCTGTAAGTAGATAGG + Intronic
907129539 1:52083575-52083597 ATTAGGTTCTTTAAGTAAGGTGG - Intronic
908286904 1:62615121-62615143 TATTATTTCTTTATGTAATTTGG + Intronic
908312261 1:62896146-62896168 TTTTTTTTTTTTAAGTATGTTGG + Intergenic
909125215 1:71659541-71659563 TTTTATTTCATTCAGTAGGTTGG - Intronic
909168739 1:72265430-72265452 TCTTAGTTATTTAATTAAATTGG - Intronic
909855106 1:80519706-80519728 TTTTAAAACTTTAAATAAGTAGG + Intergenic
909952438 1:81735970-81735992 TTTTAGTATTTTTAGTAAGACGG - Intronic
910213557 1:84818630-84818652 TTTAAGTTCTTTAAGTTGGGTGG - Intronic
910373536 1:86544318-86544340 TTTTATTACCTTAAGTATGTTGG - Intergenic
910406476 1:86896435-86896457 TTTTAGTGGGTTAAATAAGTGGG - Intronic
910718019 1:90253708-90253730 TTATAGTTCTTTAATTCATTTGG + Intergenic
911238818 1:95442041-95442063 TTTTGGTGTTTTATGTAAGTAGG + Intergenic
911241069 1:95467453-95467475 TATTAGTTCTTTTAGGAATTTGG + Intergenic
911994579 1:104749266-104749288 TTTTAGTTCTTTCAGTTGTTTGG - Intergenic
912010168 1:104949197-104949219 TTGTAGTTCTTTTAGTTTGTGGG - Intergenic
913429496 1:118775329-118775351 TTTTAGTTCTTTATATATTTTGG + Intergenic
914508186 1:148307467-148307489 TTTTAGTCCTTTGAATAATTGGG - Intergenic
916752145 1:167732875-167732897 TTTTAGTTCTTTAAATGTTTTGG + Intronic
917069552 1:171135241-171135263 TTTTAGTTGATTAAGTACCTGGG + Intergenic
917621405 1:176800248-176800270 TTTAACTTCTTAAATTAAGTTGG + Intronic
918019388 1:180670898-180670920 TTTTAGTACTTTGACTATGTTGG + Intronic
918360575 1:183752784-183752806 TTATAGTTCTTTGAGTACATTGG + Intronic
918411796 1:184266641-184266663 TTTTAATTTTTTAAATAATTAGG - Intergenic
918672574 1:187238295-187238317 TTTTAGCTCTTTAAGGAAGACGG - Intergenic
919580150 1:199361715-199361737 ATTTAGTTCTTTAAGCAACTTGG - Intergenic
921496474 1:215848282-215848304 TTTTAGTTTGTTAAGTGAGCAGG + Intronic
921699497 1:218251608-218251630 TATTTGTTCCTGAAGTAAGTAGG + Intergenic
922872852 1:228917194-228917216 TTTATTTTCTTTAAGTTAGTTGG + Intergenic
923183109 1:231542162-231542184 TTTTAGTTGTTTAAGGAGGGAGG + Intronic
923327413 1:232892952-232892974 TGTCAGTTTTTTGAGTAAGTAGG - Intergenic
924219823 1:241862389-241862411 TGTGAGTTCTTTACGTAAATGGG - Intronic
924716321 1:246577784-246577806 TTTTAGTTCTTTTCTAAAGTGGG - Intronic
924747234 1:246847474-246847496 TTTTAGAGTTTTCAGTAAGTAGG + Intronic
1063237532 10:4133723-4133745 TTTTAGTTTTTTTAGTATGCTGG - Intergenic
1063399272 10:5726250-5726272 TTTTAATGCTTTCAGTAACTGGG - Intronic
1063515312 10:6689309-6689331 TTTTTGTTTTTAAAGTAAGTTGG + Intergenic
1064299669 10:14112244-14112266 ATTTAATTCTCTAAGTAATTAGG + Intronic
1066215644 10:33284409-33284431 TTTTAGTTCTTGAATTATTTGGG + Intronic
1067375707 10:45726545-45726567 TTTTATTTTAGTAAGTAAGTTGG + Intergenic
1067883418 10:50067234-50067256 TTTTATTTTAGTAAGTAAGTTGG + Intergenic
1068065446 10:52125029-52125051 TTTTCTTTTTTTTAGTAAGTAGG + Intronic
1068679036 10:59799121-59799143 TTTTTTTTTTTTAAGTAAGTAGG - Intronic
1068859959 10:61838029-61838051 AGCTAGTTCTTTAAGTAAGGGGG + Intergenic
1068996130 10:63206705-63206727 TTTTGCTTCTTTTTGTAAGTTGG + Exonic
1069147559 10:64914796-64914818 TTTGAGTTCTTTAGGTATTTTGG + Intergenic
1069189053 10:65464904-65464926 TTTTATTTCTGTAAGTTATTGGG - Intergenic
1069967093 10:72129020-72129042 TTTTACTTTTATAAGTAAGGAGG + Intronic
1070067542 10:73051896-73051918 TTTCATTTCTTAAAATAAGTAGG - Intronic
1071261275 10:83921286-83921308 TTTGAGTTCTTTACGTATTTTGG - Intergenic
1071474664 10:86015758-86015780 TTTTAGCTGATTAAGTTAGTGGG + Intronic
1071973101 10:90928072-90928094 TTTTAGTTTTTAAAGTAATAGGG - Intergenic
1072056507 10:91762985-91763007 TTTTATTTCTTTCCGTAGGTAGG - Intergenic
1072351086 10:94557943-94557965 TTTTAGTTGTTTAAGGCAGGAGG + Intronic
1072354349 10:94592115-94592137 TTTAAGTTTTTTAAGTGACTTGG + Intronic
1072968595 10:99996513-99996535 TTTTATTTTTTTAATTTAGTTGG - Intronic
1074175169 10:110992685-110992707 TTTTAGTCATTTTAGTAATTGGG + Intronic
1076548051 10:131259376-131259398 TTTTAGTTCTTCATGTGAGATGG - Intronic
1078199020 11:9162874-9162896 TTTTTTTTCTTTAAGAAACTGGG + Intronic
1078588570 11:12617473-12617495 TTTTAGTTTTTTAAGCTAATTGG - Intergenic
1080650605 11:34219964-34219986 TTGGAGTTCTTTGAGTAAATGGG - Intronic
1081021240 11:37950276-37950298 TTTTAGATCTGAAAGTAATTGGG - Intergenic
1081089522 11:38846160-38846182 TGTAAGTTCTTTATGTAACTGGG - Intergenic
1081353730 11:42087900-42087922 TTTTTGTTTTTAAAGGAAGTTGG + Intergenic
1081436516 11:43033205-43033227 TAGTAGTTATTTAAGAAAGTTGG + Intergenic
1081629550 11:44679895-44679917 TTTTAGCTCATTAAGGAGGTTGG + Intergenic
1082937814 11:58672660-58672682 TTTTTGTTTTTTAAGTAATTTGG - Intronic
1084283209 11:68113271-68113293 TTTTATTTTTTTAAGAAACTGGG - Intronic
1084912429 11:72401695-72401717 TTTCAGTTCTTTCTGCAAGTAGG - Intronic
1087471640 11:98583331-98583353 TTTGAGTTCTTTATGTATTTTGG + Intergenic
1087946098 11:104162828-104162850 TGTTAGTACTTTAAGCAAGCAGG + Intronic
1088547550 11:110975079-110975101 TTTTAGCTATTTAATTATGTGGG + Intergenic
1090811576 11:130249232-130249254 TTTTAATCATTTAAGAAAGTAGG - Intronic
1091544440 12:1491971-1491993 TTTAAATTCTCTGAGTAAGTGGG - Exonic
1092388467 12:8054063-8054085 TTTTAGTTCTTTAAATATATAGG + Exonic
1093160118 12:15736919-15736941 TTTTATTTTTTTAAGTATTTAGG - Intronic
1093854766 12:24087902-24087924 TGTTAGTTCTATTAGTAAGGGGG - Intergenic
1094410387 12:30162028-30162050 TTTTGGTGCTTTAAGAAAGGTGG + Intergenic
1094626260 12:32127057-32127079 TTTTAGTTATTTAGATATGTTGG + Intronic
1095499001 12:42816048-42816070 GTTTATTTCTTTAAATAATTAGG + Intergenic
1095667709 12:44821459-44821481 TTTTAGTTCTTTAAGTAAGTAGG + Intronic
1095680951 12:44974874-44974896 TTTTAGTTGTTTAAGGAATGTGG + Intergenic
1096997081 12:55845247-55845269 GCTTTGTTCTTTAAGTAACTAGG + Intergenic
1097670782 12:62534830-62534852 TTTTTTTCCTTTAAGTTAGTAGG + Exonic
1099357382 12:81655012-81655034 TTTTATTTCTTGAATTAACTTGG + Intronic
1099600599 12:84731816-84731838 ATTTAATTTTTTAAGTAAATTGG + Intergenic
1099687072 12:85903954-85903976 TTTTATTTCCTTAAGTTATTGGG + Intergenic
1100346110 12:93733224-93733246 TTGTAATTCTTTAAGAAATTGGG + Intronic
1100349134 12:93762015-93762037 TTTTAGTTTTTTATTGAAGTAGG - Intronic
1100794102 12:98162211-98162233 TTTTTGTTCTTTGAGAAAGTTGG - Intergenic
1101161737 12:101984544-101984566 TTTTAATTTTTTAAGAAAGGAGG - Intronic
1102698126 12:114815745-114815767 ATTTAATTTTTTAAGTGAGTTGG - Intergenic
1102851992 12:116256181-116256203 TTTTATTTCTGTAAATAACTAGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104535005 12:129610488-129610510 TTTTAATGCTTTATGGAAGTAGG - Intronic
1104565379 12:129876537-129876559 TTGTTTTTCTTTAAGCAAGTTGG - Intronic
1104700690 12:130901902-130901924 TTTTGATTCTTTAAAAAAGTAGG + Intergenic
1105302244 13:19146389-19146411 TTGTAGTTCTTTATGTATTTTGG - Intergenic
1105489978 13:20878890-20878912 TTGCATTTCTTTAAATAAGTGGG + Intronic
1105866858 13:24468572-24468594 TTTTTGTACTTTTAGTAAGAGGG + Intronic
1107056905 13:36115831-36115853 TTTTAGTATTTTCAGAAAGTTGG + Intronic
1107064035 13:36193207-36193229 TTTTACTTCTTAAAGTTAATAGG - Intronic
1107456632 13:40561625-40561647 TTTTGTTTCTGTAAGTATGTGGG - Intronic
1107622516 13:42247563-42247585 TTTTTTTTCTTTCAATAAGTAGG - Intronic
1109204937 13:59471992-59472014 TATTAGTTCTTTAAGTGTTTGGG - Intergenic
1109453596 13:62552118-62552140 TTTTATTTCTTTGAATAATTAGG - Intergenic
1109564442 13:64093699-64093721 TTTCAGTTGTTTAAATAAATGGG + Intergenic
1110011689 13:70343126-70343148 TTTAAGTTCTTTATATAAGCTGG - Intergenic
1111595945 13:90410817-90410839 TTTTGGTTATTTAAGGAAGGTGG - Intergenic
1111743278 13:92232138-92232160 TTTTATTTCTATAATTAACTAGG - Intronic
1112642853 13:101296584-101296606 TTTTAGTTCTATAATTAAAATGG - Intronic
1113006015 13:105702972-105702994 TTTTAATTCTTTATTAAAGTAGG + Intergenic
1113553024 13:111208008-111208030 TTTTTGTTTTTGAAGTCAGTGGG + Intronic
1114489289 14:23087688-23087710 TTTTAGTTCTATAGGTAATGGGG - Intronic
1115675820 14:35673135-35673157 TTTTAGTTCATTAAAGAAATTGG - Intronic
1115975597 14:38993085-38993107 TTTTAGTTCTTTGAGAAAGGAGG - Intergenic
1116128625 14:40823902-40823924 TTTTCCTTAGTTAAGTAAGTAGG - Intergenic
1116349799 14:43846840-43846862 TTATAGTACTTTAAATAATTTGG + Intergenic
1116509727 14:45729278-45729300 ATTTAGTTCTTTAAATTACTTGG - Intergenic
1116714380 14:48409138-48409160 TTTTAGTTGTTTTATTAAATAGG + Intergenic
1117758666 14:59003400-59003422 TTCTAGTTCTGTAAGTAAATAGG - Intergenic
1117977107 14:61309746-61309768 TTTTAGTTCTAGAAGCCAGTAGG - Intronic
1118060504 14:62132878-62132900 TTTTTGTTTTTTTATTAAGTGGG + Intergenic
1118145697 14:63133309-63133331 TTTGAGTTCTTTACGTATTTTGG - Intergenic
1118291703 14:64531088-64531110 TGTTAACTTTTTAAGTAAGTAGG - Intronic
1118422015 14:65616829-65616851 TTTTTTTTCTTTAAGTAAAAAGG + Intronic
1118534345 14:66743010-66743032 TTTTTCTTGTTTAAGAAAGTTGG + Intronic
1118557245 14:67038813-67038835 ATTTAGTTATTAGAGTAAGTGGG - Intronic
1120442930 14:84561708-84561730 TTTTAGTTCTCTCAGGAATTTGG + Intergenic
1120802019 14:88700933-88700955 TCATAGTTCTTTAAATAAGCTGG + Intronic
1120926479 14:89802197-89802219 TTTTTTTTTTTTAAGTAACTTGG - Intronic
1120963502 14:90147159-90147181 TTTTAGTTGTTTAAGAAAGGAGG + Intronic
1121893592 14:97623195-97623217 TTTTCATTCATGAAGTAAGTTGG - Intergenic
1125136816 15:36353397-36353419 TTGTAGTTTTCAAAGTAAGTGGG - Intergenic
1125305046 15:38302412-38302434 TTTTATTTTTTTAAGAAAGGGGG + Intronic
1129181215 15:73877284-73877306 TTTTATTTTTTAAAGTGAGTTGG + Intronic
1129548127 15:76419399-76419421 CTTTAGTTCTTTAAATATTTAGG - Intronic
1129793572 15:78359263-78359285 TTTTGTTTTTTTAAGTGAGTGGG + Intergenic
1130003611 15:80070167-80070189 TATTGATTCTTTATGTAAGTAGG + Intronic
1130852286 15:87806315-87806337 TTTTATTTCCTTAAGTTACTGGG + Intergenic
1132024883 15:98396782-98396804 TTTTTGTATTTTTAGTAAGTTGG - Intergenic
1133352843 16:5113647-5113669 TTTTTGTTCTTTAGGGAGGTGGG - Intergenic
1135070913 16:19350842-19350864 TATTAGTTCTTTGAGAAATTGGG + Intergenic
1135410395 16:22229922-22229944 TTTTAGTTCTTGGAGATAGTTGG + Intronic
1137341539 16:47611914-47611936 TGTTAGCTCTTTATGTAAGGGGG + Intronic
1137975261 16:53025921-53025943 TTTTAGTTCTTTCAGAAAGCGGG + Intergenic
1138405902 16:56793682-56793704 TTTTAGTTCTTTAATTCCATTGG + Intronic
1138508817 16:57495552-57495574 CTTTATTTTTTTAAGTGAGTTGG - Intergenic
1138882799 16:61035928-61035950 TTATAGTACTATAAGTAACTTGG - Intergenic
1139622508 16:68157681-68157703 TTTTATTTCTTAAACTAATTTGG + Intronic
1140815372 16:78616226-78616248 TTTTAATTATATAAGCAAGTAGG + Intronic
1141683644 16:85557767-85557789 TTTTTTTTTTTTAAGTCAGTTGG - Intergenic
1142945652 17:3424567-3424589 TTTTATTTATTTATTTAAGTAGG + Intergenic
1143717077 17:8781405-8781427 TTTTAGGTCTTTAATTCATTTGG - Intergenic
1144218244 17:13076357-13076379 TTTTTGAACTTTATGTAAGTGGG - Intergenic
1146999128 17:37347735-37347757 TTTTTTTTTTTTACGTAAGTAGG - Intronic
1147053427 17:37815548-37815570 ATCTAGATCTTAAAGTAAGTTGG - Intergenic
1148763121 17:50019220-50019242 TTTTATTTCTTTTAGATAGTGGG - Intergenic
1149732793 17:58963080-58963102 TTTTTTTTCTTTAAATAAGAGGG - Intronic
1150750768 17:67860561-67860583 TTTTCATTCATTATGTAAGTGGG + Intronic
1150793355 17:68218190-68218212 TTTTCATTCATTATGTAAGTGGG + Intergenic
1151044566 17:70904121-70904143 TTTTTTTTATGTAAGTAAGTGGG - Intergenic
1152841625 17:82572705-82572727 TTTTAATTCATTAAGTAACCAGG + Intronic
1152867250 17:82731600-82731622 TTTTATTTCTTACTGTAAGTGGG + Intergenic
1153484327 18:5581463-5581485 TTTTGTTTATGTAAGTAAGTAGG + Intronic
1155981733 18:32187550-32187572 TTTTAGTTCTTTATATATCTTGG + Intronic
1156035097 18:32757230-32757252 TTTTACTACTCTTAGTAAGTTGG - Intronic
1156135964 18:34038011-34038033 TTTGAGTTCTTTGAGTATTTTGG - Intronic
1156385524 18:36601318-36601340 TTTTACGTCTTGTAGTAAGTAGG + Intronic
1156634310 18:39009338-39009360 TTTTTTTTTTTTAAGTTAGTGGG - Intergenic
1157218362 18:45804607-45804629 TTTTAGTGCTTTGAGAATGTTGG - Intergenic
1157671472 18:49532540-49532562 TTTCAGTTGTTTACGTAAGTAGG - Intergenic
1158001139 18:52620565-52620587 TTTTTGTTCTTGAAGTGATTTGG + Intronic
1158144968 18:54301999-54302021 TTTTATTTGTTTAAGAATGTGGG + Intronic
1158372077 18:56818529-56818551 TTTTAGTTATTTAAGTTCTTCGG - Intronic
1158516882 18:58138186-58138208 TTTTATTTCATTAAATAAATAGG + Intronic
1158531988 18:58271369-58271391 TTTTATTACTTTAAGTTAGAAGG + Intronic
1158594102 18:58801571-58801593 TTTTTTTTCTTTAATTAACTGGG + Intergenic
1158837631 18:61347929-61347951 TTTGAGTTCTTTATGTGTGTGGG - Intronic
1159361674 18:67412818-67412840 TTTTATTTGTTTAAGTAATTGGG + Intergenic
1160294893 18:77629054-77629076 TTTTACTTCTCTTATTAAGTGGG - Intergenic
1162243822 19:9382151-9382173 TTTTATTACTTTAAGAAAGAAGG - Exonic
1163816438 19:19467484-19467506 CTTTGGTACTTTAAATAAGTGGG + Intronic
1164044727 19:21526973-21526995 CTTTGGCTCTTTAAGTAAGTAGG + Intronic
1164227109 19:23255629-23255651 TTTTTGTGTTTTAAGTAAGATGG + Intergenic
1164487619 19:28673310-28673332 TTTTATTTCTTTAAGTAATGTGG - Intergenic
1164944248 19:32279645-32279667 TTTAAGTTCTTTATGTATTTTGG - Intergenic
1165001901 19:32770926-32770948 TCGTAGTTCTTTAAGTAGGGAGG + Intronic
1166542613 19:43615391-43615413 TTTTATTTTTTTAAAAAAGTCGG - Intronic
925554788 2:5118699-5118721 TTTTATTGCTTTAATAAAGTGGG - Intergenic
926307019 2:11644982-11645004 TTTTTTTTCTTTAAGAAAGAGGG + Intergenic
927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG + Intergenic
928321418 2:30285887-30285909 TTTCAGTTCATTAAAGAAGTTGG + Intronic
928719628 2:34104327-34104349 TTTTATTTGTTTCAGTTAGTAGG + Intergenic
928899786 2:36304623-36304645 TTTGACTTTTTAAAGTAAGTGGG - Intergenic
928982266 2:37148269-37148291 TTTTACTTTTTTAAGCAGGTAGG - Intronic
929013655 2:37472769-37472791 TTTTCTTTCTTTAATTAAGGTGG + Intergenic
929059759 2:37911814-37911836 ATTTAGTTCTTTAAATATGTAGG - Intergenic
929725717 2:44424897-44424919 TTTTATTTCTATAAGTTATTGGG - Intronic
930285118 2:49418071-49418093 TTTTTTTTCATTAAGTAACTAGG + Intergenic
930627580 2:53715676-53715698 TTTAATTTTTTTAAGTAGGTGGG + Intronic
930818800 2:55624976-55624998 GTTTAGTTCTTTAATCAAGTTGG + Intergenic
931436525 2:62252379-62252401 TTTTAGTTTTCTAAGAGAGTAGG - Intergenic
931672465 2:64660010-64660032 TTTTCATTCTTAAAGTAAGTAGG - Intronic
931968263 2:67557458-67557480 TTTTAATTCAATAAGTAAGACGG + Intergenic
933044829 2:77522170-77522192 TTTCAGTTCTTGAAGCAAGTAGG + Exonic
934539694 2:95163544-95163566 TTTTAGTTTTTTTATTAAGAGGG - Intronic
935366837 2:102302345-102302367 GTTTAGTTATTTAAGTCAGGAGG + Intergenic
935574367 2:104693604-104693626 ATTTAATTATTTTAGTAAGTTGG - Intergenic
938916314 2:135944565-135944587 TTTTTTTTTTTTAAGTTAGTTGG - Intronic
939455193 2:142425234-142425256 TTTTATTTATTGAAGTAACTGGG + Intergenic
940502366 2:154509027-154509049 TTTTTTTTTTTTAAGTTAGTGGG - Intergenic
940776561 2:157890879-157890901 TTTTATTTCTTTGAGAAAGAAGG + Intronic
941889070 2:170559291-170559313 TCTTTGTTCTTTAAATAAATGGG + Intronic
942281487 2:174368432-174368454 TTTTAGATCTCTAAGTATTTGGG - Intronic
943077904 2:183220406-183220428 TTTTATTTCTTTTATTAAGCAGG + Intergenic
943198104 2:184781860-184781882 TTTCTGTTCTTTAAGCCAGTCGG - Intronic
943389733 2:187250176-187250198 TTACTGTTCTTTAAGTAAATGGG + Intergenic
943449255 2:188027929-188027951 TTTTATTTATTTATTTAAGTTGG + Intergenic
943917271 2:193651309-193651331 TTTTATTTTTTTCAATAAGTGGG + Intergenic
945372150 2:209032363-209032385 TTTTAAATGTTTAATTAAGTGGG + Intergenic
946458696 2:219850812-219850834 TGTTAGTTCTTTAAGGATGAAGG - Intergenic
947584923 2:231349351-231349373 TTTAGATTGTTTAAGTAAGTGGG - Intronic
947906832 2:233770651-233770673 TTTTTTTTTTTTAAGTAAGACGG - Intronic
1169384222 20:5134455-5134477 TATTATTTCTTTAAATCAGTAGG - Intronic
1169438365 20:5613127-5613149 TTTTAATTCTTTAAGAAATCTGG - Intergenic
1169555935 20:6750101-6750123 TTTTAATTCTGTATGTAAATAGG - Intergenic
1169845850 20:9990720-9990742 CTTTAGTTCTTTATGTAAAATGG - Intronic
1172861765 20:38059858-38059880 TTTTTTTTCTTTTAGTAAGAGGG - Intronic
1173973569 20:47170879-47170901 TTTTTGTTTTTGCAGTAAGTTGG - Intronic
1174474684 20:50787976-50787998 TTTTTTTTTTTTAAATAAGTCGG - Intergenic
1174895514 20:54445571-54445593 TTCTAGTTTTTCAAGAAAGTTGG + Intergenic
1175017265 20:55805304-55805326 TTTTTTTTCTTTAAGCAAGGAGG - Intergenic
1177030059 21:15971283-15971305 TTTGATTTCTTTTAGAAAGTAGG + Intergenic
1177154518 21:17487675-17487697 TTTAAGTTCTTTAAGCCATTTGG + Intergenic
1177192126 21:17863636-17863658 TTTTAGTTTTCTCAGTAAGATGG + Intergenic
1177962748 21:27688878-27688900 TTTTAGTTCTTTAAATAAACAGG + Intergenic
1178723502 21:35030844-35030866 TTTGAGTTCTTTATGTAGTTTGG - Intronic
1180101479 21:45589814-45589836 TTTTAGTTCTTTAAACACATGGG + Intergenic
1180202305 21:46231738-46231760 TTTTATTACTTTATGTGAGTAGG - Intergenic
1180725891 22:17946262-17946284 TTTTTGTTCTTTTCGGAAGTAGG - Intronic
1182183499 22:28376501-28376523 TTATAGTTGTTTAAGTTATTAGG - Intronic
949140913 3:631878-631900 CTTTATTTTTTTAAATAAGTGGG - Intergenic
949284038 3:2380337-2380359 TTTTGATTCTTTAAGTCATTTGG + Intronic
951330197 3:21357932-21357954 TTTTTGTTGTTAAAGTAAGTGGG - Intergenic
951440449 3:22717151-22717173 TTTTCTTTTTTTAAGGAAGTGGG - Intergenic
951538272 3:23759450-23759472 TTTCAGTCCCTTCAGTAAGTAGG + Intergenic
951593272 3:24289797-24289819 TTTTAGTCATGTCAGTAAGTAGG - Intronic
952537244 3:34323826-34323848 TTTTGGTGCTTTATGTATGTAGG - Intergenic
956836392 3:73099687-73099709 ATTTAGTTCTTTAATTCAATTGG + Intergenic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
957258120 3:77865000-77865022 TTTAAGATTTTTAAGTAAGGTGG - Intergenic
957418363 3:79935164-79935186 GTTTAGTTCTTTAAGTTATGAGG - Intergenic
957460120 3:80506198-80506220 TTTTTATTTTTCAAGTAAGTTGG + Intergenic
957562426 3:81839830-81839852 TTTTAGTACCTTATGTAAGATGG + Intergenic
957698857 3:83683098-83683120 TTTTAGAACTTTATGAAAGTAGG + Intergenic
958196846 3:90252335-90252357 TTTTAGTTTCTAAAATAAGTTGG - Intergenic
958475979 3:94583501-94583523 TTTTAGTTGTTTTTGTAACTTGG - Intergenic
960149426 3:114235833-114235855 TTTTTTTTTTTTAAGTAAGAAGG - Exonic
960218556 3:115074582-115074604 TTTTAGTTGTTTAAGGCAGGAGG - Intronic
960356928 3:116664667-116664689 TTTTTTTTTTTTAAGTTAGTTGG - Intronic
960441720 3:117697062-117697084 TTTTATTTTTTTAAGCAAATGGG + Intergenic
961132932 3:124485577-124485599 TTTTATTTTTTTAAGAAAATAGG + Intronic
961742840 3:129044883-129044905 TTTTTTTTCTTTAATTAGGTTGG - Intergenic
961939320 3:130621238-130621260 TTTTTCTTCTTTTGGTAAGTGGG + Intronic
962098246 3:132314835-132314857 TTTTAGCTCTTCAAGTGAGAAGG - Intergenic
962442255 3:135431836-135431858 GTTTAGTGCTGTAAGTAAGATGG - Intergenic
963928854 3:150980830-150980852 TTTTAGTCATTTTAATAAGTAGG - Intergenic
964035827 3:152195490-152195512 TTTTAGTTTTATATTTAAGTTGG + Intergenic
964063151 3:152549934-152549956 TTTTAGTTCTTTATATAAAATGG + Intergenic
964072332 3:152649917-152649939 TTTTAGATCTAGAAGTAATTTGG - Intergenic
964287882 3:155140377-155140399 TTTTATTTATTGAAGTAAATGGG + Intronic
964420845 3:156501265-156501287 TTTTAGAATATTAAGTAAGTAGG + Intronic
964599314 3:158478257-158478279 TTTTAATTCTTAAAGGATGTTGG + Intronic
965960226 3:174420581-174420603 TTTTACCTCTTTAAGTTATTTGG + Intergenic
966325770 3:178752070-178752092 TTTTAGCTTTTTAAATATGTAGG - Intronic
967786809 3:193506071-193506093 TCTGAGTTCTTTCTGTAAGTAGG + Intronic
968399296 4:277825-277847 TTTTAATTTTTTAATTAAATGGG + Intronic
968417194 4:450124-450146 TTTTAATTTTTTAATTAAATGGG + Intronic
968527207 4:1066667-1066689 TTTTAGTTCTTTATGTATTCTGG + Intronic
968740322 4:2325935-2325957 TTTGAGTTCTTTATATATGTTGG + Intronic
969537171 4:7763527-7763549 TTTTTGTTTTTTAACAAAGTTGG + Exonic
970341093 4:15107736-15107758 TTTTGGTTTTTTAAATAAGATGG - Intergenic
970954994 4:21800473-21800495 TTTTAGTTCTTTAGAAATGTTGG - Intronic
971464085 4:26936069-26936091 TTTTGGTTTTTAAAGTAAGATGG + Intronic
971554201 4:27992078-27992100 TGTTAGTTGTTTAAATATGTAGG + Intergenic
971881922 4:32386525-32386547 TTTCAGTTTTTTAAGTTAATTGG - Intergenic
971984978 4:33810344-33810366 TTTAAGTTCTTTGATTAAGTGGG + Intergenic
972209102 4:36815359-36815381 TTTTTTTTCTTTTGGTAAGTTGG + Intergenic
973164998 4:47066017-47066039 TTATAGTTGATTAATTAAGTTGG - Intronic
973212255 4:47629412-47629434 TTTTAGTTCCTTATGTATTTTGG + Intronic
973687173 4:53383026-53383048 TTTTAATTCTTTAATTGATTTGG + Intronic
973838113 4:54831437-54831459 ATTTAATTCTTTAATTATGTAGG - Intergenic
974276842 4:59731499-59731521 TTTTAGTTCCATAAGTTATTGGG - Intergenic
974633061 4:64520235-64520257 TATTAGTTATTTATGTTAGTAGG + Intergenic
976820595 4:89202183-89202205 GTTTAGTTATCTAAGTTAGTTGG + Intergenic
977243413 4:94601500-94601522 TTTTCCTTGCTTAAGTAAGTGGG + Intronic
977325330 4:95568083-95568105 TATTAGTTCTTTAAATATATTGG + Intergenic
977704875 4:100060054-100060076 TTTTTGTATTTTTAGTAAGTTGG - Intergenic
977753141 4:100633553-100633575 TTTTACATCATTAAGCAAGTGGG + Intronic
977853754 4:101862114-101862136 TTTTAGTCCTTTATATAACTTGG - Intronic
977985560 4:103378861-103378883 TTGCAGTTCTCTAAGTAAGAGGG + Intergenic
978554972 4:109970238-109970260 TTATAGTTCTGTAAGGAAGTGGG - Intronic
978826513 4:113030718-113030740 TTTTAGTTCTTAGAGTACCTTGG - Intronic
978866611 4:113520575-113520597 TTTTAGTACTTTAGGTATATGGG - Intronic
979282494 4:118883282-118883304 TTCTAGTTCTTTGAATAATTAGG + Intronic
979296013 4:119032943-119032965 ACTTAGTTCCTTAAGTAACTGGG - Intronic
979531953 4:121777882-121777904 TATTAATACATTAAGTAAGTGGG + Intergenic
979537270 4:121837389-121837411 TCTTCTTTCTTTAAATAAGTAGG + Intronic
980003730 4:127517528-127517550 TTGTAGTTTTTCAAGTGAGTAGG - Intergenic
980505211 4:133710123-133710145 TTTTATTTCTATAAGTTATTGGG - Intergenic
980649583 4:135695339-135695361 TCTTACTTCTTTGAGAAAGTTGG + Intergenic
980696067 4:136357027-136357049 TTATAGTACTTTAAGGCAGTAGG + Intergenic
980765146 4:137292586-137292608 TTTTAGTTCTTTAATAAATATGG - Intergenic
981066632 4:140492997-140493019 TTTTACATCTTTAAGTGAATTGG + Intronic
981507258 4:145516078-145516100 TTTTATTTCTTAAAATGAGTAGG - Intronic
981555919 4:145993541-145993563 TTTTTTTTTTTTAAATAAGTGGG + Intergenic
984556762 4:181223513-181223535 TTTTAATTTTTTAAGTAATCAGG + Intergenic
984680013 4:182596527-182596549 TTTTAGATCTTAAAGTAATTTGG + Intronic
986088496 5:4478395-4478417 TTTTAGTTCTGTAAGCCACTGGG - Intergenic
986683245 5:10252260-10252282 TTTTGGTTCTTCAAGTTAGCTGG - Intronic
986771892 5:10981667-10981689 TTTCAGTTCTTTATGTATGTTGG + Intronic
987646656 5:20681102-20681124 TTTTAGTTCTTACAGAACGTGGG - Intergenic
988156235 5:27452655-27452677 TTTAAGTTCGGTAAGTAAGCTGG + Intergenic
988285448 5:29210094-29210116 TTCTCTTTCTTTAACTAAGTGGG - Intergenic
988317387 5:29647731-29647753 TTTTATTTCTGTAAGTTATTGGG + Intergenic
988898639 5:35707150-35707172 TTTTAGTTTTTTAACTTAGTCGG - Intronic
989081518 5:37627444-37627466 TTTTATTTCTTTTACTAATTTGG + Intronic
989685951 5:44087496-44087518 TTATAGTTCTTAAAATAATTTGG + Intergenic
990858008 5:60293215-60293237 TTTAAGTATTTTAAGTAAATTGG - Intronic
991674273 5:69075907-69075929 TTCCCATTCTTTAAGTAAGTTGG - Intergenic
991906038 5:71511701-71511723 TTTTTTTTCTTTAAGTCAGATGG + Intronic
992403044 5:76428780-76428802 TTTTTTTTTTTTAAGTAAGTTGG - Intronic
992670831 5:79059515-79059537 TTTTTGTATTTTAAGTAAATGGG + Intronic
992899183 5:81276428-81276450 TTTTTGTTTTTTAAGTAATAGGG - Intergenic
993103893 5:83576290-83576312 TTTTTGAACTTTAAATAAGTGGG + Intronic
993310331 5:86322836-86322858 TTTGAGTTCTTTAAATATTTTGG - Intergenic
994076982 5:95663752-95663774 TTTTAGTTATTTAAGCAAACTGG + Intronic
994165887 5:96607695-96607717 AGTTTGTTCTTTAAGTCAGTTGG + Intronic
994796892 5:104314895-104314917 TTTTAGTTCTTCAAGGAGTTTGG + Intergenic
994924497 5:106097320-106097342 TTGTTGTTGTTTAAGTAAGTTGG - Intergenic
995138755 5:108709018-108709040 TTTTAGTTATATAAGTAAGCAGG - Intergenic
996078683 5:119229974-119229996 TTTTAGTATTTTATGTAATTTGG + Intronic
996305360 5:122040116-122040138 TTTTATTTTTTTAATTATGTTGG + Intronic
996483879 5:124007696-124007718 TTTTAGTTGTTTAAGGCAGTAGG + Intergenic
996892892 5:128443670-128443692 TTTTTGGTCTTTAAGTTACTAGG - Intronic
998933045 5:147202348-147202370 TTTTAGCTTTTTAAGTATTTTGG + Intergenic
998986970 5:147769601-147769623 TTTTAGTTTTTAAAGAAATTAGG + Intronic
999774969 5:154804759-154804781 TTTTATTTATTTCAGTAAGATGG + Intronic
1000011975 5:157241572-157241594 TTTTAGTGATTTAAGTTAGATGG + Intronic
1000356566 5:160401754-160401776 TTTTCATTCTTAAAGTAAATAGG + Exonic
1000366440 5:160495583-160495605 CTTTAGATCTTTAGGGAAGTAGG + Intergenic
1002015737 5:176320747-176320769 TTTTTTTTTTTTAAGTAAATAGG + Intronic
1003038817 6:2668763-2668785 ATTTATTTTTTTAAGTAAGAAGG + Intronic
1003947189 6:11086898-11086920 TTTCAGTTATTTATGTATGTGGG - Intergenic
1004033792 6:11901401-11901423 TTTTAGTACTTTAAAAATGTCGG + Intergenic
1004711325 6:18173387-18173409 TTGTAGTTCTTTATGTAATCTGG + Intronic
1004786851 6:18977442-18977464 TTTTAGTTCTTAAAATGGGTTGG - Intergenic
1004823016 6:19388956-19388978 TTTTATTTCCTTAAGCAAATTGG - Intergenic
1005320757 6:24651114-24651136 TTTTTTTTTTTTAAGTTAGTGGG - Intronic
1006502716 6:34468567-34468589 TTTCAGTTCCTCAAGCAAGTGGG + Intronic
1006720333 6:36145851-36145873 TGTGAGTTCTTTAAGGAAGATGG - Intergenic
1007871457 6:45044074-45044096 TTTTAGATGTTTAGGTAAATGGG - Intronic
1007929831 6:45680201-45680223 TTTTAGTTCTTTATATATGCTGG - Intergenic
1008378352 6:50816956-50816978 TTTTAGTTCTAGAAGTCAGGGGG + Intergenic
1008464562 6:51816300-51816322 TCTTAGCTGTCTAAGTAAGTAGG - Intronic
1008666243 6:53719572-53719594 TTTTAATGCTTTCAGTAATTTGG - Intergenic
1008901645 6:56625727-56625749 TTTTTTTTTTTTAAATAAGTAGG - Intronic
1009308078 6:62117476-62117498 TTTGAGTTCCTTAAGTATTTTGG + Intronic
1009804650 6:68587720-68587742 TTTAAGTTCCTTATGTAATTTGG - Intergenic
1010310553 6:74379504-74379526 TTTTTCTTCTTTAAGGAAATTGG + Intergenic
1010789183 6:80044999-80045021 TTTTAGTTTTTCAAATTAGTGGG - Intergenic
1011009649 6:82689545-82689567 TTTTATTTATATAAGTAAGATGG + Intergenic
1011226184 6:85109944-85109966 TTTTAGTTTTTAAAATAAGTGGG + Intergenic
1012323267 6:97878960-97878982 TTTAAGTTGTTTAAGTCAGCAGG + Intergenic
1012353831 6:98288239-98288261 TTCTAGTTATATAAGTTAGTTGG + Intergenic
1012699259 6:102432804-102432826 TTTAGGTTTTTGAAGTAAGTTGG - Intergenic
1013008590 6:106098894-106098916 TTTTAGTGCTTTGAGTCACTGGG - Intronic
1013445512 6:110222248-110222270 TTTTAATTCTTTTATTAAGATGG - Intronic
1014491166 6:122063881-122063903 TTTTAGCTATTTTATTAAGTAGG - Intergenic
1016556330 6:145342272-145342294 TTTTAGTCCTTAAAGTATTTTGG + Intergenic
1017598439 6:156055441-156055463 TTTTAGTTCCTGAAGCAAGATGG - Intergenic
1019142717 6:169958239-169958261 TTTTTTTTCTTTATGTCAGTTGG - Intergenic
1019878481 7:3837541-3837563 TCTTCGTTCTTGAGGTAAGTTGG + Intronic
1020598335 7:10240701-10240723 ATTTAATTCTTAAAGTCAGTGGG - Intergenic
1020947359 7:14629259-14629281 TTTATATTCTTTAAGTGAGTTGG - Intronic
1021177691 7:17469027-17469049 TTTTGGTTCTTTAAAAAAATTGG + Intergenic
1021355447 7:19649528-19649550 TTTTATTTTTCTAAGTAAGTAGG - Intergenic
1021778998 7:24083352-24083374 TTTTAGTTTTTTAAGGAATCTGG - Intergenic
1021796183 7:24256769-24256791 TTTTTGTACTTTTAGTAAGACGG - Intergenic
1022041427 7:26585584-26585606 TTTTATTGCTTTAAGTAAAAGGG + Intergenic
1022836063 7:34116432-34116454 TATTAGATCTTTAAAGAAGTTGG + Intronic
1023625424 7:42110789-42110811 TTTTGTTTCTTTTAGTAAATGGG + Intronic
1024323487 7:48091292-48091314 TTTTTTTTTTTTAAGTAAGATGG + Intronic
1026218522 7:68370980-68371002 TTTTATTTCTTAAAAGAAGTTGG + Intergenic
1026384421 7:69831958-69831980 TTTTAACTCATTCAGTAAGTTGG + Intronic
1026542675 7:71294309-71294331 TATTATTTCTTTAAATAAGCTGG + Intronic
1028513850 7:91654768-91654790 TTTTACTTCTTTCTTTAAGTAGG + Intergenic
1030102648 7:105960035-105960057 CTTTATTTTTTTAAATAAGTAGG + Intronic
1030582016 7:111368837-111368859 TTTTAGCTCTTTAAATACTTTGG - Intronic
1031628717 7:124020683-124020705 TTTTAGGTCATTCAGTAAATGGG - Intergenic
1033149885 7:138904830-138904852 TTTTTGTTCTATAACTCAGTGGG + Intronic
1033295412 7:140129463-140129485 CTTTATTTCTTTAAGTACCTGGG - Intronic
1033465698 7:141587455-141587477 TTTCAGCTATTTAAGTAATTTGG - Intronic
1034138497 7:148794834-148794856 TTTTAGTTTTTTAATTGAGACGG + Intronic
1034143600 7:148848217-148848239 TTTTAGTGTTTTAAGTAAAAGGG + Intronic
1036473424 8:9071507-9071529 TTTTATTTCTTTTCGTAATTAGG - Intronic
1037047780 8:14330319-14330341 TTTTTGTTATTTAAGTAAAGAGG - Intronic
1037093727 8:14956004-14956026 TTTTAGTGCTTAATGTAGGTAGG + Intronic
1037123958 8:15322109-15322131 TGTTAGTTCTTTAAATATTTGGG - Intergenic
1037338552 8:17815808-17815830 TTTCTGTTTTTTAAGTAAATTGG - Intergenic
1038324160 8:26559614-26559636 TCTTAGTTCTTTAAGTAATTTGG + Intronic
1038593486 8:28863315-28863337 TTGTAGCTTTTTAATTAAGTAGG - Intronic
1038709697 8:29931848-29931870 TTCTAGTTCCTTAAGTTAGACGG - Intergenic
1039387663 8:37150686-37150708 TTTTAGTTTGGTAAGTAAGTGGG - Intergenic
1039534481 8:38295669-38295691 TTTTTTTTTTTTAAGGAAGTAGG + Intronic
1039719946 8:40152506-40152528 TTCTAGTCCTTTAAGAAAGCAGG - Intergenic
1039841935 8:41300058-41300080 TTTGAGTTCTTGCAGAAAGTAGG - Intronic
1041422549 8:57684643-57684665 TATTAGTTCTTTAAATATTTGGG - Intergenic
1041691285 8:60690464-60690486 TTTTATTTTTTTTAATAAGTGGG - Intronic
1043059888 8:75487043-75487065 TTTAAATTGTTGAAGTAAGTGGG - Intronic
1043214200 8:77565045-77565067 TTTTACATGTTTCAGTAAGTTGG - Intergenic
1043309911 8:78845421-78845443 TTTTAGTTTTTAAAGAAAATAGG + Intergenic
1043317776 8:78942665-78942687 TTTCAGGTCTTTCAGTAAATGGG + Intergenic
1043525872 8:81096122-81096144 TTTTATTTTTATTAGTAAGTAGG - Intronic
1043555354 8:81424130-81424152 TTTTATTTCTTAATGTAATTTGG - Intergenic
1043585285 8:81761293-81761315 TTATATTTCTTTAAGTATTTAGG - Intergenic
1044024245 8:87149121-87149143 TTTTATTTCTTTCTGTACGTAGG + Intronic
1044410664 8:91879082-91879104 TTATTTTTCTTGAAGTAAGTAGG + Intergenic
1045377433 8:101588618-101588640 TTTGAGTTGCTTAAGTAATTGGG + Intronic
1048554374 8:135459375-135459397 TTTTATTTCTTTAATAAAATGGG + Intronic
1048722126 8:137337418-137337440 TCAGAGTTCTTTAAGTAATTGGG + Intergenic
1049648689 8:143752270-143752292 TTTTAGTGCTTTAAATATATTGG + Intergenic
1050515406 9:6438416-6438438 TTTTTGTACTTTAACTAAATAGG + Intronic
1050818184 9:9841900-9841922 TGTTAGTTCCTTAAATATGTTGG + Intronic
1050911116 9:11072486-11072508 TTTTTGTTCTTTAAGTGATGTGG + Intergenic
1051098427 9:13493494-13493516 TTTAAGTGCTTTCAGTAAATAGG - Intergenic
1051132163 9:13875060-13875082 TTTTAGTTATTTCACTAAATAGG + Intergenic
1051145185 9:14019767-14019789 TTTAAGTTCTTTGAGAAATTTGG + Intergenic
1052136242 9:24914319-24914341 TTTTGTTTCTTTTAGTAAGGTGG - Intergenic
1052596301 9:30562619-30562641 TTTAAAATCTTTTAGTAAGTAGG + Intergenic
1056268488 9:84923595-84923617 ATTGACTTCTTTAAGTAAGTTGG - Intronic
1057523698 9:95781354-95781376 TTTTATTTTTTTTAATAAGTAGG + Intergenic
1058060910 9:100494723-100494745 TTGGAGTTCTCTAAGTAAGAAGG + Intronic
1058277842 9:103067668-103067690 TTTTTGTTTTTTAAATACGTTGG + Intergenic
1059704670 9:116810613-116810635 TTTAAGTTCTTTATGTTCGTAGG - Intronic
1059828541 9:118063329-118063351 TTTTTGTTCTTTTAGTCAGGAGG + Intergenic
1059870217 9:118564595-118564617 ATATAGTTCTTTCAGGAAGTGGG - Intergenic
1060010547 9:120039787-120039809 TTTTATTTTTTTAACTTAGTGGG - Intergenic
1062304733 9:135898675-135898697 TTTTAGTTATGTAAGTAGGTGGG - Intronic
1185753602 X:2634638-2634660 TTTTAGTTCTTTGAGAAATCTGG + Intergenic
1186156950 X:6735585-6735607 TTTTATTTCTTCACTTAAGTGGG - Intergenic
1186335826 X:8586605-8586627 TCATAATTCTTTAAGTAATTTGG + Intronic
1186937686 X:14468627-14468649 TTTAAGTTTTTTATGTAGGTAGG - Intergenic
1187542538 X:20211905-20211927 TTTTTCTTTTTTAGGTAAGTGGG + Intronic
1187818054 X:23255228-23255250 TTTTAGTTTTTTAAATATTTTGG - Intergenic
1188090447 X:25958015-25958037 TTTTGTGTCTTTAAGTAAGAAGG + Intergenic
1190204399 X:48391360-48391382 TTTTTGTTTTTTATGTTAGTGGG - Intronic
1190206137 X:48404043-48404065 TTTTTGTTTTTTATGTTAGTGGG + Intronic
1190849882 X:54228814-54228836 TTTAAGTTCAATAAGTATGTTGG - Intronic
1193079147 X:77388886-77388908 TTTTAGTTATTTGAGGAAGCTGG - Intergenic
1193317383 X:80079003-80079025 TTTTTGTTGTTTCTGTAAGTTGG + Intergenic
1193880043 X:86910647-86910669 GTTTTGTTTTTTGAGTAAGTAGG - Intergenic
1194053645 X:89103884-89103906 TTTTGGAACTTTAAGTAAGAAGG - Intergenic
1194067669 X:89282820-89282842 TTTTAGTTCTTTGAGAAATCTGG - Intergenic
1194531330 X:95053091-95053113 TTTGAGTTCTTTACGTATTTTGG - Intergenic
1194812210 X:98400395-98400417 ATTTAGTTCTTTATGGATGTAGG - Intergenic
1195787017 X:108536996-108537018 TTTTGTTTTTTTAAGTAACTAGG - Intronic
1196055088 X:111347072-111347094 TTTTTGTACTTTAACTTAGTAGG - Intronic
1197182678 X:123553101-123553123 TTTAAGTACTTTAAGTAAAAAGG - Intergenic
1197324466 X:125074894-125074916 TTTTTGTTGTTTAAGTAATCAGG - Intergenic
1197752054 X:129971508-129971530 TTTTAGTTCTTTAAGGAAAGAGG + Intergenic
1197833553 X:130671234-130671256 TTTTAGTTGTTTAAGGTAGGAGG - Intronic
1198132379 X:133710151-133710173 TGTTAGTTCTTGAAGTAAATTGG + Intronic
1198235037 X:134729204-134729226 TTTAAGTCCCTTAACTAAGTAGG - Intronic
1199057370 X:143313861-143313883 TTTTAGTGCATTCAGTAAATAGG - Intergenic
1199089887 X:143679371-143679393 TTTTTGTATTTTTAGTAAGTTGG - Intergenic
1199583528 X:149386234-149386256 TTTTAGTTGTTTTAGAAAGGAGG - Intergenic
1200721821 Y:6617008-6617030 TTTTAGTTCTTTGAGAAATCTGG - Intergenic
1201643820 Y:16205571-16205593 TTTTTTTTTTTTAAATAAGTTGG - Intergenic
1201658995 Y:16379750-16379772 TTTTTTTTTTTTAAATAAGTTGG + Intergenic