ID: 1095668627

View in Genome Browser
Species Human (GRCh38)
Location 12:44833065-44833087
Sequence CAATTCCACCACCAGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095668622_1095668627 13 Left 1095668622 12:44833029-44833051 CCAGAGCTAAATGTAAGCTTCAC 0: 1
1: 0
2: 2
3: 9
4: 114
Right 1095668627 12:44833065-44833087 CAATTCCACCACCAGTTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 183
1095668621_1095668627 17 Left 1095668621 12:44833025-44833047 CCTTCCAGAGCTAAATGTAAGCT 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1095668627 12:44833065-44833087 CAATTCCACCACCAGTTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 183
1095668619_1095668627 27 Left 1095668619 12:44833015-44833037 CCCAGAAACACCTTCCAGAGCTA 0: 1
1: 0
2: 1
3: 8
4: 186
Right 1095668627 12:44833065-44833087 CAATTCCACCACCAGTTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 183
1095668620_1095668627 26 Left 1095668620 12:44833016-44833038 CCAGAAACACCTTCCAGAGCTAA 0: 1
1: 1
2: 1
3: 7
4: 178
Right 1095668627 12:44833065-44833087 CAATTCCACCACCAGTTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095668627 Original CRISPR CAATTCCACCACCAGTTTTG GGG Intronic
900997938 1:6132811-6132833 CAATTACTCCATCATTTTTGAGG + Intronic
902471800 1:16652626-16652648 CAATCACACCACCAGTTTTCAGG - Intergenic
902487006 1:16754819-16754841 CAATCACACCACCAGTTTTCAGG + Intronic
907705225 1:56826894-56826916 AAATTCCTCCAACAGCTTTGTGG - Intergenic
908085419 1:60627065-60627087 CATTTCCACCACCTGTGTTCTGG + Intergenic
908802628 1:67896401-67896423 GAATTCCACAACCTGTTTGGAGG - Intergenic
908840560 1:68276261-68276283 CAATGCCACCATGAGATTTGGGG - Intergenic
909472049 1:76040069-76040091 CCATTCTAACACCAGCTTTGTGG + Intergenic
912919749 1:113854609-113854631 AAATTTCACCAGCAGATTTGAGG + Intronic
914824257 1:151130157-151130179 CAATTCAACCAACATCTTTGAGG - Intergenic
914936481 1:151985655-151985677 CATCTCCACCACCAGGTTTTTGG + Intronic
915290885 1:154882442-154882464 TAATGCCAGCACCAGTGTTGAGG - Intergenic
916714694 1:167439168-167439190 CAATTACTACACCTGTTTTGTGG + Intronic
917626597 1:176852777-176852799 CAATTTCTCCACCATTTTAGAGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
920653466 1:207856002-207856024 CATTTCCTCCTTCAGTTTTGTGG + Intergenic
924277115 1:242400257-242400279 CACCCCCACCCCCAGTTTTGTGG + Intronic
924588770 1:245383276-245383298 CAATTCCACCGCTATTTTTCAGG - Intronic
924798622 1:247310823-247310845 CAATTTCAACACAAATTTTGGGG + Intronic
1063110309 10:3029980-3030002 CCATACCACAACCAGTGTTGTGG + Intergenic
1066681408 10:37939399-37939421 AAATTCCCCCACCCTTTTTGGGG + Intergenic
1069878760 10:71578875-71578897 CAATGCCACTCCCAGTTCTGGGG - Intronic
1071091998 10:81929762-81929784 AAATTCAACCATCATTTTTGAGG - Intronic
1072559140 10:96554013-96554035 CCTTTCCACATCCAGTTTTGAGG + Intronic
1073529184 10:104215905-104215927 CAATTCCACCACCTGTGCTCTGG + Intronic
1076226973 10:128785334-128785356 CATTTCCACCAACAGTGTTCAGG + Intergenic
1076690357 10:132220660-132220682 AAATTCCAACACGAGTTTTAAGG + Intronic
1079718918 11:23786438-23786460 CAATTTCAGCACAAGTTTTAGGG + Intergenic
1080377597 11:31731666-31731688 CATTTCCAGCCCCAGATTTGGGG - Intronic
1080508179 11:32939357-32939379 TAATACCACCATCAGTTTTCTGG + Intronic
1085040489 11:73323770-73323792 CTATTCCTCCACCAGCCTTGGGG - Intronic
1085598357 11:77831234-77831256 CAATTCCACTAGCAGTGATGAGG - Intronic
1092665051 12:10787100-10787122 CAATTCCACCAACAGTGTACAGG + Intergenic
1092742340 12:11641889-11641911 CAATTATACCACCAGTTTCCTGG + Intergenic
1094193996 12:27726608-27726630 CAATTTCACCAGCAAGTTTGAGG + Intronic
1094350315 12:29517331-29517353 GCATTCCAGCTCCAGTTTTGAGG + Intronic
1095286918 12:40423637-40423659 CAATTTCACCTCCAATTTTTAGG + Intronic
1095668627 12:44833065-44833087 CAATTCCACCACCAGTTTTGGGG + Intronic
1096436404 12:51593631-51593653 CAGTTCCCCGACCAGTTCTGCGG + Intronic
1100331727 12:93588985-93589007 CATTTCCTCCAGCAGTTTTCTGG + Intergenic
1103212921 12:119179531-119179553 CACTGCCACCGCCAGGTTTGGGG + Exonic
1103254576 12:119529868-119529890 AAATTCCACCATTAGATTTGTGG - Intronic
1103654064 12:122456447-122456469 CACTTCCAGCACCAGATGTGTGG - Intergenic
1104547595 12:129726280-129726302 CAAGTCCACCCTCAGCTTTGGGG - Intronic
1105213837 13:18273262-18273284 CATTTCCACCACAAGTCATGGGG + Intergenic
1106194568 13:27482156-27482178 CAATTCCACTACCAATTCTTTGG + Intergenic
1106768135 13:32936327-32936349 CAGTTCCACCACCAGATTGTGGG + Intergenic
1108110776 13:47069580-47069602 CAATTCAACCACCAGTCATTGGG - Intergenic
1108647213 13:52441919-52441941 TAATTCCCCCATCAGTTGTGAGG - Intronic
1109254774 13:60066172-60066194 CACTTCCACTACTAGATTTGAGG - Intronic
1109913476 13:68947959-68947981 AAATTTCAACACGAGTTTTGTGG + Intergenic
1110329415 13:74254015-74254037 CAAATACACAACCAGCTTTGAGG - Intergenic
1110705390 13:78597851-78597873 GGATTCCTCCACCAGTTTTGGGG - Intergenic
1111510848 13:89260797-89260819 CATTTCCACCAACAGTGTAGTGG + Intergenic
1111912109 13:94324374-94324396 CAATTCAATCACCTATTTTGGGG - Intronic
1112121214 13:96413854-96413876 GAATTCCACCACGGATTTTGAGG - Intronic
1113304236 13:109059389-109059411 CAATTCCTTCAGCAGTTTTTGGG + Intronic
1114425993 14:22623267-22623289 CATTTCCACCTTCAGTTCTGTGG - Intergenic
1114625953 14:24130568-24130590 AAATCCCACCACTGGTTTTGAGG + Intronic
1115167832 14:30469527-30469549 CAATGACACCACCAGTTTTCTGG + Intergenic
1115481111 14:33862120-33862142 GGATTCCACCACCAGTTCAGTGG + Intergenic
1117431134 14:55662828-55662850 CAAGTTCACCTCAAGTTTTGTGG - Intronic
1119099845 14:71869746-71869768 CAATTTCAACACAAGTTTTGAGG - Intergenic
1121027213 14:90625409-90625431 CATTTTCACCACCATTTCTGAGG + Intronic
1121034896 14:90693742-90693764 CATTCCCACCAGCAGTTATGAGG - Intronic
1125260028 15:37812970-37812992 GAATTCCATCACTTGTTTTGTGG - Intergenic
1129423319 15:75447623-75447645 TAGTTCCACAACTAGTTTTGGGG - Intronic
1133142194 16:3754154-3754176 CCATTTCTCCAGCAGTTTTGAGG - Intronic
1138286908 16:55817168-55817190 CAATTCCTGCAAAAGTTTTGGGG - Intronic
1138339938 16:56282168-56282190 CAATTCTACCACCAGCTATATGG + Intronic
1138893353 16:61172552-61172574 CATTTCCACCAACAGTTTGTTGG - Intergenic
1141979573 16:87541547-87541569 CAGTTGCACCGCCAGTCTTGCGG - Intergenic
1150544887 17:66145597-66145619 CAATTCCACTGCCATCTTTGTGG + Intronic
1155602997 18:27570821-27570843 CAAATCCACTACCACATTTGAGG - Intergenic
1158205086 18:54984144-54984166 AAATTCCAGCTCCAATTTTGTGG - Intergenic
1161652688 19:5495030-5495052 TAATTCCACCTCCCGTGTTGGGG - Intergenic
1163360714 19:16844407-16844429 CATTGGCACCACCAGTTTTGTGG - Intronic
1164940928 19:32251877-32251899 CACTTCCACCTCCAATGTTGGGG - Intergenic
1165029321 19:32986122-32986144 GCTTTCCACCACCAGTTGTGTGG - Intronic
1165200014 19:34135795-34135817 CATTTCCACCACCACATGTGTGG + Intergenic
1166731903 19:45064084-45064106 CACGTTCATCACCAGTTTTGGGG + Exonic
1202704200 1_KI270713v1_random:9419-9441 CAATCACACCACCAGTTTTCAGG - Intergenic
925239856 2:2315148-2315170 CAATTCCCCCAAAAGTTTTCAGG - Intronic
926095141 2:10076521-10076543 CAATTCAACCACCAGCTCTCAGG + Intronic
927090659 2:19708482-19708504 CAATGCCACCCCCAGGTATGAGG + Intergenic
928109388 2:28494331-28494353 CCATGCCACCAGCAGCTTTGAGG - Intronic
932442418 2:71745961-71745983 GAATTCCAACATGAGTTTTGAGG - Intergenic
932832135 2:75000450-75000472 CAGTTCCACCATCTGTTTGGAGG - Intergenic
933165902 2:79074377-79074399 AAATTCCAACATAAGTTTTGTGG - Intergenic
933450115 2:82438353-82438375 CAATTCCATTGACAGTTTTGTGG - Intergenic
933670427 2:85002082-85002104 CAATTCTTCTACCTGTTTTGAGG - Intronic
934300489 2:91773487-91773509 CATTTCCACCACAAGTCATGGGG - Intergenic
934473726 2:94578427-94578449 CAATTACAATTCCAGTTTTGGGG + Intergenic
937035633 2:118779396-118779418 CAACTCTTCCACCAGTCTTGAGG + Intergenic
937245276 2:120488535-120488557 CAATTCCAAAACCAGTCTTCTGG - Intergenic
939193623 2:138945664-138945686 AAATTCCACCTACAGCTTTGAGG - Intergenic
942740961 2:179177482-179177504 TAAATCCACCACCAGTTCAGGGG + Intronic
945286785 2:208090645-208090667 GAATTGCATCACCAGTTTTCTGG + Intergenic
946453471 2:219800958-219800980 TCATTCCACCACTAGCTTTGTGG + Intergenic
946668556 2:222077115-222077137 CTATTACAACACCTGTTTTGTGG - Intergenic
947081587 2:226403572-226403594 ACATTCCGCCACCAGTTATGGGG + Intergenic
947196484 2:227573311-227573333 CAACTCCACCACCATCATTGAGG - Intergenic
948693411 2:239720872-239720894 CAATGCCAGCACCACTGTTGCGG - Intergenic
1171245101 20:23604374-23604396 CAATCCCAGCATCAGTTTGGGGG - Intronic
1181698846 22:24608620-24608642 CATTTCCACCACAAGTCATGGGG - Intronic
951119543 3:18909095-18909117 CAATCACACCACCAGTTTTCAGG + Intergenic
951171231 3:19544015-19544037 CAATTTCAACATCAGTTTTAGGG + Intergenic
951943149 3:28104140-28104162 AATTTCCTCCACCAGGTTTGTGG - Intergenic
952072046 3:29648955-29648977 CAACTTCACCACCTGTTTTGGGG + Intronic
957545330 3:81629678-81629700 CAATTAAACATCCAGTTTTGTGG - Intronic
959063676 3:101637012-101637034 AAATTCCGCCACCCTTTTTGGGG + Intergenic
959999189 3:112713198-112713220 CACCTCCACCTCCAGCTTTGGGG - Intergenic
962256135 3:133871501-133871523 CAAATCCACCCACAGCTTTGGGG + Intronic
962423345 3:135247868-135247890 TGAGTCCACCACAAGTTTTGAGG + Intronic
962590742 3:136887670-136887692 AAATTCTACCACCAATTTTATGG - Intronic
964175967 3:153826361-153826383 CAATACCTACAACAGTTTTGGGG + Intergenic
964769569 3:160210319-160210341 CAATTCCTGCAGCAGGTTTGTGG - Intergenic
967200315 3:187067034-187067056 CAATTCCCCATCCAGTTTTAAGG + Intronic
968827350 4:2908855-2908877 CACATACACCACCAGCTTTGGGG + Intronic
969201396 4:5609078-5609100 GAATTATACCACCAGGTTTGCGG + Intronic
971750832 4:30645693-30645715 TAATGGCACCACCAGTTTTTTGG - Intergenic
975165212 4:71170738-71170760 CAACACCATCACCAGTATTGAGG - Intergenic
975643969 4:76527900-76527922 CCCTTCCACCACCAGCTGTGGGG - Intronic
975735123 4:77373248-77373270 CAATGCCAAAACCAGTTCTGAGG - Intronic
976244620 4:82994820-82994842 CAAATCCACCACCATATTTGGGG - Intronic
979491823 4:121337030-121337052 TTATTCCAGCAGCAGTTTTGAGG - Intronic
981259365 4:142701312-142701334 CATTTCCACCCTCTGTTTTGGGG - Intronic
983185388 4:164694893-164694915 CAATGTCACCACCATTCTTGAGG - Intergenic
989577117 5:42998868-42998890 TAATTCCACCTTCAGTTTTTGGG - Intergenic
990130060 5:52570184-52570206 CAATTCCATCAGCAGTTTATTGG + Intergenic
993251278 5:85526921-85526943 GAATTCCACCATCAATTTTGAGG + Intergenic
993478566 5:88394980-88395002 GAATACCAGCACCAGTTTGGGGG - Intergenic
994827390 5:104731985-104732007 AAATTTAACCACAAGTTTTGGGG + Intergenic
996135784 5:119840565-119840587 AAACTACACCACCAGTTTTTAGG + Intergenic
998292445 5:140927860-140927882 CACCTCCACCAGCAGTTTAGCGG - Exonic
998793546 5:145792650-145792672 CAATTCCACCAGCACTTTTTGGG - Intronic
1000251841 5:159503247-159503269 CAAGTGCATCAACAGTTTTGCGG - Intergenic
1000481536 5:161782186-161782208 CAATTCCATGACCAAGTTTGTGG + Intergenic
1003687475 6:8318555-8318577 CAATACCACCACCAGTGATCTGG - Intergenic
1004993612 6:21166374-21166396 AAATTCCCCTACCAGTTTTAAGG + Intronic
1007596293 6:43053276-43053298 CCACTCCACCACCAGTTCTCAGG - Intronic
1007745487 6:44040678-44040700 CAGTCCCACCAACAGTTTGGAGG + Intergenic
1008732059 6:54494438-54494460 CATTTCTCCCACCACTTTTGGGG - Intergenic
1015089974 6:129344408-129344430 TAATAGCACCACCATTTTTGGGG - Intronic
1017123249 6:151043951-151043973 CAATTACAATTCCAGTTTTGGGG - Intronic
1017123666 6:151046953-151046975 CAATTACAATTCCAGTTTTGGGG - Intronic
1018227263 6:161640204-161640226 CTCTTCCACCCCCAGTTTTCTGG + Intronic
1021953593 7:25800573-25800595 AAATTCCACCAGGATTTTTGTGG + Intergenic
1022358959 7:29641436-29641458 AAATTCCCCCACCCTTTTTGGGG - Intergenic
1026058269 7:67004245-67004267 AAATTTCAACATCAGTTTTGGGG - Intronic
1026719821 7:72820781-72820803 AAATTTCAACATCAGTTTTGGGG + Intronic
1028045389 7:86110909-86110931 CAACTCCTCAACCAATTTTGTGG + Intergenic
1032204431 7:129849639-129849661 CCATTTCTCCACCTGTTTTGAGG + Intronic
1034474102 7:151273006-151273028 CAGTCACACCGCCAGTTTTGGGG + Intronic
1040108775 8:43556324-43556346 AAATTCCCCCACCCTTTTTGGGG - Intergenic
1040519107 8:48160039-48160061 CAATCCCACAACCAGCTCTGGGG - Intergenic
1040958468 8:53005070-53005092 CACTTCCCCCACCCATTTTGAGG + Intergenic
1046186038 8:110720311-110720333 CATTTCCACCTCCAGTTTCAAGG + Intergenic
1051475996 9:17509710-17509732 CAATTCCACCCCCTGATTTGTGG - Intergenic
1053136084 9:35650922-35650944 CTTTGCCACCACCAGTATTGGGG - Exonic
1053684604 9:40510085-40510107 CAATTACAATTCCAGTTTTGGGG - Intergenic
1053685014 9:40513037-40513059 CAATTACAATTCCAGTTTTGGGG - Intergenic
1053934572 9:43138363-43138385 CAATTACAATTCCAGTTTTGGGG - Intergenic
1054278715 9:63111919-63111941 CAATTACAATTCCAGTTTTGGGG + Intergenic
1054279121 9:63114880-63114902 CAATTACAATTCCAGTTTTGGGG + Intergenic
1054297699 9:63345547-63345569 CAATTACAATTCCAGTTTTGGGG - Intergenic
1054298105 9:63348501-63348523 CAATTACAATTCCAGTTTTGGGG - Intergenic
1054395715 9:64650058-64650080 CAATTACAATTCCAGTTTTGGGG - Intergenic
1054396123 9:64653018-64653040 CAATTACAATTCCAGTTTTGGGG - Intergenic
1054430359 9:65155253-65155275 CAATTACAATTCCAGTTTTGGGG - Intergenic
1054430766 9:65158213-65158235 CAATTACAATTCCAGTTTTGGGG - Intergenic
1054499615 9:65863308-65863330 CAATTACAATTCCAGTTTTGGGG + Intergenic
1054500021 9:65866268-65866290 CAATTACAATTCCAGTTTTGGGG + Intergenic
1055030131 9:71765863-71765885 CAATTGCAACACCTGCTTTGTGG - Intronic
1055435184 9:76285646-76285668 CCCCCCCACCACCAGTTTTGCGG + Intronic
1055854527 9:80669936-80669958 AAATTCTACCATCAGTTCTGTGG - Intergenic
1056240709 9:84643877-84643899 GAACTACACCACCAGTTTTCTGG - Intergenic
1058753062 9:108058325-108058347 AAATTCCACCCCCAGCTATGGGG + Intergenic
1058878064 9:109261263-109261285 CAACTCTACCACCAGTTTAAAGG + Intronic
1059655055 9:116350080-116350102 CAACTCCACCATTAGTTTAGTGG + Intronic
1060121839 9:120998891-120998913 CTATTCAACCACTAATTTTGAGG + Intronic
1203440339 Un_GL000219v1:1747-1769 CAATCCCAGCAACAGTTTTCTGG + Intergenic
1203440571 Un_GL000219v1:4144-4166 CAATCCCAGCAACAGTTTTCTGG + Intergenic
1203498689 Un_GL000224v1:177890-177912 CAATCCCAGCAACAGTTTTCTGG + Intergenic
1203511225 Un_KI270741v1:120178-120200 CAATCCCAGCAACAGTTTTCTGG + Intergenic
1203511450 Un_KI270741v1:122527-122549 CAATCCCAGCAACAGTTTTCTGG + Intergenic
1185944800 X:4363057-4363079 CCATTTCACCACCAGTTCTCCGG - Intergenic
1187111584 X:16307007-16307029 CAATTTCCCCAACAATTTTGTGG + Intergenic
1189457857 X:41210247-41210269 CAATTACACCACTAGTTTTGTGG + Intronic
1190201823 X:48368289-48368311 CATTTCAGCCACCAGCTTTGTGG - Intergenic
1190208716 X:48427122-48427144 CATTTCAGCCACCAGCTTTGTGG + Intergenic
1192759880 X:74086006-74086028 AAATTCCACCACCATTGCTGTGG + Intergenic
1194646195 X:96461091-96461113 CAAATCCACCACCAGGTTTAAGG + Intergenic
1197798713 X:130326967-130326989 AAATTTCAACATCAGTTTTGGGG - Intergenic
1200183763 X:154168388-154168410 AAATTTCAACACGAGTTTTGGGG - Intergenic
1200189417 X:154205516-154205538 AAATTTCAACACGAGTTTTGGGG - Intergenic
1200195170 X:154243325-154243347 AAATTTCAACACGAGTTTTGGGG - Intergenic
1200200822 X:154280446-154280468 AAATTTCAACACGAGTTTTGGGG - Intronic
1200299910 X:154962970-154962992 CAATCCCACCTCCAGATCTGAGG + Intronic