ID: 1095670156

View in Genome Browser
Species Human (GRCh38)
Location 12:44849216-44849238
Sequence CATGGATTTCTTTGATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095670156_1095670158 3 Left 1095670156 12:44849216-44849238 CCTGCTCATCAAAGAAATCCATG 0: 1
1: 0
2: 3
3: 11
4: 170
Right 1095670158 12:44849242-44849264 AAAATAGACAAGCCACAAACTGG 0: 1
1: 0
2: 27
3: 166
4: 1240
1095670156_1095670159 4 Left 1095670156 12:44849216-44849238 CCTGCTCATCAAAGAAATCCATG 0: 1
1: 0
2: 3
3: 11
4: 170
Right 1095670159 12:44849243-44849265 AAATAGACAAGCCACAAACTGGG 0: 1
1: 11
2: 90
3: 719
4: 3363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095670156 Original CRISPR CATGGATTTCTTTGATGAGC AGG (reversed) Intronic
902088135 1:13878951-13878973 GATGGATTTCTCTAAGGAGCTGG - Intergenic
904130388 1:28271610-28271632 CATTGGTCTCTTTGATGAGTGGG + Intronic
904801572 1:33096760-33096782 CGTGGACATCTTTGCTGAGCTGG + Exonic
906295517 1:44646760-44646782 CAGGGATCTCTATGATGAGGTGG + Intronic
906368027 1:45227411-45227433 CATGGATTTTTTTGGTGGGAGGG - Intronic
908388032 1:63661217-63661239 CATAGTTTTGTTTGCTGAGCTGG - Intergenic
911888408 1:103334158-103334180 CATTAACATCTTTGATGAGCAGG - Intergenic
912488608 1:110048626-110048648 CATGGATTTCTCTTATAAGGAGG + Intronic
913685514 1:121228167-121228189 AATGGATTTCTTTGGGAAGCTGG + Intronic
914037360 1:144015771-144015793 AATGGATTTCTTTGGGAAGCTGG + Intergenic
914152093 1:145052161-145052183 AATGGATTTCTTTGGGAAGCTGG - Intronic
916007405 1:160674981-160675003 CATGGCTTTCTTTAAGGAACAGG - Intergenic
917072253 1:171164922-171164944 CATAGATTTCACAGATGAGCAGG - Intergenic
917970067 1:180200510-180200532 TATGGATTTCCTTCATGAGATGG + Exonic
920472833 1:206246725-206246747 AATGGATTTCTTTGGGAAGCTGG + Intronic
1067279085 10:44857823-44857845 CAGGGGTTTCTTTGCTGAGCAGG + Intergenic
1067741218 10:48897278-48897300 CAAGGATTTCTCAGATGAGTAGG + Intronic
1067987076 10:51162064-51162086 CAGTGATTTCTTTGTGGAGCTGG + Intronic
1068037605 10:51780639-51780661 CATGGATTAATTTGAGGAACTGG - Intronic
1071892776 10:90030173-90030195 CATGGCTTTCTTTGGTTAGTAGG - Intergenic
1072433595 10:95395724-95395746 CTTGGATTTCTGTGATCAGATGG - Intronic
1072567188 10:96626636-96626658 CAGGGATTTCCTGGATGACCTGG - Intronic
1073612846 10:104961343-104961365 CATGGATTTCTACGATCAGATGG - Intronic
1074304193 10:112261578-112261600 GATGGATTCCTTTGATGTCCAGG - Intergenic
1075008155 10:118845244-118845266 CATGGCTCTCTTTGAAGAGGAGG + Intergenic
1076578754 10:131492331-131492353 CATGGTGCTCTTTGATGAGTGGG - Intergenic
1080333195 11:31165765-31165787 TTTGAATTTCTTTGATGAGGAGG + Intronic
1082058835 11:47843300-47843322 CATGGAGGTCATTGATGACCTGG - Intronic
1083197351 11:61096454-61096476 AATGGTTTTCTTGGATGAGGGGG - Intergenic
1083565273 11:63709916-63709938 AATGAATTTCTTAGGTGAGCAGG + Intronic
1084032271 11:66487934-66487956 CATCGACCTCTTTGAAGAGCCGG - Exonic
1084699611 11:70777789-70777811 CAGTGATGTGTTTGATGAGCTGG - Intronic
1086158226 11:83692260-83692282 AATGGAGTTCAATGATGAGCAGG + Intronic
1090053393 11:123400845-123400867 GATTGATTTCTTTGCTGAGCAGG + Intergenic
1091180227 11:133597480-133597502 ACTCTATTTCTTTGATGAGCTGG - Intergenic
1095670156 12:44849216-44849238 CATGGATTTCTTTGATGAGCAGG - Intronic
1096484052 12:51965302-51965324 CATGGATTAATTTGGTAAGCAGG + Intronic
1098026763 12:66212191-66212213 CTTGGATTTTTAGGATGAGCCGG + Intronic
1098284273 12:68892386-68892408 CTTGGTTTTATTTGATTAGCTGG + Intronic
1107081765 13:36382530-36382552 AATGGGTTTATTTGAGGAGCTGG - Intergenic
1107727809 13:43317493-43317515 CATTGATTTCTTTGAATAGCAGG - Intronic
1108036019 13:46291316-46291338 CATGAATTTGTTTGATGACTGGG + Intergenic
1109748476 13:66657842-66657864 TGTAGATTTCTTTGATGTGCAGG - Intronic
1110477852 13:75939044-75939066 CATGGTTTTCTGTTATGGGCTGG + Intergenic
1110870074 13:80441180-80441202 CATTGTTTTCTTTGCTGTGCAGG + Intergenic
1111382937 13:87482781-87482803 CAAGGATATTTTTGAAGAGCTGG - Intergenic
1112161096 13:96868750-96868772 CACTGCTTTATTTGATGAGCTGG + Intergenic
1115530712 14:34324401-34324423 AAGGTATTTCTTTGATGTGCTGG + Intronic
1118451135 14:65903498-65903520 CATGGACATCTTTGAGGAGTGGG - Intergenic
1119599890 14:75968536-75968558 CCTGGATTTCTTTGAAGCCCTGG - Intronic
1120174460 14:81278296-81278318 CAGTGCTTTCTTTGAGGAGCAGG - Exonic
1121992638 14:98574560-98574582 CATTAATTACTTTGAAGAGCAGG - Intergenic
1122572963 14:102720496-102720518 CATAGATTTCTTTAATGATGGGG - Intronic
1122852431 14:104543938-104543960 TATGGACTTCTTTGAGGAGTGGG - Intronic
1123912378 15:24980781-24980803 CATGGATATATTTAAGGAGCCGG - Intergenic
1124149719 15:27166769-27166791 AATGGATTTCTTTGCTGCACTGG - Intronic
1125446093 15:39758497-39758519 CATGGATTTTTTTGAGGGGGGGG + Intronic
1126218538 15:46185432-46185454 TATGGATCTATTTGTTGAGCAGG - Intergenic
1126909594 15:53403685-53403707 CAGGAATTTCTTGGATGAGATGG - Intergenic
1126970995 15:54111700-54111722 CATGCAATCCTTTGATGAGCGGG - Intronic
1127597717 15:60503463-60503485 CAAGCATTTCTTTAATAAGCGGG + Intronic
1129577732 15:76769577-76769599 TTTGCATTTCTCTGATGAGCAGG - Intronic
1131040535 15:89261338-89261360 CATATATCTCTTTGAAGAGCTGG + Intronic
1133231194 16:4367396-4367418 CATTCACTCCTTTGATGAGCTGG + Intronic
1137510585 16:49096372-49096394 GATGGATTTCTGCAATGAGCGGG + Intergenic
1140399839 16:74662674-74662696 CATGGGTTTCACTGATGAACAGG + Intronic
1144440946 17:15281035-15281057 CATGGGATTCTTTTATGAGAGGG + Intergenic
1147000279 17:37357806-37357828 CCTGGATGTCTGTGATGAGAAGG - Intronic
1147054720 17:37825452-37825474 CATGGACTTCTTTGATAAATAGG - Intergenic
1151339693 17:73462884-73462906 CAGGGAGTTCCTTGTTGAGCAGG + Intronic
1154428658 18:14291634-14291656 AATTGAATTCTTTGATGTGCTGG + Intergenic
1154430932 18:14307979-14308001 AATTGAATTCTTTGATGTGCTGG + Intergenic
1156616864 18:38797110-38797132 AATGTATTTTTTTGATGAGAAGG + Intergenic
1156733600 18:40225976-40225998 GATGGATTTCTTTCATCAGAAGG - Intergenic
1158422979 18:57312655-57312677 AATGGATTTCCCTGATGAGAAGG + Intergenic
1158916321 18:62134887-62134909 CATTGTTTTTTTTGATGGGCGGG + Intronic
1161810388 19:6467993-6468015 CCTGGAGTCCTTTGAAGAGCTGG + Exonic
1162218381 19:9155853-9155875 CAGAGTTTTCTTTGGTGAGCAGG + Intronic
1163239567 19:16052112-16052134 CAAGCAATTCGTTGATGAGCAGG - Intergenic
1165136943 19:33675462-33675484 CCTCGATTTCCCTGATGAGCTGG + Intronic
1165261422 19:34622377-34622399 CTTGCATTTCTTTTATGAGGTGG + Intronic
1165799993 19:38543567-38543589 CAAGGATGTCATTGAAGAGCAGG + Exonic
929009010 2:37422891-37422913 TATGGAATTCTCAGATGAGCTGG + Intergenic
932555621 2:72822649-72822671 AGTGGATTTTTTTGAAGAGCAGG + Intronic
933858725 2:86442782-86442804 CCTGGTTGTCTGTGATGAGCCGG + Intronic
936227177 2:110666456-110666478 CATGTATTCCTATGATGACCTGG - Intronic
937862592 2:126722689-126722711 CAGGGATTTCTATGATGTGTGGG + Intergenic
939029259 2:137050909-137050931 AATGGATATATCTGATGAGCAGG + Intronic
939486485 2:142818717-142818739 CAGTGATTTCTCTGATGACCAGG - Intergenic
939882584 2:147647100-147647122 TATAGGTTTCTTTTATGAGCAGG - Intergenic
942668313 2:178346571-178346593 CTTGGATTTCTTTCCTGCGCAGG + Intronic
944075693 2:195728383-195728405 CAAGGATTTCTTTCATTTGCAGG - Intronic
944109261 2:196114413-196114435 CATGCATTTCTTTTATAATCAGG - Intergenic
945060275 2:205902912-205902934 CATGGCTTTCTGTGATGTCCAGG - Intergenic
947391438 2:229643428-229643450 CATGGATTTCATTGATTAGCAGG + Intronic
947506965 2:230714380-230714402 CATGGATTTACTTGATTATCTGG - Intronic
1171786969 20:29476216-29476238 CTTGGATTTCTTTCAACAGCCGG - Intergenic
1173474446 20:43349116-43349138 CATGTTCTTCTGTGATGAGCTGG + Intergenic
1174121606 20:48269840-48269862 CATTTATTTCTTTACTGAGCTGG + Intergenic
1174440670 20:50550017-50550039 CATGCATTACTTTGAAGATCTGG + Intronic
1177528024 21:22322382-22322404 CATGTATTTCTTTGGGGAGGCGG + Intergenic
1184464985 22:44663688-44663710 CATGGAATTCTTTGAGGAGAGGG + Intergenic
1184883393 22:47326637-47326659 TTTGCATTTCTCTGATGAGCTGG + Intergenic
1185255912 22:49831287-49831309 CATGGGTTTCTTTGTTGATTTGG - Intergenic
952409415 3:33033951-33033973 GACGGATTTTTCTGATGAGCAGG - Intronic
957247493 3:77733331-77733353 CATGGATTGCCTGGATGATCAGG - Intergenic
959179402 3:102959517-102959539 CATGTATTTCTTTGATATACTGG + Intergenic
962193674 3:133337172-133337194 CCTGGGGTTCTTTGATCAGCAGG - Intronic
962528942 3:136260696-136260718 CATGGATCTCTTCCATGGGCTGG + Intronic
965235799 3:166119976-166119998 CTTGGCTTTCTTTGGTGATCTGG + Intergenic
965931685 3:174051364-174051386 CCTGGATTTCACTGATGAGACGG + Intronic
966901148 3:184486846-184486868 CTTGCATTTCTCTGATGATCAGG + Intronic
967408346 3:189142069-189142091 CAGGAATGTCTTTGCTGAGCAGG + Intronic
970093289 4:12433567-12433589 CATGGATTTCTAAGATGATGAGG - Intergenic
970176854 4:13348234-13348256 CAGGGATCTCTTTGATGTTCAGG - Intergenic
972121896 4:35713383-35713405 GGTGGCTTTCTTTGGTGAGCAGG - Intergenic
973641203 4:52904622-52904644 CATAGATTTTATTCATGAGCTGG + Intronic
973919167 4:55667244-55667266 CATGGAATTCATTGATTAGTAGG - Intergenic
974874988 4:67692931-67692953 CATTGATTTCTTTAATGACATGG + Intronic
979644920 4:123057241-123057263 CATTATTTTCTTTGATGAACTGG + Exonic
979973028 4:127161152-127161174 CTTGGCTTTCTTTGATGAGAAGG - Intergenic
982770663 4:159393959-159393981 CATGGATTCCTAAGAGGAGCTGG + Intergenic
984770396 4:183432290-183432312 CATGGAATTCTTTTATAGGCAGG - Intergenic
986331604 5:6720342-6720364 CATAGAATCCGTTGATGAGCAGG + Intronic
987018060 5:13840905-13840927 AAGGGATATCTTTGATGACCTGG - Exonic
987579543 5:19772205-19772227 CATGGATATTTTTGAGGAGGTGG - Intronic
988793385 5:34629948-34629970 CAGGTATTTCTCTGATGAGGTGG - Intergenic
988811305 5:34787621-34787643 CAGGGATTTTTTTGAGGAGGAGG + Intronic
989347730 5:40448664-40448686 TTTGGATTTCTTTAATGATCGGG + Intergenic
990671469 5:58135235-58135257 CAGGCATTACTTTGAAGAGCAGG - Intergenic
991134719 5:63167926-63167948 CATGGATTTCATTCTTCAGCAGG - Intergenic
992218095 5:74545417-74545439 AATGGATATATTTGATCAGCGGG - Intergenic
994186164 5:96817369-96817391 TATTTATTGCTTTGATGAGCAGG - Intronic
995702233 5:114949183-114949205 CATGCATTTCTTAGTTGAACAGG - Intergenic
996064732 5:119068304-119068326 CCTGGATTTCTTGGATTAGCAGG + Intronic
996221564 5:120938531-120938553 AATGGATTTATTTACTGAGCAGG + Intergenic
999994719 5:157081134-157081156 CATTTATTTCTTTGATGAGGAGG + Intergenic
1001731531 5:173964158-173964180 CATGCATTTCATTGTGGAGCCGG + Intergenic
1002060751 5:176624449-176624471 CATTGATCTCTTTCATGAGCAGG - Intronic
1002566365 5:180114499-180114521 AGTAGATGTCTTTGATGAGCAGG + Exonic
1003633497 6:7810143-7810165 AATAGATTTCTTTGATTCGCTGG + Intronic
1006402257 6:33824772-33824794 CATGGATGTCGTTTCTGAGCTGG + Intergenic
1007481731 6:42154703-42154725 CATGGATTGCTTTGAACAGAGGG - Intergenic
1007757019 6:44106272-44106294 CAGGGAGTTCTTTGTTGTGCGGG + Intergenic
1008056574 6:46951770-46951792 CATGGATTTCTCTGAGTTGCAGG + Intronic
1011206001 6:84898703-84898725 CATGTTTTTCTTTGATGGGTAGG + Intergenic
1012037074 6:94155843-94155865 CATGGATTACTCTGATGAATTGG - Intergenic
1013613195 6:111815018-111815040 AATAGACTTCTTTGAAGAGCTGG + Intronic
1015953168 6:138574366-138574388 AATGGATTTCTCTGGTGAGATGG - Intronic
1019221188 6:170474213-170474235 CATGGATCCCTTTGGTGATCTGG + Intergenic
1019570096 7:1707338-1707360 CATGGAGTGCTTTGCAGAGCTGG + Intronic
1023109177 7:36792864-36792886 CATGGACATCTTTGATGGGACGG - Intergenic
1023516872 7:41009863-41009885 CACTGATTTCATTGATGAGAAGG - Intergenic
1024614066 7:51093051-51093073 CATTGTTTTCTTTGCTGTGCAGG - Intronic
1027353197 7:77332595-77332617 CATGGATTTCTTTGAAAATCTGG - Intronic
1029726980 7:102412991-102413013 CCTGGATTTCTTTGATGGGCAGG - Intronic
1037874190 8:22531147-22531169 CAAGGATATCTCTTATGAGCTGG + Intronic
1037935917 8:22915027-22915049 CTCGGGTTTCTGTGATGAGCAGG - Intronic
1040601713 8:48891066-48891088 CATGTATTTCTCTGAAGATCTGG + Intergenic
1040896099 8:52370027-52370049 CATGCATGTCTGTGAGGAGCGGG - Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1042258844 8:66835285-66835307 CATGGATTTCTATAGTGGGCTGG - Intronic
1044249397 8:89988518-89988540 CATGGAATTCTCTGGTGAGAAGG - Intronic
1046316700 8:112512081-112512103 CATGGATGACTGTGATGAGGGGG - Intronic
1047618548 8:126583317-126583339 TATGGTTTTCTTTTATGAGGTGG + Intergenic
1048489875 8:134882847-134882869 CACTGATTGCTTTGAGGAGCAGG + Intergenic
1050453707 9:5811222-5811244 CATGGTCTTCTTTGATGTGCTGG - Exonic
1051567792 9:18519975-18519997 CATGTCTTTCTTTGAAGAACAGG + Intronic
1053303299 9:36966716-36966738 CCTGAATACCTTTGATGAGCAGG + Exonic
1056937769 9:90930390-90930412 CTTGGACTTCTTTGCTTAGCAGG - Intergenic
1057481735 9:95449921-95449943 CAGGTATTTCTTTGCTGTGCTGG - Exonic
1057989756 9:99756359-99756381 CATGGATGCCTTTCATGACCTGG - Intergenic
1059520105 9:114932940-114932962 CATGGATTTCTATGTTGGCCAGG - Intergenic
1203447566 Un_GL000219v1:73691-73713 CTTGGATTTCTTTCAACAGCAGG - Intergenic
1185498951 X:583384-583406 CATGTATCTCTTTGATGGCCAGG - Intergenic
1186880402 X:13859998-13860020 CATGGATTTCTTTTTTAACCTGG - Intronic
1188185775 X:27112704-27112726 CATGGACTTCTTTGATGGGCTGG - Intergenic
1193761294 X:85469688-85469710 GATTGATTTCTTTGCTGTGCAGG + Intergenic
1194880894 X:99250906-99250928 CATGTGTTTCTTTCATTAGCAGG - Intergenic
1196714108 X:118794655-118794677 CATGAGTTTCTTTGATGTTCTGG + Intergenic
1198517368 X:137423340-137423362 CATGGGTCTTTTTAATGAGCGGG - Intergenic
1198550780 X:137742996-137743018 CCTGGAGTTCTTAGATGGGCTGG + Intergenic
1199547772 X:149025291-149025313 CATGGTTATCTTTGAAGAGGTGG + Intergenic
1200804635 Y:7420385-7420407 CATGGTTTTCTTTTAAGAGGTGG - Intergenic
1202102607 Y:21326284-21326306 TCTGGACTTCTTTGCTGAGCAGG - Intergenic