ID: 1095672285

View in Genome Browser
Species Human (GRCh38)
Location 12:44875849-44875871
Sequence CAGTAAGACCCGAGACTCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095672284_1095672285 0 Left 1095672284 12:44875826-44875848 CCGAAGATCAAACAGAATGTTCT 0: 1
1: 0
2: 2
3: 28
4: 271
Right 1095672285 12:44875849-44875871 CAGTAAGACCCGAGACTCCATGG 0: 1
1: 0
2: 0
3: 5
4: 79
1095672282_1095672285 12 Left 1095672282 12:44875814-44875836 CCTGCTCCGAGACCGAAGATCAA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1095672285 12:44875849-44875871 CAGTAAGACCCGAGACTCCATGG 0: 1
1: 0
2: 0
3: 5
4: 79
1095672283_1095672285 6 Left 1095672283 12:44875820-44875842 CCGAGACCGAAGATCAAACAGAA 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1095672285 12:44875849-44875871 CAGTAAGACCCGAGACTCCATGG 0: 1
1: 0
2: 0
3: 5
4: 79
1095672281_1095672285 19 Left 1095672281 12:44875807-44875829 CCACTCACCTGCTCCGAGACCGA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1095672285 12:44875849-44875871 CAGTAAGACCCGAGACTCCATGG 0: 1
1: 0
2: 0
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095672285 Original CRISPR CAGTAAGACCCGAGACTCCA TGG Exonic
902617616 1:17632406-17632428 CAGGAAGACCCGACGCTCCTTGG - Exonic
904021951 1:27473431-27473453 GAGCAAGACTCCAGACTCCATGG + Intronic
904881230 1:33698658-33698680 CAGTTAGACCCCATGCTCCAGGG - Intronic
911332965 1:96546528-96546550 CTTAAAGACCTGAGACTCCATGG + Intergenic
915576945 1:156785688-156785710 CAGTGAGTCCAGAGACTGCAAGG - Intronic
920577158 1:207069969-207069991 CAGTGAGACAAGAGACTCCTAGG - Intronic
1062824668 10:558895-558917 CAGCAGGACCCCAGACACCACGG + Intronic
1074468540 10:113706041-113706063 CAGAGACACACGAGACTCCACGG - Intronic
1076441564 10:130484373-130484395 CGATAAGACCAAAGACTCCATGG - Intergenic
1085766037 11:79282327-79282349 CTGTGTGACCCGATACTCCAGGG + Intronic
1089832325 11:121339479-121339501 CAATAAGACATGAGACTCTAAGG + Intergenic
1090795681 11:130133933-130133955 CAGTGAAGCCCGAGGCTCCATGG - Intronic
1095672285 12:44875849-44875871 CAGTAAGACCCGAGACTCCATGG + Exonic
1098352700 12:69581011-69581033 AAGAAAGACCCAAGACTTCATGG - Intergenic
1113780444 13:112973761-112973783 CAGGGAGACCCGTGGCTCCAGGG + Intronic
1117050472 14:51854911-51854933 CAGTAAGACCTCAGGCTTCATGG + Intronic
1122858552 14:104571874-104571896 CAGAAAGACCCGAGAGCCCCAGG + Intronic
1124970871 15:34489082-34489104 CAGGAAGCCCGGAGTCTCCAGGG + Intergenic
1125521066 15:40348077-40348099 CAGTAACACCCTGCACTCCAAGG + Intergenic
1125759760 15:42088529-42088551 CAGGAAGAACAGAAACTCCAGGG - Intronic
1127061403 15:55189772-55189794 CAGTCAGTCACGAGACTTCAGGG - Intronic
1139375283 16:66493053-66493075 CAGTGAGAACTCAGACTCCAAGG - Intronic
1150452179 17:65278425-65278447 CGGGATGACCTGAGACTCCAAGG - Intergenic
1152211972 17:79007534-79007556 CAGAAAGTACCGAGACTCCGAGG + Intronic
1152446897 17:80350155-80350177 CAGTAAGAACAGATAGTCCAGGG - Intronic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1155396745 18:25393798-25393820 GAGAAAGACCTGAGAGTCCAGGG + Intergenic
1159402085 18:67951742-67951764 CAGTAAGGCTGGAGACACCAAGG + Intergenic
1159999596 18:75004114-75004136 CAGTGAGACCAGGCACTCCAGGG - Intronic
1165405492 19:35628610-35628632 CAGGAAGACCGGAGACGCCCGGG - Intergenic
1165848882 19:38837409-38837431 CAGGAAGCCCAGAGTCTCCAGGG + Exonic
925198452 2:1946979-1947001 CATTATGACCCGCGACACCAAGG - Intronic
925383806 2:3447816-3447838 AGGTCAGACCAGAGACTCCAGGG + Intronic
928317109 2:30255075-30255097 TAGTAAGACCCGGGACTCTGTGG - Intronic
930169754 2:48239088-48239110 GAGTAATGCCCTAGACTCCAAGG - Intergenic
932318364 2:70801615-70801637 GAGTGGGACCCCAGACTCCACGG + Intergenic
933832373 2:86221500-86221522 CACAAAGACCAGTGACTCCAGGG + Intronic
935022359 2:99243919-99243941 CAGTGTGACCCGAGACTCCCTGG - Intronic
935631415 2:105215585-105215607 CAGTAAGAGCAGAGGCTACAAGG - Intergenic
935967404 2:108494451-108494473 CAGTAAGAGCCCAGAATCCAGGG - Intronic
943740346 2:191400466-191400488 CAGGTAGGCCCGAGACCCCAAGG + Exonic
948183895 2:236003921-236003943 CAGTCAGCCCCTGGACTCCATGG + Intronic
948523988 2:238559278-238559300 CAGCCAGACCCGAGCCTCCTGGG + Intergenic
1170184102 20:13567891-13567913 TAGTAAGACTCGAGACTGGAAGG + Intronic
1171144326 20:22768297-22768319 CAGGAAGACCCCAGACGGCAGGG + Intergenic
1171360440 20:24583059-24583081 CAGTGAGACCTGAGGCTCCCTGG - Intronic
1175977060 20:62716323-62716345 CTGAAAGACGCCAGACTCCAAGG + Intronic
1181493062 22:23272848-23272870 CTGTCAGACCCGAGCCTGCATGG - Intronic
1182182734 22:28367936-28367958 AAGAAAGGCCCGAGACTCGATGG + Intronic
950659669 3:14459401-14459423 CTGCAAGACCTGGGACTCCAGGG + Intronic
953836666 3:46352074-46352096 AAGTAAGACCTGAGACTTGAAGG - Intergenic
963174520 3:142283843-142283865 CATTAAGAGATGAGACTCCATGG + Intergenic
966148746 3:176842646-176842668 TAGCATGACCCAAGACTCCAGGG - Intergenic
969575864 4:8035345-8035367 AAGCAAGAGCTGAGACTCCAGGG - Intronic
977711115 4:100126468-100126490 AAGTAAGACACCTGACTCCAAGG - Intergenic
978436836 4:108694693-108694715 CAGTAACACCAGAGCCTACAGGG + Intergenic
979550775 4:121988660-121988682 CAATAAGATCAGAGAGTCCAGGG + Intergenic
983440343 4:167774818-167774840 CACTATGACCTCAGACTCCAGGG + Intergenic
983453984 4:167939998-167940020 CAGGGAGAGGCGAGACTCCAAGG + Intergenic
984744821 4:183204293-183204315 CAGAAAGACCCGAGAATACCAGG + Intronic
986653801 5:9990695-9990717 CAGGAAGACCCGAGCATCCAAGG + Intergenic
1003596770 6:7481177-7481199 CAGGAAGCCCCGAGCCTCCAGGG + Intergenic
1006380958 6:33696925-33696947 CAGTAAGAGCCAAGGTTCCATGG + Exonic
1008096285 6:47342861-47342883 CAGTAAAAGCCGAGACTGAAAGG + Intergenic
1015345145 6:132147779-132147801 CAAAAAGACCTGAGACTCCCTGG + Intergenic
1026742477 7:72987766-72987788 CAGCAAGACCCCAGGGTCCAGGG + Intergenic
1026872081 7:73858968-73858990 CAGGAAGACATGAGACTCCCAGG - Intergenic
1027101258 7:75377312-75377334 CAGCAAGACCCCAGGGTCCAGGG - Intergenic
1029494917 7:100891310-100891332 CAATGAGCCCCGAGACCCCAAGG - Exonic
1033387839 7:140896200-140896222 CTGTAAGACCCAAAACTACAAGG - Intronic
1035256306 7:157630538-157630560 GAGTAAGACCCGTAATTCCATGG - Intronic
1037667686 8:20984491-20984513 CAGTATGAGCCAAGACTCCCAGG + Intergenic
1042679228 8:71362135-71362157 AAGAAAGCCCCGAGGCTCCATGG - Exonic
1045250712 8:100481423-100481445 CAGCAAGATCCAGGACTCCAGGG - Intergenic
1045549961 8:103162823-103162845 TGGTAAGACACGAGACTCCAGGG + Intronic
1047364096 8:124196383-124196405 GAGTAAGACCAGGGACTCAAAGG + Intergenic
1047405179 8:124579220-124579242 CAGTAAAACTCAAGACTCAAGGG + Intronic
1050265161 9:3882226-3882248 CACTGAGCCCCGAGATTCCATGG - Intronic
1050361141 9:4832159-4832181 CAGAAAGACCCCAGACTTCCTGG + Intronic
1058129341 9:101232321-101232343 CAGTGAGAACAGACACTCCAAGG - Intronic
1058315866 9:103565052-103565074 CAGGAAGAGCAGAGAATCCAGGG + Intergenic
1062335416 9:136063280-136063302 GAGTCAGACCCCAGCCTCCAGGG - Intronic
1186381799 X:9068513-9068535 CAGTAAGCCACAAGACTCTAGGG + Intronic
1200914239 Y:8557351-8557373 CAGAAAGACCCCAGAGTCCCAGG + Intergenic
1202199545 Y:22331779-22331801 CAGCAAGGCCTGAGTCTCCAGGG - Intronic