ID: 1095672653

View in Genome Browser
Species Human (GRCh38)
Location 12:44877944-44877966
Sequence TTAGATGCACAGCTGTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095672653 Original CRISPR TTAGATGCACAGCTGTAGAA AGG (reversed) Intronic
900868637 1:5286280-5286302 GGAGATGCAGAGCTGTACAAGGG + Intergenic
901139074 1:7016404-7016426 GTAGGTGCTCAGCTGTCGAATGG + Intronic
901686542 1:10946648-10946670 TTAGATGCCCAGCTGTGGCTGGG - Exonic
902574706 1:17370195-17370217 TAAAATACACAGCTGTACAAAGG + Intergenic
902948382 1:19860744-19860766 TTAGAAGCACATCTGTAGGTGGG + Intergenic
907053440 1:51344882-51344904 TGAGAGGCACAGCTGGGGAAAGG - Intronic
907152993 1:52306324-52306346 TGAGATGACCAGCTGTAGAGAGG + Intronic
908248145 1:62244090-62244112 CTAGATGCTCATCTGTAAAATGG - Intronic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
911006282 1:93228099-93228121 TTAGATACACAGGTGATGAAAGG + Intronic
913030409 1:114897123-114897145 TTAGATGTACTTCTTTAGAATGG - Intronic
915128184 1:153679972-153679994 ATAGAAACTCAGCTGTAGAAAGG - Intronic
916290124 1:163156610-163156632 TTAGGTGCACAGATTTAGACTGG - Intronic
916426899 1:164689357-164689379 CTAGATACACAGCTGTGGACAGG - Intronic
916613760 1:166418971-166418993 TTGGATGCACAGCTGTGGTGCGG + Intergenic
917073590 1:171179518-171179540 GTACATGCCCAGCTGTGGAATGG - Intergenic
918174947 1:182035463-182035485 TTAGATGTACTTCTTTAGAAGGG - Intergenic
918667809 1:187173380-187173402 TTATAAGAACAGATGTAGAATGG - Intergenic
919280261 1:195481609-195481631 TTAGATGTACATCTTTAGAGGGG - Intergenic
922451256 1:225739306-225739328 TTATATGATCACCTGTAGAAGGG + Intergenic
922538979 1:226404735-226404757 TTAGCTGCACAGCTGAGGCAAGG + Intronic
1063799582 10:9558173-9558195 TCAGATGGACAGATGAAGAAAGG + Intergenic
1064024013 10:11832595-11832617 TTAAACACACAGCAGTAGAAAGG - Intronic
1065299742 10:24310648-24310670 TTAGAGGCACACCTGGAGCAAGG - Intronic
1065630218 10:27672247-27672269 TTTAATGGACAGCTGTAGAGAGG - Intergenic
1067421838 10:46158959-46158981 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1067507144 10:46865048-46865070 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1068076752 10:52265284-52265306 TTCCATGCACAGCAGGAGAAGGG - Intronic
1069194493 10:65532494-65532516 TGAGATCCACATCTGTTGAAGGG + Intergenic
1069549349 10:69351778-69351800 TTACTTGCTCATCTGTAGAATGG + Intronic
1070465637 10:76720832-76720854 ATAGATGCTCTGCTGGAGAAAGG + Intergenic
1070859318 10:79638095-79638117 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1071845955 10:89521467-89521489 TGATATGTACAGCTGTACAAAGG + Intronic
1072354440 10:94593495-94593517 TTAGATGCACAGCTTCAACACGG + Exonic
1074735710 10:116430471-116430493 TCAGCTGCACAGGTGTAGACAGG + Intronic
1075088506 10:119429915-119429937 TGAGATGCACAGGTGTAGGGAGG + Intronic
1081256243 11:40899230-40899252 GTAGATGCACAGCTGAAGAAAGG - Intronic
1084991044 11:72925939-72925961 TTGGATCCACAGCTGCAGATTGG - Intronic
1088299765 11:108344620-108344642 TGAGATGAACAGCAGTAGGAAGG + Intronic
1092505540 12:9095197-9095219 TAACATTCACATCTGTAGAAGGG + Intronic
1092815267 12:12306993-12307015 TGAGAAGCACTGCTCTAGAAAGG + Intergenic
1094449612 12:30571098-30571120 TTAGATGCAAAGCAGAAAAAAGG + Intergenic
1095139476 12:38643936-38643958 TTAGAAGCACATCTGTGGATGGG + Intergenic
1095672653 12:44877944-44877966 TTAGATGCACAGCTGTAGAAAGG - Intronic
1096729878 12:53600665-53600687 TTAGATGGACAGCTTTAGAAAGG + Intronic
1101242883 12:102855740-102855762 TTAGATGCCCTGGTTTAGAAAGG - Intronic
1104141776 12:125994374-125994396 TTAGGTGCACATCTGAGGAAAGG + Intergenic
1106223198 13:27764839-27764861 TTATATGCACAGATATAGAAAGG + Intergenic
1107691660 13:42959546-42959568 TTAGATGCAGAGCTGCATACAGG - Intronic
1109079248 13:57876968-57876990 TTAGATTGACAGCCATAGAATGG + Intergenic
1109294910 13:60518305-60518327 TAAGATGCACAGCTTGAGAGGGG - Intronic
1109982307 13:69924425-69924447 TTGGATGGCCAGCTGCAGAAAGG + Intronic
1114143287 14:19942045-19942067 GTAGCTGCTCAGCTGCAGAATGG - Intergenic
1116537463 14:46051308-46051330 TTAGATTCACAGCTGGAGTTTGG - Intergenic
1118350572 14:64970710-64970732 TTAGTTTCTCATCTGTAGAACGG - Intronic
1118700070 14:68424458-68424480 GTATAGGCACAGCTGTTGAAGGG - Intronic
1120216581 14:81687204-81687226 TTACATACACAGCTTTAGAAAGG + Intergenic
1120849223 14:89154420-89154442 TTAGACACACTGCTCTAGAAAGG + Intronic
1122051606 14:99064784-99064806 TTGGATGCAAAGATGAAGAAAGG - Intergenic
1125204325 15:37135227-37135249 TTAGATATACAGCTGTCCAATGG + Intergenic
1126076314 15:44913727-44913749 TTAGAATCACAGTTTTAGAAAGG - Intergenic
1126082533 15:44979275-44979297 TTAGAATCACAGTTCTAGAATGG + Intergenic
1127654414 15:61042888-61042910 TTTGATGCATTGCTTTAGAAGGG - Intronic
1128964110 15:72040284-72040306 TTAGATGCACTTCTTTAGAGGGG + Intronic
1129594855 15:76954578-76954600 TTAGTTCCTGAGCTGTAGAAAGG + Intergenic
1134072833 16:11271561-11271583 TTAGAGGGACAGCTGCAGCAGGG + Intronic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1135040818 16:19115367-19115389 TGAGACGCACAGCCATAGAAAGG - Exonic
1138396379 16:56708026-56708048 TCAGATGCAGAGCTGGAGACAGG + Intronic
1138612038 16:58132939-58132961 TTAGATGCACACTGGTACAATGG - Intergenic
1143778760 17:9218304-9218326 TTAGATTCTCATCTGTAAAATGG + Intronic
1144755363 17:17677140-17677162 TTAGTTGCACACAGGTAGAAGGG - Intergenic
1145290274 17:21539067-21539089 TTAGATGGACAGATGTAGATAGG + Intronic
1146129606 17:30259954-30259976 TTAGATGCCCTCCTCTAGAAGGG + Intronic
1146589278 17:34114553-34114575 TTAGATCCACATCTGCAGAAAGG + Intronic
1154126350 18:11695683-11695705 TTAAATCCTCAGCTGTAGATAGG + Intronic
1154461310 18:14590545-14590567 GTAGCTGCTCAGCTGCAGAATGG - Intergenic
1158407781 18:57175662-57175684 TTAAATGCAGAGCTGGAGCAAGG - Intergenic
1158683681 18:59593242-59593264 TCACATGGACAGCTGAAGAATGG - Intronic
1163298874 19:16430399-16430421 TTGGTTGCACAGTTGTGGAAGGG - Intronic
1164743041 19:30590840-30590862 TTAGATGTCCAGCTGTTGAAGGG + Intronic
925521276 2:4748204-4748226 TTATATTCACATCTGTAAAATGG + Intergenic
925621362 2:5796441-5796463 TTAGATGCATGTCTGTAGTACGG - Intergenic
925630215 2:5884321-5884343 TAGCATGAACAGCTGTAGAAAGG + Intergenic
926169368 2:10541958-10541980 AAAGATGCTCAGCTGTTGAAAGG - Intergenic
928087973 2:28357416-28357438 TCAGTTGCTCATCTGTAGAATGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929790480 2:45018812-45018834 GGTGATGCACAGCTGCAGAAGGG - Intergenic
929901706 2:46009954-46009976 TTCAATGCACATCTGTTGAATGG - Intronic
931269007 2:60685567-60685589 ACAGATGCCCAGCTGGAGAAAGG + Intergenic
934030670 2:88043137-88043159 TGAGAACCACTGCTGTAGAAAGG - Intronic
934030852 2:88045223-88045245 TCAAATACACAGTTGTAGAATGG - Intronic
939507906 2:143071979-143072001 TTATATGCACAACTTTGGAAAGG - Intergenic
940049456 2:149447174-149447196 TTAAATGCACATCAGTAGTAAGG + Intronic
941379955 2:164780180-164780202 CTAGATCCACATCTGTAAAATGG + Intronic
941686270 2:168452099-168452121 TTAGATGCAAAGTGGTAGGAAGG + Intergenic
943200997 2:184823633-184823655 TTGGATATACAGCTTTAGAATGG + Intronic
943420123 2:187659166-187659188 TTAGATGCACTTCTTTAGAGGGG + Intergenic
943742744 2:191428009-191428031 TTAGATGCATAGGGGTAGAATGG + Intergenic
945991760 2:216401840-216401862 TTAGATACAGAGCCTTAGAAGGG + Intergenic
946197412 2:218043391-218043413 TGGGATGAACAGCTGCAGAAAGG - Intronic
947887852 2:233589594-233589616 TTACATGCAGATCAGTAGAATGG + Intergenic
1169512663 20:6281168-6281190 TTGGATCCACATCTGTAAAATGG + Intergenic
1171055637 20:21903808-21903830 TAAGAGGCACACCTGTATAAAGG - Intergenic
1171299266 20:24045480-24045502 TTAGAGGCAAAGCTGGAAAAGGG - Intergenic
1175064936 20:56276713-56276735 TTAGATGTACCTCTTTAGAAGGG + Intergenic
1175111549 20:56652025-56652047 ATAGCTGCATAGCTGTACAACGG - Intergenic
1175790336 20:61736690-61736712 GGATATGCACAGCTGAAGAAGGG - Intronic
1176813197 21:13567302-13567324 GTAGCTGCTCAGCTGCAGAATGG + Intergenic
1177347003 21:19886472-19886494 CTAGAAGTACAGTTGTAGAAGGG - Intergenic
1178969701 21:37162170-37162192 TCAGATGCACAGCTTTAGAAAGG - Intronic
1179675303 21:42976959-42976981 TTGGATCCATAGCTGCAGAATGG + Intronic
1180041055 21:45280352-45280374 GTAGATCCACAGCTGAAGATGGG - Intronic
1184026671 22:41862782-41862804 TAAGATGAACATCTGCAGAAAGG - Intronic
949940457 3:9150466-9150488 TTCCATGCACAGATGGAGAAAGG + Intronic
953701462 3:45199129-45199151 TCAGAGGCTCAGCTGTAAAAGGG - Intergenic
956081280 3:65559171-65559193 TTAGATGCTCAGCTTCTGAAAGG - Intronic
956944695 3:74207129-74207151 TTAGATGCAGTGTGGTAGAATGG + Intergenic
959262197 3:104096986-104097008 TTAAGTGCACAGTTGAAGAATGG + Intergenic
959642179 3:108654028-108654050 TAAGATGCTCAGCATTAGAAGGG - Intronic
962065820 3:131979630-131979652 AAAGATGCAGAGCTGCAGAATGG - Intronic
963431326 3:145208358-145208380 TTGGATCCTCATCTGTAGAAGGG + Intergenic
966016317 3:175142194-175142216 TTAGATGCACAAATGAAAAATGG - Intronic
969421143 4:7096747-7096769 GTAGATGCCCAGGAGTAGAATGG - Intergenic
969623763 4:8292240-8292262 TTAGAGGCAGATCTGGAGAAGGG + Intronic
969869565 4:10096172-10096194 TTTAATGCACAGCTGCAGAGTGG + Intronic
970271030 4:14347814-14347836 GTAGAAGCACAGATGTAGGAAGG - Intergenic
970289194 4:14553097-14553119 TTAGATGCTCATCTGTAAACAGG - Intergenic
970772898 4:19637824-19637846 TTAGATGTTCATCTGTAAAATGG + Intergenic
973043551 4:45505639-45505661 CTAGATGCAAAATTGTAGAATGG + Intergenic
973807480 4:54540016-54540038 TGAGGTGCACAGCTGCAGGATGG + Intergenic
974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG + Intergenic
975931788 4:79533205-79533227 TGAAATGCACAGCTGTGGATTGG - Intergenic
976241752 4:82965394-82965416 TTAGATTCAAAGCTGGAGGAGGG + Intronic
977157043 4:93587224-93587246 TTAGATGCACAGGATTACAAAGG + Intronic
978810571 4:112845057-112845079 TAAGAAGTACAGCTGTAGAAAGG + Intronic
979858785 4:125667571-125667593 TGGGATCCACATCTGTAGAAGGG + Intergenic
980859839 4:138486094-138486116 TTTGATACATAGCTCTAGAATGG - Intergenic
981324129 4:143427201-143427223 TTAGATGCACTTCTTTAGAGTGG - Intronic
986804224 5:11293089-11293111 TTGTTTGCACAGCTGTATAATGG - Intronic
987081210 5:14427196-14427218 TTAGATGAGGAGCTGCAGAAAGG - Intronic
990380105 5:55214509-55214531 TGAGATGCAGAGATGAAGAAGGG + Intergenic
991288387 5:65006269-65006291 TTAGTTGCACATTTGTAAAATGG + Intronic
991434725 5:66585950-66585972 TTAATTTCAAAGCTGTAGAATGG - Intergenic
995655801 5:114424891-114424913 GTAGATGCCCAGATGTTGAAAGG + Intronic
996537871 5:124597023-124597045 GTAAATGCTCAGCTGTGGAAGGG + Intergenic
998522043 5:142809965-142809987 TCTTATCCACAGCTGTAGAAAGG - Intronic
1002943024 6:1734297-1734319 CTACATGAACAGCTGTATAATGG - Intronic
1004570896 6:16844019-16844041 TTCAATACATAGCTGTAGAAAGG - Intergenic
1007306921 6:40914140-40914162 TGAGATTCCCAGCTGTAGAGTGG + Intergenic
1008317103 6:50058155-50058177 TTAAATGCAGAGATGTAGATGGG + Intergenic
1008752143 6:54747983-54748005 TTAAATTTACAGCTTTAGAATGG - Intergenic
1012929760 6:105304592-105304614 ATAGATGCACAGGCCTAGAACGG - Intronic
1013564457 6:111343411-111343433 TTGACTGCAAAGCTGTAGAAGGG + Intronic
1014074702 6:117222801-117222823 CTAGATGAACACCTGTGGAAGGG + Intergenic
1015081332 6:129228789-129228811 TTAGAGCCACAGCTGGAGAAAGG - Intronic
1023338647 7:39196198-39196220 GTAGATCTACAGCTGAAGAAAGG + Intronic
1023642827 7:42277917-42277939 TGTGCTCCACAGCTGTAGAATGG + Intergenic
1024764578 7:52642028-52642050 TTAGAAGCACAGATTTTGAAAGG - Intergenic
1025581423 7:62723572-62723594 TGAAATGTCCAGCTGTAGAATGG - Intergenic
1028736160 7:94214784-94214806 TCAGATGCACAAGTGTAGAGAGG - Intergenic
1029332124 7:99867189-99867211 TTTTATCCACAGCTGCAGAATGG + Intergenic
1031035827 7:116786625-116786647 TTAGGAGCACAGGTGTTGAATGG + Intronic
1032667096 7:134047536-134047558 TTAGATTCTTAGTTGTAGAATGG - Intronic
1033042900 7:137934497-137934519 TGAGATGCACAGCTGATGAAAGG + Intronic
1038601712 8:28950685-28950707 TTAGAGGCACAACTGTATAGAGG + Intronic
1041762772 8:61384850-61384872 TTAGATGAGAAGCTGGAGAATGG + Intronic
1045102325 8:98857902-98857924 TTAGAAGCAAAACTGGAGAAAGG + Intronic
1045470642 8:102509283-102509305 TGAGAACCACAGCTCTAGAAAGG + Intergenic
1045640319 8:104242947-104242969 TTAGATGAAAGGTTGTAGAAAGG - Intronic
1046511419 8:115209173-115209195 TTACATGCACACCTGTGCAAAGG - Intergenic
1047859432 8:128948289-128948311 TAAGATCCACAGTTCTAGAACGG + Intergenic
1049785082 8:144446703-144446725 TCAGATGAACAGCTGAAGACAGG + Intergenic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1051804374 9:20975403-20975425 TTAGATGCTCACTTCTAGAACGG + Intronic
1052074084 9:24119118-24119140 TTAGATGTGAAGCTCTAGAAGGG + Intergenic
1055697058 9:78896576-78896598 CTTTATGCACATCTGTAGAAGGG + Intergenic
1059619939 9:115992801-115992823 TTTGTTGCTCAGCTGCAGAATGG + Intergenic
1060602548 9:124887909-124887931 TTACTTCCACAGCTGTAGAAAGG + Intronic
1190548840 X:51558177-51558199 TTAGATGTACTTCTTTAGAAGGG - Intergenic
1195877829 X:109560842-109560864 ATAGCTGCACAGCTGTATTAGGG - Intergenic
1196986866 X:121282840-121282862 ATAGAGGCACTGCTGTAGAGAGG - Intergenic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic
1199971214 X:152863326-152863348 CTAGCTGCACAGTTTTAGAAAGG - Intronic