ID: 1095673131

View in Genome Browser
Species Human (GRCh38)
Location 12:44884317-44884339
Sequence AAATGTATGAAACATTTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 403}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095673129_1095673131 11 Left 1095673129 12:44884283-44884305 CCTAAGTATATATGCACCTAACA 0: 6
1: 291
2: 1266
3: 7822
4: 4425
Right 1095673131 12:44884317-44884339 AAATGTATGAAACATTTACCTGG 0: 1
1: 0
2: 3
3: 29
4: 403
1095673130_1095673131 -5 Left 1095673130 12:44884299-44884321 CCTAACAGCAAAGCATCAAAATG 0: 1
1: 2
2: 19
3: 128
4: 685
Right 1095673131 12:44884317-44884339 AAATGTATGAAACATTTACCTGG 0: 1
1: 0
2: 3
3: 29
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095673131 Original CRISPR AAATGTATGAAACATTTACC TGG Intronic