ID: 1095673131

View in Genome Browser
Species Human (GRCh38)
Location 12:44884317-44884339
Sequence AAATGTATGAAACATTTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 403}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095673129_1095673131 11 Left 1095673129 12:44884283-44884305 CCTAAGTATATATGCACCTAACA 0: 6
1: 291
2: 1266
3: 7822
4: 4425
Right 1095673131 12:44884317-44884339 AAATGTATGAAACATTTACCTGG 0: 1
1: 0
2: 3
3: 29
4: 403
1095673130_1095673131 -5 Left 1095673130 12:44884299-44884321 CCTAACAGCAAAGCATCAAAATG 0: 1
1: 2
2: 19
3: 128
4: 685
Right 1095673131 12:44884317-44884339 AAATGTATGAAACATTTACCTGG 0: 1
1: 0
2: 3
3: 29
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095673131 Original CRISPR AAATGTATGAAACATTTACC TGG Intronic
901920875 1:12536658-12536680 AAATATATGAAACAATTATTAGG - Intergenic
904188510 1:28724831-28724853 AAAAGTATGGAAAATTTGCCAGG - Intergenic
904790356 1:33015729-33015751 AAAAATATGAAAAATTTAGCTGG + Intronic
905546328 1:38803074-38803096 AACTGCATGACACATTTAGCTGG + Intergenic
906147052 1:43566371-43566393 AGATTTATGAAGCATTTACTAGG - Intronic
907151161 1:52288972-52288994 AAATGAATGAACCATTTGCTTGG + Intronic
907280616 1:53344685-53344707 ACACGTATGTAGCATTTACCAGG - Intergenic
907566589 1:55440576-55440598 AAATGTATAAAAAATTAGCCGGG + Intergenic
907802184 1:57780205-57780227 AAATGTATGAGAAATATAACTGG - Intronic
908330895 1:63070034-63070056 AAATATATGAAACATTTCTAAGG - Intergenic
909153056 1:72033662-72033684 CAATGTATGAGACATCTAACTGG + Intronic
910100894 1:83575175-83575197 AAATCCATTAAACAATTACCAGG + Intergenic
911011488 1:93285849-93285871 CTATGCAGGAAACATTTACCAGG + Intergenic
912924420 1:113901354-113901376 AACTGTATAATTCATTTACCAGG + Exonic
913031976 1:114916684-114916706 AAATATATTAATCTTTTACCTGG + Intronic
913421427 1:118673958-118673980 AAAAATATGATACATTAACCTGG + Intergenic
915610937 1:156992034-156992056 GAATATATCAAACATTTACATGG + Intronic
917249490 1:173042369-173042391 ATATTTATGGAACATCTACCAGG - Intronic
919352847 1:196481347-196481369 TAATGTATGTTACACTTACCAGG - Intronic
921629229 1:217413846-217413868 AGATGAATGATAAATTTACCAGG - Intergenic
921717908 1:218437240-218437262 AAATGAATGAATCATTTTTCTGG + Intronic
922806587 1:228393420-228393442 GAATGCAGGAAACATTTACCAGG + Intergenic
923574264 1:235143574-235143596 AAAAGTATGAAAAAATTAGCTGG + Intronic
924167447 1:241299333-241299355 AAATGTATGAATCATCTAGGAGG - Intronic
924495481 1:244584770-244584792 AAATGTATGGAACCTTGCCCTGG - Intronic
1063861641 10:10315138-10315160 TAATGTACTAAGCATTTACCTGG - Intergenic
1064095742 10:12423353-12423375 AAAAGTAGAAAACATTTACTGGG + Intronic
1064498455 10:15941034-15941056 AAATATATGAAATATTATCCAGG + Intergenic
1064725543 10:18276006-18276028 AAATGTATGAAAGATAGACAAGG - Intronic
1065931654 10:30484610-30484632 GAATGCATCAAACATTTATCGGG + Intergenic
1067316610 10:45172212-45172234 AGATGTATGAAAGCTTTACTTGG + Intergenic
1068158769 10:53236394-53236416 AATTCTATGAAAATTTTACCAGG - Intergenic
1068188750 10:53622026-53622048 AAATGTATGAATGATCTACATGG + Intergenic
1068492450 10:57741154-57741176 AAATGTATGAGACATCTAGAAGG - Intergenic
1070228887 10:74542525-74542547 AAATATGTGAAACATTTATATGG + Intronic
1072832915 10:98678233-98678255 AAATGTAAGAAAAATTGTCCTGG - Intronic
1072882483 10:99241595-99241617 AAATGTTTAAAACATTATCCGGG + Intergenic
1075038298 10:119087552-119087574 AAAAGTATGAAACAATCATCTGG - Intergenic
1075881534 10:125856285-125856307 AACTGCATAAAACATTTCCCAGG + Intronic
1076072832 10:127505412-127505434 ATATTTATGGAACATTCACCTGG + Intergenic
1077625698 11:3769450-3769472 AAAATTATGAAACATTAGCCAGG + Intronic
1077975033 11:7239076-7239098 AAATGTATGAAAGAATATCCTGG - Intronic
1078045572 11:7911526-7911548 AAATGCATTAAAAGTTTACCAGG + Intergenic
1078888948 11:15536337-15536359 CAATGTAGGAAACAACTACCAGG + Intergenic
1079836361 11:25339723-25339745 AAGAGTATGAAACATTTATTGGG - Intergenic
1080311408 11:30897425-30897447 AAAAGTATGAAAAAATTAGCCGG + Intronic
1080743357 11:35085742-35085764 AAAAGAAAGAAAAATTTACCAGG - Intergenic
1080964755 11:37201796-37201818 AAAAGTATAAAAAATTAACCGGG - Intergenic
1081111679 11:39142940-39142962 AAAAATATGAAACTTTTAACAGG + Intergenic
1081168595 11:39838738-39838760 AAGTGTATAAAACAATTACTTGG + Intergenic
1081535202 11:43991366-43991388 AAGTGTATGAAATATTTCCCAGG + Intergenic
1084295238 11:68209169-68209191 AAATGTATGATACATTTTAATGG - Intronic
1085229796 11:74956339-74956361 AAATGTCTAAAACATGTATCAGG + Intronic
1085624722 11:78063238-78063260 AAATAAATAAAACATTTACAAGG + Intronic
1086187912 11:84041562-84041584 AAATGTATGATAAATTTACTGGG + Intronic
1086346672 11:85904037-85904059 AAATAAATGAAACATAAACCTGG + Intronic
1086396207 11:86417906-86417928 AAATGTATCATACATTAGCCAGG - Intronic
1086951762 11:92897857-92897879 AAGTTTGTGAAACATTTACCTGG - Intergenic
1087306499 11:96495554-96495576 AAATGTTTGAAAAACTTAGCAGG + Intronic
1088145916 11:106677835-106677857 ACATGTATGAAATATTTAGTTGG - Intronic
1088389884 11:109302515-109302537 AAATCTATGAGGCATCTACCTGG + Intergenic
1088702428 11:112425550-112425572 AAATGTATGCAATATTGACTTGG - Intergenic
1089198999 11:116711990-116712012 AAATGTGTGAGACATTCACATGG - Intergenic
1089446125 11:118553804-118553826 AAAGGAATGAAATAATTACCAGG + Intronic
1091122817 11:133070767-133070789 AAATGAATGAAAATTGTACCAGG + Intronic
1091423305 12:362756-362778 AACTGTGTGGAACAGTTACCTGG - Intronic
1091961878 12:4702382-4702404 AAATAAATGAAACAATTTCCTGG - Intronic
1092276330 12:7063863-7063885 AAAAATATGAAAAATTAACCAGG + Intronic
1093467340 12:19463622-19463644 AAATGTTAGAAACGTTGACCCGG - Intronic
1093504916 12:19853940-19853962 AAACACATGAAACATTAACCTGG + Intergenic
1094036681 12:26079428-26079450 AAAAATATGAAACATTAGCCAGG + Intronic
1095299307 12:40563801-40563823 AATTATATGAAACATTTAGTAGG - Intronic
1095673131 12:44884317-44884339 AAATGTATGAAACATTTACCTGG + Intronic
1096291375 12:50346525-50346547 AAATGTATAAAACAGATACAGGG - Intronic
1096697439 12:53358847-53358869 AAAAGAAAGAAACATTTAACAGG + Intergenic
1097548396 12:61034457-61034479 ACATGTATTAGACATTTGCCAGG + Intergenic
1097589525 12:61557206-61557228 AAAAGTAGGAAACTTTTTCCGGG + Intergenic
1098198548 12:68028987-68029009 AAATGTACAAAACATTTCCTAGG + Intergenic
1098352036 12:69572990-69573012 AAAAATATGAAACAATTAGCTGG - Intronic
1098945468 12:76584599-76584621 AAATGTTTGAAAAATTAGCCAGG - Intergenic
1099102802 12:78463406-78463428 TAATGAATGAAACATTTAGCTGG + Intergenic
1099114425 12:78606643-78606665 TAAGGTATGTGACATTTACCAGG + Intergenic
1099230476 12:80017938-80017960 AAATAGATAAAAGATTTACCAGG - Intergenic
1099260818 12:80380252-80380274 AAATCTATGAATCATTTATTTGG - Intergenic
1100782452 12:98043433-98043455 AAATGTTTTAAAAATTTGCCTGG - Intergenic
1101257446 12:102992637-102992659 AAGTGTTGGAAACATTTGCCTGG + Intergenic
1102134929 12:110566077-110566099 GAATGTAATAGACATTTACCTGG - Intronic
1102336930 12:112089612-112089634 AAATGTAATAAACATTTAAAGGG + Intronic
1103271190 12:119675091-119675113 AACTGTATGAATCATGTTCCAGG - Intronic
1103293317 12:119865144-119865166 AAAAATATGAAACATTTCCCTGG + Intronic
1103842542 12:123876800-123876822 AAAAATATGAAACATTAGCCAGG + Intronic
1104209959 12:126679180-126679202 AAATGTATGAAACAGCTTCATGG + Intergenic
1104234137 12:126916204-126916226 AAATGTGTGTAACATTTAATAGG + Intergenic
1106065665 13:26345954-26345976 AAATGTCTTAAATATATACCAGG - Intronic
1106511189 13:30414155-30414177 AAATGTATTATACATATAACTGG + Intergenic
1106917633 13:34532000-34532022 AAAAGTATGAAAAATTAGCCAGG + Intergenic
1107630796 13:42341327-42341349 TCATCTATGAAACATTTTCCTGG + Intergenic
1107922750 13:45227309-45227331 AAATGTAAGATACAGTTTCCAGG + Intronic
1108159739 13:47626228-47626250 AACTGGATAAAACCTTTACCGGG + Intergenic
1108288365 13:48931922-48931944 AAATGAAAGAAACATTTATTTGG - Intergenic
1108527022 13:51294069-51294091 AAAAATATGAAAAATTAACCGGG - Intergenic
1108761514 13:53571543-53571565 CACTGTATGAAAAATTTAGCAGG - Intergenic
1108875452 13:55043306-55043328 AAATGCTTGAAACATTTTACTGG + Intergenic
1111392271 13:87611862-87611884 AAATGAATGGGACACTTACCAGG + Intergenic
1112548996 13:100402301-100402323 AAATGTAAAAAACACTTAGCTGG + Intronic
1113138646 13:107122099-107122121 AAACTTATTAAACATTTACCAGG + Intergenic
1114759669 14:25299330-25299352 AAATTTATGAGACTTTAACCTGG + Intergenic
1116411021 14:44624206-44624228 CAAGGTATGAAAGAATTACCAGG + Intergenic
1117261346 14:54037092-54037114 AAATGTCTGAAACATTTCTTTGG - Intergenic
1117580311 14:57144958-57144980 AACTGTATGAGGCATTTTCCAGG + Intergenic
1118947819 14:70404483-70404505 AAATGTCTGAGTCATTTACATGG + Intronic
1119284938 14:73445633-73445655 AAATGTAGCTAACATTTACTGGG + Intronic
1119408703 14:74414615-74414637 AAATGTATGAGAGATTTAGGAGG + Intronic
1119507750 14:75187594-75187616 AAATATATGAAAAATTAGCCGGG - Intergenic
1120154195 14:81074346-81074368 AAATGTATTAAACATTTGGGTGG - Intronic
1120296247 14:82645732-82645754 AAATGTAATAAACATTTATTAGG + Intergenic
1120493024 14:85200823-85200845 AAATGAATAAAACATTCACCAGG + Intergenic
1120884510 14:89441360-89441382 AATGGTATGAAAAATTTAGCAGG - Intronic
1121780832 14:96621299-96621321 AAATGTATGAAAAATTAGCCAGG - Intergenic
1122400425 14:101464266-101464288 AATTGTTTGAAACATGCACCTGG + Intergenic
1122555970 14:102580273-102580295 AAATGAATGAGCCATTTTCCAGG - Intergenic
1124668635 15:31617086-31617108 AAATATATCAAACATTTATGAGG + Intronic
1125473864 15:40030861-40030883 AAATGTAGAAAACATTAACATGG + Intronic
1125699740 15:41671483-41671505 AAATATATAAAAAATTTAGCCGG - Intronic
1126406505 15:48328383-48328405 AAATGTACGAAAAATTAGCCAGG + Intergenic
1127734434 15:61828294-61828316 CTATGTTTGAAACACTTACCAGG - Intergenic
1128043197 15:64593685-64593707 AAATATATAAAACATTAGCCAGG - Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1129070744 15:72948360-72948382 AAATATACGAAAAATTAACCAGG + Intergenic
1129609313 15:77040233-77040255 AAATATTTGAAACATTCTCCTGG + Intergenic
1131586399 15:93699230-93699252 ATATGTATCAAACATTTATTTGG + Intergenic
1132355988 15:101171671-101171693 AAAAATATGAAAAATTAACCTGG + Intergenic
1133320149 16:4908698-4908720 AAAAATATGAAAAATTTGCCAGG - Intronic
1134392784 16:13834969-13834991 AAATTTATGACACATTTACTTGG + Intergenic
1135196710 16:20401014-20401036 AACTGAATGATAGATTTACCTGG - Intronic
1135771733 16:25222984-25223006 ATATGTGTAAAACATTTAGCAGG - Intronic
1136184663 16:28580078-28580100 AAATGTTTGAATCATTTGTCAGG + Intronic
1137537028 16:49335058-49335080 AAATGTTTAAAACATTCACATGG - Intergenic
1138359113 16:56411530-56411552 GAATTTGTGAAACATTTACATGG - Intronic
1138506824 16:57482526-57482548 AAAAATATGAAACAATTAGCCGG - Intronic
1139543955 16:67640224-67640246 AAATGTGTGAAGCTTTTAGCTGG + Intergenic
1139580469 16:67870614-67870636 TAATGTATGAAACAATGCCCTGG - Intronic
1140072123 16:71659904-71659926 AAATATATGAAACATTTGATAGG - Intronic
1140576731 16:76179330-76179352 AATTATTTAAAACATTTACCAGG + Intergenic
1141073568 16:80980732-80980754 AAATGTGTAAAACCTTAACCAGG + Intronic
1141400591 16:83743812-83743834 AGATGTAATAAACCTTTACCGGG + Intronic
1142660108 17:1422930-1422952 AAAAGTATGAAGCATTGACTAGG + Exonic
1143093480 17:4463575-4463597 AAATATATTAAAAATTTAGCTGG + Intronic
1144190624 17:12842253-12842275 ATATGTATCAAACAATTAGCTGG + Intronic
1144721058 17:17470252-17470274 AAATGAATGAAACCATCACCAGG + Intergenic
1145758656 17:27411574-27411596 AAATGTATGTAACAATTAGCAGG + Intergenic
1146370092 17:32260720-32260742 AAAAATATAAAACATTTGCCGGG - Intergenic
1146814005 17:35927844-35927866 AAGATTATGAAACATTTACTTGG - Intronic
1148098981 17:45075618-45075640 AAAAGTATGAAAAATTAGCCAGG + Intronic
1148377589 17:47162574-47162596 AACTGTATGAATTATTTACATGG + Intronic
1148611368 17:48966852-48966874 AAATGAATAAAACATTTATTGGG + Intronic
1149947502 17:60946352-60946374 AAAATTATGAAACTTTTACAAGG + Intronic
1150334050 17:64317483-64317505 AAATGTATTCATCATTTCCCAGG - Intergenic
1150830604 17:68515193-68515215 AACTAAATGAAACATTTACTTGG + Intronic
1150968960 17:70004866-70004888 AAAAGTATGAAAAATTAGCCAGG - Intergenic
1152171964 17:78757107-78757129 AAAAGTATGAAAAAATTAGCTGG - Intronic
1155263851 18:24072590-24072612 AAAAGTAAGAAGCATTGACCGGG - Intronic
1155647203 18:28093680-28093702 AAATGTATTAATCATTTAACTGG - Intronic
1155843990 18:30682677-30682699 AAATGTAAGAAACCTTAATCGGG + Intergenic
1156161615 18:34366038-34366060 AAATTAATGACAGATTTACCAGG - Intergenic
1156228673 18:35133158-35133180 AAATGGAGTAAACATTTGCCTGG - Intronic
1157215181 18:45776605-45776627 AAATGGATATAACATTTACAAGG - Intergenic
1157255201 18:46132586-46132608 AAATATAAAAAACATTGACCAGG + Intergenic
1158322311 18:56277041-56277063 AGGAGTATGAAACATTTAACTGG + Intergenic
1158406558 18:57165301-57165323 TAATAAATGAAAGATTTACCTGG - Intergenic
1159245951 18:65805540-65805562 AAGTGAATGGAACATTTACTTGG - Intronic
1159807401 18:72972964-72972986 AAAAGTATGTAACATTTTCCTGG + Intergenic
1160053751 18:75460664-75460686 AGATATATGAAATATTTTCCAGG - Intergenic
1162350649 19:10147099-10147121 AAATTTTTAAAACATTAACCAGG + Intronic
1162388185 19:10373331-10373353 AAAAATATGAAACATTGGCCAGG - Intronic
1163560488 19:18016512-18016534 AAATATATAAAAAATTAACCAGG + Intergenic
1164791118 19:30981856-30981878 ACATGTATATAACATTTACAAGG + Intergenic
1168537852 19:57186301-57186323 AATTGTATTAAACACTGACCAGG + Intergenic
925771951 2:7290627-7290649 AAAAGTATCAAACATTCAGCCGG + Intergenic
925909355 2:8563372-8563394 AAAAGTATAAAAAATTAACCAGG - Intergenic
926669928 2:15567344-15567366 AAATGTATGACACCTATAACAGG - Intergenic
926770593 2:16370278-16370300 AAATATATAAAACATTTATAAGG - Intergenic
926852228 2:17211785-17211807 AAATGTATGAAACTTTTAATGGG + Intergenic
928632714 2:33210391-33210413 AAATGTAAAAAAGAATTACCAGG - Intronic
930436283 2:51347723-51347745 AAATCTATGCAACATTTAGGAGG + Intergenic
930441000 2:51405722-51405744 AAAAATATGAAAAATTTGCCAGG - Intergenic
930920087 2:56742554-56742576 AAATGTTTGAACTATTTTCCAGG + Intergenic
931081290 2:58774663-58774685 AAATATTTCAAATATTTACCTGG - Intergenic
931452330 2:62378686-62378708 AAATATATAAAACATTAGCCAGG - Intergenic
931722129 2:65074573-65074595 AAATGCATGAATTATTTCCCAGG + Intronic
933056256 2:77670774-77670796 AAAAGTATGACACAGTTACAGGG + Intergenic
933238814 2:79896565-79896587 TTATGTATGAAACATTCAGCTGG + Intronic
933927810 2:87115089-87115111 AAAAGTATGACACAGTTACAGGG + Intergenic
934556869 2:95291711-95291733 CAAAGCATGAAACATTTGCCAGG + Intergenic
934669481 2:96201187-96201209 TAATGTATGTAATGTTTACCAGG - Intronic
935404359 2:102692891-102692913 AAATGCATAAAACCTTTACAAGG - Intronic
936140614 2:109936978-109937000 AAATGCATAAAATATTTTCCTGG - Intergenic
936177305 2:110234923-110234945 AAATGCATAAAATATTTTCCTGG - Intergenic
936204080 2:110434508-110434530 AAATGCATAAAATATTTTCCTGG + Intronic
936727283 2:115334886-115334908 AAATCTATGCAAAATATACCAGG + Intronic
936906493 2:117541463-117541485 AATTGGAAGAAACATTTATCTGG + Intergenic
937055836 2:118935996-118936018 ACAGGTATGAAAGATTTACTTGG + Intergenic
937645729 2:124264229-124264251 AATAGTATCAAACATTTACAAGG - Intronic
937716211 2:125036678-125036700 AAGTGAATGAAAAATTTTCCAGG - Intergenic
939552431 2:143632187-143632209 AAATGTATGGAACATTGCCCAGG - Intronic
939849440 2:147286791-147286813 TAATGTATGAAGCATTTAGAGGG - Intergenic
941127066 2:161596665-161596687 ATATGTATAAAACATTTATATGG - Intronic
941382004 2:164804733-164804755 TAATGTGTAAAACACTTACCTGG + Intronic
943141156 2:183983612-183983634 AAAAGTATAAAAAATTTAGCAGG + Intergenic
944692296 2:202169198-202169220 TCATTTAGGAAACATTTACCAGG - Intronic
945127033 2:206523984-206524006 AAATGAATGAAATGTGTACCTGG + Intronic
945749678 2:213765958-213765980 GAATGAATGTAACATTGACCTGG + Intronic
946268117 2:218566414-218566436 AAATGTAACAAGCACTTACCAGG + Intronic
946933109 2:224690939-224690961 AAATGTGTGAAAGGTTTACTTGG - Intergenic
947349612 2:229229474-229229496 AAATATATGAAAAATTAGCCAGG + Intronic
948228231 2:236329688-236329710 AAATTTATTAAACATCTACTTGG + Intronic
1169443800 20:5654924-5654946 AAACGTATAAAGCACTTACCAGG - Intergenic
1169653526 20:7895750-7895772 AAATGTATAAAAAATTGGCCAGG + Intronic
1171124487 20:22589673-22589695 AAATGTATGAAATAGCTCCCAGG - Intergenic
1173035214 20:39402388-39402410 TAATGTATGAAAGAATAACCTGG + Intergenic
1176910164 21:14555461-14555483 AACTATATGAAACATATAGCAGG + Intronic
1177165442 21:17597614-17597636 ATATGTATATAACATGTACCTGG - Intronic
1177239112 21:18433191-18433213 AAATGTTTTAAATACTTACCAGG - Intronic
1178579466 21:33825836-33825858 AAATTTAAGAAACATTTACCAGG - Intronic
1185238846 22:49730043-49730065 AAAAGTATGAAAAATTAGCCAGG - Intergenic
949241773 3:1881246-1881268 AAAAGTATAAAAGATATACCTGG + Intergenic
951045850 3:18037663-18037685 AGATGTATTAGACATTTATCGGG - Intronic
951263969 3:20546232-20546254 AAATGTTTGAAAAATATCCCAGG + Intergenic
951365108 3:21771465-21771487 AAATGTATGGAACATTCAAAAGG + Intronic
951599539 3:24358079-24358101 ATATTTATTAAACATCTACCAGG - Intronic
952072653 3:29657232-29657254 AAATGAATTAACCATATACCTGG - Intronic
952601047 3:35083620-35083642 AAATGCATGAAACTTTTCCTAGG + Intergenic
953520924 3:43642574-43642596 AAATATATAAAACATTTATGTGG + Intronic
954501692 3:51023746-51023768 ATATGCATGAAAAATTTTCCAGG - Intronic
954817414 3:53293809-53293831 AAATGGATGAAACATTTGCCTGG - Intronic
957736126 3:84205417-84205439 AAATATACTAAACATTTACAAGG + Intergenic
958180550 3:90054709-90054731 AAATGTATAAAATTTTCACCAGG - Intergenic
959409270 3:105999814-105999836 AAATGTACCAAACACTTACTAGG + Intergenic
960125366 3:113992545-113992567 AATTGTATCAAACATTTAAACGG + Intronic
960129992 3:114045531-114045553 AAATATATGAAGGATTTAGCAGG - Intronic
960707787 3:120496976-120496998 AAAAGTATTAAAAATTGACCTGG + Intergenic
960729481 3:120710395-120710417 AAAAGTATGAAATAGTTATCTGG - Intronic
961019065 3:123488692-123488714 AAAGATCTGAAACATTTAGCAGG + Intergenic
961206855 3:125090351-125090373 TTATACATGAAACATTTACCAGG - Intronic
961231422 3:125315411-125315433 AAATATATAAAACATTGGCCGGG + Intronic
962412366 3:135152490-135152512 AGATGTATGAAAGATTTACTGGG + Intronic
962923786 3:139973798-139973820 AAATATATTAAAAATTTAGCTGG - Intronic
963467952 3:145705915-145705937 AAATATTTGAAACATTTATAAGG - Intergenic
963596311 3:147330440-147330462 AAATGTATGAATACTTTACCTGG - Intergenic
963689874 3:148485946-148485968 AAATGTATAAAACCTATAACAGG + Intergenic
963887560 3:150599077-150599099 CAATGTATGTAAAATTTATCAGG + Intronic
964901108 3:161659611-161659633 AAATGTATGTGGCATTTCCCAGG - Intergenic
965673278 3:171169185-171169207 AAAGGTATGAAATATTTATAAGG + Intronic
965830111 3:172776743-172776765 AAATTTAAGACACATTTACATGG - Intronic
966025328 3:175272550-175272572 AAATGTATGATGCATTGAACCGG + Intronic
966219970 3:177541552-177541574 AAAAGGAAGAAACATTTTCCTGG + Intergenic
967383392 3:188885265-188885287 AAATGCATAAAACACTTATCAGG - Exonic
967689011 3:192451656-192451678 AAATATATGTGATATTTACCAGG - Intronic
970777023 4:19686980-19687002 AAATGTGTGTAACATTTGCTTGG - Intergenic
972958820 4:44426122-44426144 AAATGTATGATACATTTGTAAGG + Intronic
974390449 4:61260165-61260187 AAATATATGAAACATTTGAAGGG + Intronic
975343396 4:73266556-73266578 GAATGAATGAAAGATTTCCCTGG - Intergenic
975568391 4:75785597-75785619 AAATATATGAAATATTCACAAGG - Intronic
976120553 4:81776027-81776049 AAATGTAGTATACATATACCGGG + Intronic
976858072 4:89628359-89628381 AAGAGTATCAAACATTTACAGGG - Intergenic
977039169 4:91993567-91993589 AAATGTAAAAAACAATTAGCCGG + Intergenic
977345848 4:95814858-95814880 AAATGTAGGAAACATGTCCTTGG - Intergenic
977700798 4:100020694-100020716 AAAGGAATGAAACAATGACCTGG + Intergenic
977915519 4:102587923-102587945 AAATGTATGCAATGTTTCCCTGG - Intronic
978669085 4:111224357-111224379 AAGTGTATTAAACAATTACTAGG + Intergenic
978879715 4:113687043-113687065 AAATGTTTGCAAAATTCACCTGG + Intronic
979040964 4:115794183-115794205 AAATGTAAGAAATTTTTAACTGG - Intergenic
979124773 4:116955618-116955640 AAATGTCTGAGACAATGACCTGG + Intergenic
979341800 4:119534113-119534135 AGATGTATGTAACATTAACTGGG - Intronic
980711220 4:136570989-136571011 AAAAGTGTCAAACATTTATCAGG - Intergenic
980820715 4:138012879-138012901 AATTGCATGAAAAATTTACAAGG - Intergenic
981488682 4:145316626-145316648 ACATGTGTGAAAGAATTACCAGG - Intergenic
981781122 4:148430511-148430533 AAATATTTAAAATATTTACCTGG + Intronic
982049620 4:151487639-151487661 AAATGTAGCTAACATTTATCAGG + Intronic
982993353 4:162308049-162308071 ACAAGTATGAAACATTTGCCTGG - Intergenic
983032500 4:162820659-162820681 AAATGTATGAAACTGTTAGAAGG - Intergenic
983370079 4:166846902-166846924 ACATTTTTGGAACATTTACCTGG - Intronic
983848707 4:172552229-172552251 AAATGCATGAAAGATGTAACTGG - Intronic
984302790 4:177944792-177944814 AAATGTAAGAAAAATATTCCAGG - Intronic
984365328 4:178792199-178792221 AAATGTATTAAAAATTTACAAGG + Intergenic
984403020 4:179291172-179291194 AAATATATGTAACATCTACTAGG - Intergenic
984513203 4:180704343-180704365 AAATGTATGTAAGATTCACATGG - Intergenic
985618484 5:938744-938766 AAATGTGTTAAACACTCACCTGG - Intergenic
986237263 5:5923331-5923353 AAATGTATGAAAAATTAGCGTGG - Intergenic
987205184 5:15618152-15618174 AAATGTATAAAACATTGGCTGGG - Intronic
987477591 5:18410634-18410656 AAAAGTATGAAAAATTAGCCGGG + Intergenic
987888343 5:23841573-23841595 AATTATATGAAAAATTGACCAGG + Intergenic
988224930 5:28400883-28400905 AAATGCATAAAACATTTAAAGGG - Intergenic
988233748 5:28511535-28511557 CAATGTTTCAAACATTTAACTGG + Intergenic
988641020 5:33040972-33040994 AAATGTCTGTAACACTTTCCTGG - Intergenic
988925565 5:35988023-35988045 AAATTTATGAAAGATTTCCCAGG - Intronic
990417876 5:55603801-55603823 ACATGTATGATAGATTTACATGG - Intergenic
990485041 5:56249868-56249890 AAATGTATGAAAGCTGTAACTGG - Intergenic
991473927 5:66999720-66999742 AAATGAAAGAAACATTATCCTGG - Intronic
991573487 5:68079399-68079421 AAATTTTTGGTACATTTACCCGG + Intergenic
992980813 5:82169887-82169909 AAATATTTCAAACATTTACATGG - Intronic
993854705 5:93059444-93059466 ATATGTATCAAACAGTTACAAGG + Intergenic
995277780 5:110296724-110296746 ATACTTATGGAACATTTACCAGG - Intronic
995651697 5:114376930-114376952 AAATAAATGAAACACTTAGCTGG + Intronic
996309044 5:122082139-122082161 AAATGTATTTAACAAATACCAGG - Intergenic
996779351 5:127168543-127168565 ATGTGTATTAAATATTTACCAGG - Intergenic
996862077 5:128079190-128079212 AAACTTATGAAAAATTTATCAGG - Intergenic
997681707 5:135761002-135761024 TAATGTATTTAACATTGACCAGG + Intergenic
998763493 5:145458248-145458270 AAATGTATGAACAATGTAACTGG + Intergenic
999533946 5:152496032-152496054 AAATGTATGCAACAGCTCCCAGG - Intergenic
1000456892 5:161460448-161460470 AAATTTATGAAATATTTCCGAGG + Intronic
1001854817 5:175001807-175001829 AAATGTTTGTTAAATTTACCTGG - Intergenic
1003754456 6:9100924-9100946 AAATGTATGAAATACTTAATTGG + Intergenic
1003846635 6:10181033-10181055 AAATGTATGAGACTTTTATCAGG - Intronic
1004998621 6:21218136-21218158 AGATATATTAAATATTTACCTGG - Intronic
1005123392 6:22417078-22417100 AAATGAATGAAAAAATTAACAGG - Intergenic
1005253023 6:23969326-23969348 AAATTTTTGAAACTTTTTCCTGG + Intergenic
1005355840 6:24982787-24982809 TAAGGTATGCAAAATTTACCTGG + Intronic
1005922033 6:30410436-30410458 GTATGAATGATACATTTACCAGG - Intergenic
1006201990 6:32301749-32301771 AACTGTAAGAAACATATACCAGG + Intronic
1006215817 6:32441716-32441738 AAATCTATGGAAAATATACCTGG - Intronic
1006686767 6:35841531-35841553 AACTGTATAAAACATTTTCTTGG + Intronic
1006784746 6:36658756-36658778 ATATTTATTAAACATATACCAGG - Intergenic
1007639003 6:43321593-43321615 AAGTGTATGAAACATTCTCCAGG + Intronic
1007910417 6:45507884-45507906 AACTGTGGGAAACATTTATCAGG + Intronic
1008370638 6:50726362-50726384 ATATGTATGAATTATTTTCCTGG - Intronic
1008963993 6:57295993-57296015 GAATGTATGAAACATTGATATGG - Intergenic
1009575922 6:65459631-65459653 ATATTTATCAAACATCTACCAGG - Intronic
1009884857 6:69613884-69613906 AAATATGTAAAACATTTACATGG - Intergenic
1010001158 6:70950913-70950935 AATTGTATGCAAAAATTACCAGG + Intronic
1010825796 6:80473197-80473219 AAATGGAAGAAACATTTAAAGGG - Intergenic
1011840114 6:91487114-91487136 AAATGTATTACACATGTACTAGG - Intergenic
1013135927 6:107282706-107282728 AAAAATACAAAACATTTACCAGG + Intronic
1013694553 6:112687125-112687147 AAATGTATCAGAAATTTAGCAGG - Intergenic
1013800819 6:113939844-113939866 GAATGTCTGAAACATTTAAGAGG + Exonic
1014267167 6:119293044-119293066 AAATGTGGGAAACTGTTACCAGG - Intronic
1014392963 6:120886948-120886970 AAATTTATAAAACATTTATAAGG + Intergenic
1014637199 6:123862202-123862224 AAATATATGAAGCATTTATGGGG + Intronic
1014691928 6:124572780-124572802 AATTGTATGAAATATTTATATGG - Intronic
1014880793 6:126722070-126722092 TTATGTATGACACATTTACTTGG + Intergenic
1015767713 6:136736833-136736855 AAATATGTAAAACATTAACCAGG - Intronic
1015987000 6:138894542-138894564 TGAGGTATGAAAAATTTACCAGG + Intronic
1016736786 6:147488168-147488190 AAAAGTATGAAAAATTAGCCGGG + Intergenic
1017321580 6:153100670-153100692 AAATGGAGAGAACATTTACCTGG - Intronic
1017359543 6:153551117-153551139 AAATCTGTGAATCATTGACCAGG - Intergenic
1017494419 6:154970963-154970985 AAAAGTATAAAAAATTAACCGGG + Intronic
1018310067 6:162499298-162499320 AATAATATGAAAGATTTACCAGG - Intronic
1018623785 6:165757518-165757540 AAATGAATAAAACATTTAAATGG - Intronic
1021049929 7:15970619-15970641 AAAAGTATGAAATATTTTTCAGG + Intergenic
1022053213 7:26700906-26700928 TAATGTATGACAGTTTTACCTGG + Intronic
1023426098 7:40038028-40038050 AATTATATAAAACATTTACTTGG + Intronic
1023529446 7:41137206-41137228 AAATGTTTGAAAAAATTAGCTGG + Intergenic
1024521300 7:50306275-50306297 AAATGTATGAAATATGTTCATGG - Intronic
1024595805 7:50936289-50936311 AAATGTATGAAACAATTTTGTGG - Intergenic
1026249730 7:68659104-68659126 CAATGTCTGACACATGTACCAGG - Intergenic
1026925281 7:74187903-74187925 AAGTGTTTTAAACATTTGCCTGG + Intronic
1026936893 7:74262559-74262581 AAATTTAAAAAACATTTGCCAGG - Intergenic
1026944911 7:74309555-74309577 AAATGTTTTAAACATTCATCCGG + Intronic
1027881362 7:83842598-83842620 AAATGCATTGAACATTTTCCAGG + Intergenic
1030024941 7:105314169-105314191 AAAAATATGAAAAATTAACCGGG + Intronic
1030079931 7:105768570-105768592 ACATGCATGAAACATGTACTTGG + Intronic
1030461642 7:109844368-109844390 AAATCAATTTAACATTTACCAGG + Intergenic
1030684349 7:112469080-112469102 AAATCCAAGAAATATTTACCTGG - Intronic
1031251280 7:119385407-119385429 AAATCAATGACAAATTTACCAGG - Intergenic
1031376250 7:121029860-121029882 AAATGTATATAAAATTAACCTGG - Intronic
1031729737 7:125284427-125284449 AAATGTTTGAAACATCTTACTGG - Intergenic
1031908092 7:127483754-127483776 ACATATATGAAAAATTAACCAGG + Intergenic
1032749271 7:134821100-134821122 CAAGGTATGTAACATTTACATGG - Intronic
1032902527 7:136325878-136325900 AAATGTTTGAAAGATTTAATTGG + Intergenic
1032926052 7:136605963-136605985 AAATGTGTGACACATGAACCTGG + Intergenic
1033321343 7:140342497-140342519 AAGTGAATGAAACATTTAATAGG - Intronic
1033671391 7:143497019-143497041 AAATTAATTAAATATTTACCTGG - Intergenic
1036556475 8:9864354-9864376 ATATATATGAAAGATTTACCTGG - Intergenic
1036961188 8:13246052-13246074 AAAAGTATAAAACATGAACCAGG + Intronic
1036982044 8:13480742-13480764 AAAAGTATAAAAAATTTGCCAGG + Intronic
1037162408 8:15789695-15789717 AGATGTATGAAACATTTGCCAGG + Intergenic
1037420698 8:18699011-18699033 AAATGAATGAAAAGGTTACCTGG + Intronic
1037424603 8:18741995-18742017 AAATGTATAAAAACATTACCAGG + Intronic
1038622079 8:29153900-29153922 AAAGCTATGGAGCATTTACCTGG + Intronic
1038912404 8:31981085-31981107 TAATGTATGCAAAATTTATCAGG + Intronic
1039697635 8:39929513-39929535 GAATGTATGATAAATTAACCTGG + Intergenic
1040767617 8:50933002-50933024 AAAGATCTGTAACATTTACCTGG + Intergenic
1040857419 8:51962212-51962234 AAAAGTTTGAAACAGTTGCCTGG + Intergenic
1041018597 8:53615923-53615945 AAAGGTAGGAAACTTTTTCCTGG - Intergenic
1041598976 8:59693164-59693186 AAATGTAAGTAAAATTTAACAGG + Intergenic
1041778929 8:61556592-61556614 ATTTATATGAAATATTTACCTGG - Intronic
1041836250 8:62219329-62219351 AAATGTAGGAAACCTTTCCTAGG + Intergenic
1042301907 8:67292747-67292769 AAATGTTAGAAACATTAACTGGG + Intronic
1042355907 8:67827316-67827338 AAATGTATTAATCATTTATAGGG - Intergenic
1042761981 8:72281007-72281029 AAAGGTAGGTAACATTTACATGG + Intergenic
1043102993 8:76070243-76070265 AAATGTATGAATCTCTTCCCTGG - Intergenic
1044707114 8:95019496-95019518 AAATCTATGGAACATTTCGCAGG + Intronic
1046161069 8:110365905-110365927 AAATGTATGAATCAATTTCTGGG - Intergenic
1046230497 8:111349208-111349230 AAATGTTTCAAACCTTTTCCAGG - Intergenic
1046496259 8:115018422-115018444 AAATAAATAAAATATTTACCAGG - Intergenic
1047721637 8:127645570-127645592 CAAGGTATGAAAAATTGACCAGG + Intergenic
1047911094 8:129530318-129530340 ATATTTATGGAACATTTACTTGG + Intergenic
1051242865 9:15078769-15078791 AAATGTATGAAAGAGTTAGCAGG + Intergenic
1052766568 9:32647521-32647543 AAATGTATGGAAAATTTTACAGG - Intergenic
1053363933 9:37509486-37509508 TAATGTATTAAACATTGACTTGG - Intergenic
1054975004 9:71133214-71133236 AAATGTGTTATACATTTATCTGG + Intronic
1055736800 9:79339047-79339069 ACATGAATGATAAATTTACCGGG + Intergenic
1056772116 9:89485486-89485508 AAATCTTTAAAACATTAACCGGG + Intronic
1058180225 9:101789606-101789628 TAATTTATGAAACATTTCCATGG + Intergenic
1058242089 9:102576821-102576843 TATTTTATGAAACATTTATCTGG - Intergenic
1058406851 9:104686453-104686475 AAATGTCTGAAAAATTAACATGG + Intergenic
1058484813 9:105433354-105433376 AAATGGATGAAAGATTTAAATGG + Intronic
1058782718 9:108354401-108354423 AAATTTATGAATTATTTACAAGG - Intergenic
1059093210 9:111383759-111383781 AAAAGTATGAAAAATTAGCCAGG + Intronic
1059156425 9:111992763-111992785 AAAAATATGAAACTTTTGCCAGG + Intergenic
1060254997 9:122019608-122019630 AAAAATATGAACGATTTACCGGG - Intronic
1060570772 9:124637729-124637751 AAAAGTATGAAAAATTAGCCGGG + Intronic
1185961903 X:4553583-4553605 AAATATATGAAACATATAGGAGG + Intergenic
1186560840 X:10611268-10611290 AAATGTATGAAAGAATTAAATGG + Intronic
1187622377 X:21072128-21072150 AAATGTTTGATATATTTATCCGG + Intergenic
1187764506 X:22625414-22625436 GAATGTACGAAACATTTGCTTGG - Intergenic
1187969314 X:24643873-24643895 AAGTGTATGAAATATTTGCAGGG - Intronic
1188169421 X:26905178-26905200 AAATGTATGAAGCATTGCTCTGG + Intergenic
1188241283 X:27794851-27794873 AAATTTATAATACATTTACCAGG - Intergenic
1188244486 X:27823635-27823657 AAAAGTATAAAAAATTAACCAGG - Intergenic
1188732298 X:33664875-33664897 AAATAGATGAAACATTTTCAAGG + Intergenic
1189698307 X:43688813-43688835 AAATGTAAGCAACATTTGACAGG - Intronic
1193512158 X:82416396-82416418 AAATGTATGGAACACTTACTAGG - Intergenic
1193558015 X:82980735-82980757 AAATGTGAGAAAGATTTGCCAGG - Intergenic
1193949840 X:87784211-87784233 AAATAAATGAAACATTTTTCAGG + Intergenic
1194666411 X:96682122-96682144 AAATGTATTAAGCAATTACAAGG - Intergenic
1195293578 X:103453083-103453105 AAATGTATAGAACATTTATTGGG + Intergenic
1195318786 X:103704408-103704430 ATATGTATAAAATATTTAGCTGG + Intergenic
1196310345 X:114156825-114156847 AAAAGAATGAAACAATTAGCTGG - Intergenic
1196327036 X:114418207-114418229 AAATATGTAAAGCATTTACCAGG + Intergenic
1197351516 X:125388633-125388655 AAATGTATTTAACATGTACATGG + Intergenic
1197808270 X:130417611-130417633 AGATGTATGAGAGATTTACCAGG + Intergenic
1198306923 X:135392786-135392808 AAATAAATGAAAAATTTACATGG - Intergenic
1199002776 X:142659558-142659580 AAGTGTATGAAATATTTAACTGG - Intergenic
1199397981 X:147362528-147362550 CTATGTTTGAAATATTTACCTGG - Intergenic
1201156846 Y:11138333-11138355 AAATAAATGAAATATTTACATGG - Intergenic