ID: 1095673715

View in Genome Browser
Species Human (GRCh38)
Location 12:44891456-44891478
Sequence AAACTACCACTGCTGGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095673713_1095673715 -5 Left 1095673713 12:44891438-44891460 CCTCTGCTCTCGGCTCAGAAACT 0: 1
1: 0
2: 2
3: 17
4: 287
Right 1095673715 12:44891456-44891478 AAACTACCACTGCTGGAGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 143
1095673709_1095673715 8 Left 1095673709 12:44891425-44891447 CCCCATAAAGGGTCCTCTGCTCT 0: 1
1: 0
2: 1
3: 12
4: 133
Right 1095673715 12:44891456-44891478 AAACTACCACTGCTGGAGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 143
1095673711_1095673715 6 Left 1095673711 12:44891427-44891449 CCATAAAGGGTCCTCTGCTCTCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1095673715 12:44891456-44891478 AAACTACCACTGCTGGAGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 143
1095673710_1095673715 7 Left 1095673710 12:44891426-44891448 CCCATAAAGGGTCCTCTGCTCTC 0: 1
1: 0
2: 2
3: 9
4: 109
Right 1095673715 12:44891456-44891478 AAACTACCACTGCTGGAGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095673715 Original CRISPR AAACTACCACTGCTGGAGCT CGG Intronic
902032867 1:13435727-13435749 AATCTCCCACTGCTGGAGGTTGG + Intergenic
904149882 1:28429465-28429487 AAAGTTCCACTGTTGGAGGTCGG + Intronic
906250117 1:44304734-44304756 ACACTATCACTGTTGGAGATGGG - Intronic
910547207 1:88432244-88432266 AAGCTGCCACTGCTGGGGGTGGG - Intergenic
912405117 1:109431195-109431217 AAACTAACACAGATGGCGCTAGG + Intergenic
915668319 1:157465185-157465207 TAACTACCAGTGTTGGAGGTGGG + Intergenic
916454119 1:164953050-164953072 AAACTGGCACTGCAGGAGCCAGG + Intergenic
916502770 1:165400908-165400930 AAATTGGCACTGCTGGAGCATGG - Exonic
918568991 1:185965080-185965102 AAAATACCTCAGCTGAAGCTAGG + Intronic
919758531 1:201081680-201081702 TAATTCCCAATGCTGGAGCTGGG + Intronic
922226829 1:223652760-223652782 AAACCACCACTGCAGCGGCTGGG + Intronic
1068935930 10:62635833-62635855 ATTCTACCTCTGCTGTAGCTGGG - Intronic
1069768296 10:70880322-70880344 CGACTACCACTGCTGGTGCAAGG - Exonic
1070329324 10:75406440-75406462 AAACGGCCACTGCCGGAGCCAGG + Intergenic
1071123894 10:82312507-82312529 AAACTTTCACGGCAGGAGCTAGG - Intronic
1072264796 10:93716795-93716817 TAACCCCCACTGCTGGAGGTGGG - Intergenic
1076336012 10:129706805-129706827 AATCCACCCCTGCTGGAGATGGG + Intronic
1076346751 10:129784689-129784711 AAACTGCATCAGCTGGAGCTGGG + Intergenic
1078067077 11:8085606-8085628 AAGCTACCCCTGCTGGACCCAGG - Intronic
1083281230 11:61628416-61628438 AATTTGCCACTGCTGGTGCTGGG - Intergenic
1083417220 11:62533576-62533598 AAATGTCCACTGCTGGAACTTGG + Exonic
1083981662 11:66176233-66176255 AGACTACCAGAGATGGAGCTAGG - Intronic
1084176065 11:67422979-67423001 AAACTACCAGGGCTGGGGCTTGG - Intronic
1084926280 11:72514792-72514814 AAACCACCACTCCTGGAAATTGG - Intergenic
1086800931 11:91174219-91174241 TAACTACCAGTGTTGGAGGTGGG - Intergenic
1087289337 11:96302517-96302539 AAACTCTCACTCCTGGAGGTTGG + Intronic
1088803378 11:113328160-113328182 AAGCCACCACTCCTGGTGCTTGG + Intronic
1090230703 11:125101203-125101225 TAACTTCCACTTCTGGGGCTGGG + Exonic
1095673715 12:44891456-44891478 AAACTACCACTGCTGGAGCTCGG + Intronic
1096493651 12:52026803-52026825 AAACTAGGCCTGCAGGAGCTAGG + Intronic
1097349845 12:58536697-58536719 AAACAACCATGGCTGGAGGTAGG - Intergenic
1098064679 12:66601310-66601332 AAACTGCCTATGCTGGAGCTGGG + Intronic
1099951817 12:89312314-89312336 AAAACACCATTGCTGGAGTTGGG - Intergenic
1101310629 12:103575498-103575520 AAACCTCCAGTGCTGGAGCGGGG - Intergenic
1102685693 12:114722840-114722862 ATTGTACCACTGCTGTAGCTTGG - Intergenic
1106632004 13:31484233-31484255 CATCTACCACTTCTGGGGCTGGG + Intergenic
1108171675 13:47748347-47748369 TAGCTACCACTGTTGGGGCTGGG - Intergenic
1110157023 13:72329822-72329844 AACCTACCAGTGCTTGAGCTTGG - Intergenic
1110786237 13:79530410-79530432 AAATTGCCACAGCTGGAGCTGGG - Intronic
1114631433 14:24161757-24161779 AACCTACCTCTGCTGATGCTCGG + Intronic
1116657826 14:47674211-47674233 AATCAAAGACTGCTGGAGCTCGG + Intronic
1118906448 14:70027232-70027254 GTACCACCACTGCTGGCGCTTGG + Intronic
1119165145 14:72486297-72486319 AAGCTTCTACTGCTGAAGCTGGG + Intronic
1122086350 14:99309350-99309372 TAATTCCCACTGCTGGAGGTGGG + Intergenic
1202839388 14_GL000009v2_random:107271-107293 AGACCACCACTGCTGGGGCCTGG - Intergenic
1202908763 14_GL000194v1_random:97424-97446 AGACCACCACTGCTGGGGCCTGG - Intergenic
1125551371 15:40547396-40547418 AAAGTCCCACTGCTGAAGCTCGG - Intronic
1126517734 15:49554645-49554667 ACACTGCCACTGCTGGGGGTTGG + Intronic
1127148988 15:56054528-56054550 AAAATACCATTGCTAAAGCTAGG - Intergenic
1128281839 15:66401682-66401704 AAGCAAGCACTGTTGGAGCTTGG + Intronic
1130709909 15:86269960-86269982 ATAGAACCACTGCTGGTGCTGGG - Exonic
1132601103 16:773360-773382 CAACCACCACTGCTGGCTCTGGG + Intronic
1133593176 16:7265845-7265867 TAACTCCCAATGCTGGAGGTGGG + Intronic
1133834349 16:9352675-9352697 AAAATAGCACTACTGGAGGTGGG - Intergenic
1134683697 16:16144151-16144173 ACCCAACCACTGCGGGAGCTGGG + Intergenic
1135831131 16:25774478-25774500 AAACCACCATTGCTGTAGCAAGG - Intronic
1138817941 16:60223936-60223958 ACACTTCCACTGCTGCAGCCTGG - Intergenic
1142801270 17:2347441-2347463 AAACTACCACTGTTGGGGAGAGG + Intronic
1146555902 17:33823763-33823785 AAACTTCCAATGCTGAAGCCTGG - Intronic
1148146615 17:45369585-45369607 AATCTGTCATTGCTGGAGCTGGG + Intergenic
1149133760 17:53340314-53340336 CATCTGCCACTGCTGGGGCTTGG + Intergenic
1149157479 17:53648621-53648643 ACACTACCACTGCAGGGGGTTGG + Intergenic
1151984264 17:77531967-77531989 AAACTGCCCTTGCAGGAGCTTGG + Intergenic
1153075507 18:1157480-1157502 AAGCTGCCACTGCTGGGGGTGGG - Intergenic
1153484691 18:5585109-5585131 AAACTTCAACTGCAGAAGCTAGG - Intronic
1158265616 18:55657923-55657945 AAACCACCACTGATGTAGCTGGG + Intronic
1158371616 18:56812739-56812761 AAATTCTCACTCCTGGAGCTGGG - Intronic
1161013991 19:1974435-1974457 AATCCAGCACTGCTGGGGCTGGG - Intronic
925823094 2:7819907-7819929 AAACTACCTCTTCTGGAGCCTGG + Intergenic
926493841 2:13559053-13559075 TAACTCCCAATGCTGGAGGTGGG - Intergenic
930595314 2:53380117-53380139 AAACTACCACTTGTCGAGTTTGG - Intergenic
930989914 2:57640820-57640842 AAACGTCAACTGCTGGAGCAGGG + Intergenic
933936619 2:87209160-87209182 AAAGTATCACTCCTTGAGCTGGG - Intergenic
936356525 2:111756668-111756690 AAAGTATCACTCCTTGAGCTGGG + Intergenic
939561756 2:143740664-143740686 AAACTGCCCCTGCTGTACCTGGG - Intronic
941430120 2:165404116-165404138 AAAGTAACATTGCTGGAGGTTGG + Intergenic
941765808 2:169295116-169295138 AAAGTACCACTGCACAAGCTTGG + Intronic
942890635 2:180982079-180982101 GAACTGCCACTGCTGGTGCTGGG - Exonic
944153970 2:196592529-196592551 GAACATCCTCTGCTGGAGCTTGG - Exonic
944620504 2:201510131-201510153 AAATTACCACTGCTAGCTCTTGG + Intronic
948677665 2:239608268-239608290 AAACTCCCTCTGCTGAAGTTGGG - Intergenic
1174843511 20:53921508-53921530 AAGCAACAACAGCTGGAGCTGGG + Intergenic
1175177288 20:57119891-57119913 AATCTGGCACTGCTGGAGGTGGG + Intergenic
1175231551 20:57476733-57476755 AAACCACAACGGCTGAAGCTGGG - Intergenic
1176628124 21:9112087-9112109 AGACTACCGCTGCTGGGGCCTGG - Intergenic
1181693938 22:24583566-24583588 AAGCTGCCACTTGTGGAGCTCGG + Intronic
1183991819 22:41602066-41602088 AAACTACAAATACTGGAGTTTGG + Intronic
1184345875 22:43912440-43912462 TAACTACCAGTGTTGGAGGTGGG + Intergenic
1184963710 22:47951044-47951066 AAAATACCACCCCTAGAGCTGGG + Intergenic
1185228957 22:49669402-49669424 AAGTTACCACTGCTGGCCCTGGG + Intergenic
949123350 3:415144-415166 AAACTAACAGTTCTGGGGCTGGG - Intergenic
949619224 3:5791278-5791300 AAACTATCATTCCTGGACCTGGG + Intergenic
950801209 3:15553026-15553048 ACACAACCACTGCTGGGGCATGG + Intergenic
952692134 3:36221553-36221575 AATCTACCACAGCTGTATCTTGG - Intergenic
953448588 3:42988158-42988180 TGACTACCACTGCTGGAGAGTGG + Intronic
956521284 3:70106974-70106996 CAACTCACATTGCTGGAGCTGGG + Intergenic
956702398 3:71969981-71970003 AAACCAGCACTGCTGCAGCTGGG - Intergenic
960333317 3:116389259-116389281 ATTCTACCACAGCTGGAGGTAGG - Intronic
962024286 3:131530934-131530956 AAACTACCACTTGTTGAGTTTGG + Intergenic
962512305 3:136114352-136114374 AAACAACAACTCCTGAAGCTCGG - Intronic
964416649 3:156454752-156454774 AACCTACTACTGATGGTGCTTGG + Intronic
967940228 3:194760275-194760297 AAACTATCACTTCTTGAGTTTGG - Intergenic
971860883 4:32104012-32104034 AAACTCAGACTGCAGGAGCTTGG + Intergenic
974614468 4:64264484-64264506 GAACTACCAATGCTGTAGCTTGG - Intergenic
975023463 4:69520317-69520339 ACACAGCCACTGCTGGAGTTGGG + Intronic
977279068 4:95016485-95016507 AAACTACCACTTCTTGAATTTGG + Intronic
982866778 4:160523314-160523336 AAACCAACAATGCTGGAGGTGGG - Intergenic
986590580 5:9365216-9365238 AAACAACCAGGGCTGGAGCAAGG + Intronic
987367067 5:17158363-17158385 GGACAATCACTGCTGGAGCTTGG + Intronic
989635713 5:43530807-43530829 AAACTGCAGCTGCTGCAGCTGGG + Intronic
995174374 5:109157974-109157996 AAAGTAACAATGCTGGAGTTAGG + Intronic
995238064 5:109852956-109852978 AAAATAACACTGCTGGAGGCTGG - Intronic
999446214 5:151641779-151641801 AATCGATCACTGCTGAAGCTAGG + Intergenic
999468002 5:151825267-151825289 AATCTCCCCTTGCTGGAGCTGGG + Intronic
999947800 5:156616328-156616350 ATATTCCCACTGCTAGAGCTAGG + Intronic
1000668876 5:164034765-164034787 CAACTCCCAGTGCTGGAGGTGGG - Intergenic
1002088757 5:176792515-176792537 AACCTGCTACTCCTGGAGCTGGG + Intergenic
1002169901 5:177369158-177369180 AGAGAACCACTGTTGGAGCTGGG + Intronic
1002993927 6:2264987-2265009 AAACTAGGACTGATGGAACTAGG + Intergenic
1016733253 6:147448914-147448936 ATACCACCACTGCTGTAGATCGG + Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018026155 6:159807801-159807823 AAACTACCACTTGTTGAGTTTGG + Intronic
1018644973 6:165939911-165939933 ACGCTTCCATTGCTGGAGCTTGG - Intronic
1023930052 7:44699996-44700018 AATCTCCCACTGCTGGAGGTGGG - Intronic
1024179835 7:46881069-46881091 CAGCTGCCACTCCTGGAGCTGGG + Intergenic
1028864216 7:95689076-95689098 ATACAACCACTTCTGGAGCCGGG - Intergenic
1029733107 7:102450652-102450674 AAACTAGAAAGGCTGGAGCTGGG - Exonic
1029939792 7:104468124-104468146 AAACTGCCACTGCTGCAACCCGG + Intronic
1031921867 7:127608365-127608387 AAGCTTCCACTGCAGGTGCTGGG + Intergenic
1035084668 7:156247759-156247781 ATGCCACCACTGCTGGAGGTGGG + Intergenic
1035372217 7:158386784-158386806 AAACCACCACAGCAAGAGCTGGG - Intronic
1036043489 8:5113299-5113321 AAACTTCCACTGGTGGAGAATGG + Intergenic
1036763924 8:11534083-11534105 ATACCAGCACTGCTGGGGCTGGG + Intronic
1037033902 8:14142687-14142709 TAACTCCCAATGCTGGAGATGGG + Intronic
1037295144 8:17391611-17391633 AAACTACCACTACTCAAACTGGG + Intronic
1038149589 8:24930462-24930484 ACACTACCTCTGCTGGACGTGGG + Intergenic
1038553157 8:28487088-28487110 AAACAACCAGTGCAGGCGCTTGG - Intronic
1040582992 8:48712566-48712588 AAATGACCAATGGTGGAGCTGGG + Intronic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1042097922 8:65238933-65238955 ATACTACCACTGCTGAAACAAGG - Intergenic
1042651571 8:71047878-71047900 AAACTACCTCTGCAGTAACTTGG + Intergenic
1044511216 8:93081443-93081465 AAACTACTACTGCTAAACCTAGG + Intergenic
1044931037 8:97251834-97251856 AAACGACCAGTGCAGGAGTTTGG - Intergenic
1047165215 8:122431128-122431150 AAACTGCCATTGCAGAAGCTTGG - Intergenic
1048635600 8:136291979-136292001 TAACTCCCAATGCTGGAGGTGGG - Intergenic
1049143704 8:140981464-140981486 AAAATCCCACTGTTGAAGCTGGG + Intronic
1050415700 9:5414604-5414626 AAACTAACACTGAAGGAGCCGGG + Intronic
1050483148 9:6106838-6106860 CAGCTACCACTCCTGGGGCTGGG + Intergenic
1050708496 9:8431756-8431778 AAACTAGCATTTCTGGGGCTGGG + Intronic
1203750968 Un_GL000218v1:79767-79789 AGACCACCACTGCTGGGGCCTGG - Intergenic
1203483016 Un_GL000224v1:24577-24599 AGACCACCACTGCTGGGGCCTGG + Intergenic
1186917993 X:14244304-14244326 GAACTGCCACTGCTGGTGCTGGG - Intergenic
1187312419 X:18158061-18158083 TAATACCCACTGCTGGAGCTGGG + Intergenic
1189690717 X:43613991-43614013 AGACTGCCACTGCTGGAGGATGG + Intergenic
1195849265 X:109265160-109265182 ACACCACCCCTGCTGGAGGTTGG + Intergenic
1196457969 X:115903290-115903312 CAACTCCCAGTGCTGGAGTTCGG - Intergenic
1198147526 X:133872463-133872485 CAACAAACAGTGCTGGAGCTTGG + Intronic
1198725036 X:139667848-139667870 ATGCTACCACTGCTAGAGCTGGG - Intronic