ID: 1095674211

View in Genome Browser
Species Human (GRCh38)
Location 12:44897745-44897767
Sequence TTCTGTCTCGGGGGCATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1001
Summary {0: 1, 1: 1, 2: 95, 3: 383, 4: 521}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095674211_1095674221 12 Left 1095674211 12:44897745-44897767 CCTGGAATGCCCCCGAGACAGAA 0: 1
1: 1
2: 95
3: 383
4: 521
Right 1095674221 12:44897780-44897802 CTGGAAAAGAGGCTGAAGCCAGG 0: 5
1: 73
2: 701
3: 679
4: 796
1095674211_1095674217 1 Left 1095674211 12:44897745-44897767 CCTGGAATGCCCCCGAGACAGAA 0: 1
1: 1
2: 95
3: 383
4: 521
Right 1095674217 12:44897769-44897791 TGTTTACTCCCCTGGAAAAGAGG 0: 2
1: 16
2: 178
3: 397
4: 1004
1095674211_1095674222 13 Left 1095674211 12:44897745-44897767 CCTGGAATGCCCCCGAGACAGAA 0: 1
1: 1
2: 95
3: 383
4: 521
Right 1095674222 12:44897781-44897803 TGGAAAAGAGGCTGAAGCCAGGG 0: 5
1: 72
2: 726
3: 642
4: 878
1095674211_1095674216 -7 Left 1095674211 12:44897745-44897767 CCTGGAATGCCCCCGAGACAGAA 0: 1
1: 1
2: 95
3: 383
4: 521
Right 1095674216 12:44897761-44897783 GACAGAACTGTTTACTCCCCTGG 0: 6
1: 162
2: 356
3: 568
4: 502
1095674211_1095674223 23 Left 1095674211 12:44897745-44897767 CCTGGAATGCCCCCGAGACAGAA 0: 1
1: 1
2: 95
3: 383
4: 521
Right 1095674223 12:44897791-44897813 GCTGAAGCCAGGGAGCCAAGTGG 0: 643
1: 640
2: 376
3: 178
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095674211 Original CRISPR TTCTGTCTCGGGGGCATTCC AGG (reversed) Intronic
902063164 1:13662277-13662299 TTCTGACCAGGGGGCATCCCTGG + Intergenic
902141613 1:14361461-14361483 TTCTGTCTCACTGGCGTTCCAGG + Intergenic
903566943 1:24274762-24274784 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
906557828 1:46728475-46728497 TTCTGTCTCACTGGCATTCCAGG - Intergenic
906586724 1:46984836-46984858 TTCTGTCTCACTGGCATTTCAGG - Intergenic
906739972 1:48173232-48173254 TTCTCTCTCCCTGGCATTCCAGG + Intergenic
906843127 1:49161062-49161084 TTCTGTCTCGCTGGCATTTCAGG + Intronic
907015151 1:51005351-51005373 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
907423455 1:54363072-54363094 TGCTGTCTAGAGGTCATTCCTGG + Intronic
907565605 1:55430692-55430714 TTCTGTCTCGCTGGGATTCCAGG - Intergenic
907600093 1:55760508-55760530 TTCTGTCTCGCTGGCATTACAGG - Intergenic
907953517 1:59206613-59206635 TTCTGTCTCACAGGCATTCCAGG - Intergenic
908584649 1:65554721-65554743 GTCTGTCTTGCTGGCATTCCAGG + Intronic
908598307 1:65711557-65711579 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
908601427 1:65744211-65744233 TTCTGTCTCACTGGCATTTCAGG + Intergenic
909403270 1:75258169-75258191 TTCTGTCTCACTGGCATTCCAGG - Intronic
909415648 1:75402824-75402846 TTCTGTCTCACTGGCATTCCAGG - Intronic
909672381 1:78203534-78203556 TTCTGTCTCACTGGCATTCCAGG - Intergenic
909690165 1:78398238-78398260 TTCTGTCTTGCTGGCATTCCAGG + Intronic
910177179 1:84443198-84443220 TTCTGTCTTGCTGGCGTTCCAGG - Intergenic
910330975 1:86072138-86072160 TTCTGTCTCACTGGCGTTCCAGG - Intronic
910604821 1:89072003-89072025 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
910799504 1:91131380-91131402 TTCTGTCTCGCTGGTCTTCCAGG - Intergenic
910805759 1:91188650-91188672 TTCTGTCTCACTGGCACTCCAGG + Intergenic
911270630 1:95797342-95797364 TTCTGTCTTGCTGGCGTTCCAGG - Intergenic
911692075 1:100845652-100845674 TTCTGTCTTGGTGGCATTCCAGG + Intergenic
911856868 1:102888909-102888931 TTCTCTCTCTAGGGAATTCCTGG - Exonic
911941840 1:104057200-104057222 TTCTGTCTCTTTGGCGTTCCAGG - Intergenic
911982728 1:104586504-104586526 TTCTGTCTCGCTGGCATTCCCGG - Intergenic
912076756 1:105884700-105884722 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
912150492 1:106853379-106853401 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
912966216 1:114239706-114239728 TTCTGCCTCACTGGCATTCCAGG - Intergenic
913021478 1:114792348-114792370 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
913430130 1:118781290-118781312 TTCAGTCTCACTGGCATTCCGGG + Intergenic
913720405 1:121587169-121587191 TTCTGTCTCACTGGCTTTCCAGG + Intergenic
915663592 1:157424391-157424413 TCCTGTCTCGCTGGGATTCCAGG - Intergenic
916362847 1:163990411-163990433 TTATGTCTTGCCGGCATTCCAGG - Intergenic
916973420 1:170048954-170048976 TTCTGTCTCACTGGGATTCCAGG - Intronic
917091706 1:171359664-171359686 CTCTGTCTTGCCGGCATTCCAGG - Intergenic
917163174 1:172080636-172080658 TTCTGTCTTGCTGGCATTCCAGG + Intronic
917357735 1:174143999-174144021 TTCTGTCTCGCTGGCAGTCCAGG - Intergenic
917405946 1:174708801-174708823 TTCTGTCTCACTGGCATTCCAGG - Intronic
917585005 1:176417181-176417203 TTCTGTCTCGCTGGCGTTCCAGG + Intergenic
918360419 1:183751561-183751583 TTCTGTCTCGCTGGGGTTCCAGG + Intronic
918612865 1:186512425-186512447 TTCTGTCTCGCTGGCGTTCCAGG + Intergenic
918632115 1:186730612-186730634 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
918684374 1:187396943-187396965 TTCTGTCTTGCTGGCATTCCTGG - Intergenic
918906829 1:190506392-190506414 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
919146805 1:193645410-193645432 TTCTGTCTCTCTGGGATTCCAGG + Intergenic
920985560 1:210885522-210885544 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
921626155 1:217379795-217379817 TTCTCTCTTGCTGGCATTCCAGG - Intergenic
921631318 1:217437361-217437383 TTGTGTCTCGCTGTCATTCCAGG - Intronic
921738246 1:218653405-218653427 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
921962209 1:221047564-221047586 TTCTGTCTTGCTGGCGTTCCAGG - Intergenic
922066183 1:222145902-222145924 TTCTGTCTCGCTAGCATTCCAGG - Intergenic
922253452 1:223871175-223871197 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
922406246 1:225316363-225316385 TTCTGTCTTGCTGGCATTCCAGG + Intronic
922666508 1:227474020-227474042 CTCTGTCTCGCTGGCATTCCAGG - Intergenic
922829946 1:228547287-228547309 TTCTGTCTCTTGGCCATGCCTGG + Intergenic
922853936 1:228757963-228757985 TTAGGTCTTGGAGGCATTCCTGG + Intergenic
923727981 1:236523858-236523880 TTCTGTGTCTGGGGCGTCCCTGG - Intronic
923853400 1:237820652-237820674 TTCTGTCTCGCTGGCATCCCAGG - Intronic
924253423 1:242158321-242158343 TTCTGTCTCGCTGGCCTCCCAGG + Intronic
924254555 1:242169558-242169580 TTCTGTCTCGCTGGCATTCCAGG - Intronic
924295993 1:242587077-242587099 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
924823137 1:247513519-247513541 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1065427392 10:25619639-25619661 TTCTGTTTCACTGGCATTCCAGG - Intergenic
1065651714 10:27899443-27899465 TTCTGTCTCGCTGGCATTCCGGG - Intronic
1066074392 10:31858550-31858572 TCCTGTCTCGGCGGCATCTCTGG + Intronic
1067162191 10:43836568-43836590 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1067329478 10:45301559-45301581 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1067332299 10:45333636-45333658 TTCTGTCTCGCTGACATTCCAGG + Intergenic
1069093501 10:64229959-64229981 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1069120853 10:64567477-64567499 TTCTGTCTCGCTGGGTTTCCAGG + Intergenic
1069264318 10:66438705-66438727 TTCTGTCTTGCTAGCATTCCAGG + Intronic
1070213138 10:74347547-74347569 TTCTGTCTCGCTGGGGTTCCGGG - Intronic
1070349232 10:75575997-75576019 TTCTGTCTCACTGGCATTCCAGG - Intronic
1071480634 10:86062333-86062355 CTTTGCCTCGGGGACATTCCAGG + Intronic
1072044851 10:91644274-91644296 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1072404377 10:95136311-95136333 TTCTGTCTCAGTGGCATTCCAGG - Intergenic
1072493729 10:95934400-95934422 TTCTGTCTTGTTGGCGTTCCAGG + Intronic
1072872270 10:99132867-99132889 TTCTGTCTCGCTGGCGTTTCAGG - Intronic
1072899511 10:99394701-99394723 TTCTGTCTCAGGGGCTTGTCTGG - Intergenic
1073884162 10:108019322-108019344 TTCTGTCTCACTGGCATGCCAGG - Intergenic
1074016790 10:109542582-109542604 TTCTGTATCACTGGCATTCCAGG + Intergenic
1075390112 10:122085718-122085740 CTCTGTCTCTGGGGCATCCTGGG - Exonic
1075983945 10:126767057-126767079 TTCTGTCTCACTGGCATCCCAGG + Intergenic
1076245761 10:128946050-128946072 TTCAGTCTGGGGGGCAGTCAAGG - Intergenic
1078429159 11:11274321-11274343 TTCTGTCACACTGGCATTCCTGG - Intronic
1078814148 11:14802143-14802165 TTCTGTCTTGCTGGCGTTCCAGG + Intronic
1079517845 11:21289640-21289662 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1079696093 11:23484150-23484172 TTCTGTCTCACTGGAATTCCAGG - Intergenic
1079799806 11:24854630-24854652 TTCTGTCTCACTGGCATTCCAGG + Intronic
1080117698 11:28639088-28639110 TTCTGTCTCACTGGCTTTCCAGG - Intergenic
1080977129 11:37356700-37356722 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1081080233 11:38732102-38732124 TTCTGTCTCGCTGGCATTTCAGG + Intergenic
1081118254 11:39232208-39232230 TTCTGTCTCGCTGGGTTTCCAGG - Intergenic
1081198769 11:40192581-40192603 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
1081252371 11:40851139-40851161 TTCTGTCTTGCTGGCTTTCCAGG + Intronic
1081363268 11:42205482-42205504 TTCTGTCTTGCTGGTATTCCAGG - Intergenic
1082670675 11:56033254-56033276 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1082867107 11:57910430-57910452 TTCTGTCTCGCTGGCACTCCAGG + Intergenic
1082924352 11:58530177-58530199 TTCTGTCTCGCTGGCATTCCAGG - Intronic
1083054117 11:59803351-59803373 TTGTGTCTTGGGGGCACTCTAGG + Intergenic
1083368475 11:62158226-62158248 TTCTGTCTCACTGGCGTTCCAGG - Intergenic
1083385555 11:62306666-62306688 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1083510193 11:63202279-63202301 TTCTGTCTCACTGGCATTCCAGG - Intronic
1083825343 11:65200014-65200036 TTCTGGATTGGTGGCATTCCAGG - Intronic
1084580759 11:70021742-70021764 TTCAGTCTCTGGAGCCTTCCTGG - Intergenic
1085003347 11:73061436-73061458 TTCTGTCTCACTGGTATTCCCGG - Intronic
1085433829 11:76481374-76481396 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
1086300362 11:85420947-85420969 TTGTGTCTTGTTGGCATTCCAGG + Intronic
1086348844 11:85924739-85924761 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1086732855 11:90271074-90271096 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
1086735690 11:90302650-90302672 TTCTGTCTTGGTGGCATTACAGG + Intergenic
1086907345 11:92433245-92433267 TTCTGTCTCACTGGCATTCCAGG + Intronic
1087305731 11:96487268-96487290 TTCTGTCTCGCTGGCATTCCAGG - Intronic
1087596096 11:100256930-100256952 TTCTGTCTCACTGGCATTCCAGG - Intronic
1087667760 11:101070453-101070475 TTCTGTCTCACTGGCATTCCAGG - Intronic
1087703821 11:101466717-101466739 TTCTGTCTCACTGGTATTCCAGG + Intronic
1087712164 11:101567001-101567023 TTCTGTCTCACTGGCGTTCCAGG - Intronic
1087925117 11:103910729-103910751 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1088066436 11:105726023-105726045 TTCTGTCTCAATGGCATTGCAGG - Intronic
1088078335 11:105878903-105878925 TTCTGTCTCACTGGCATTCCAGG + Intronic
1088211960 11:107466466-107466488 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1088307235 11:108423211-108423233 GTCTGTCTCGCTGGCATTCCAGG - Intronic
1089766061 11:120766464-120766486 TTCTGTGTTGCTGGCATTCCAGG + Intronic
1090214261 11:124947071-124947093 TTCTGTGTCTGGGGGATCCCTGG - Intergenic
1090688839 11:129156220-129156242 TTCTGTCTTGTTGGCATTCCAGG - Intronic
1090896142 11:130977100-130977122 TTCAGTCTCGCTGGCATTCCAGG + Intergenic
1091958724 12:4672362-4672384 TTCTGTCTCACTGGCGTTCCAGG - Intronic
1092304334 12:7283682-7283704 TTCTGTCTCATTGGCTTTCCAGG - Intergenic
1092332127 12:7594340-7594362 TTCTGTCTCACTGGCATTGCAGG - Intergenic
1092398817 12:8153896-8153918 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1092690876 12:11108797-11108819 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1092703225 12:11256474-11256496 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1092966403 12:13647806-13647828 TTCTGCCTCTGGGGTATTCCTGG - Intronic
1093004393 12:14035905-14035927 TTCTGTCTTGCTAGCATTCCAGG - Intergenic
1093402276 12:18761082-18761104 TTCTGTTTCACTGGCATTCCAGG - Intergenic
1093545078 12:20336622-20336644 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1093664495 12:21795561-21795583 TTCTGTCTCACTGGCGTTCCAGG + Intergenic
1093714470 12:22366066-22366088 TTTTGTCTAGCTGGCATTCCAGG - Intronic
1093835634 12:23825103-23825125 TTCTGTCTCTCTGGCATTCCAGG + Intronic
1094757828 12:33492698-33492720 TTCTGTCTCAATGGCATTCCAGG - Intergenic
1094782091 12:33802843-33802865 TTCTGTCTCACTGGCATACCAGG + Intergenic
1095119962 12:38405373-38405395 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1095230524 12:39733914-39733936 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1095356394 12:41280343-41280365 GTCTGTCTTGCTGGCATTCCAGG - Intronic
1095488458 12:42708321-42708343 TTCTGTCTTGCTGGCATTCTAGG - Intergenic
1095547389 12:43388040-43388062 TTCTGTCTTGCTGGCATTCCGGG + Intronic
1095674211 12:44897745-44897767 TTCTGTCTCGGGGGCATTCCAGG - Intronic
1095778111 12:46031883-46031905 TTCTGTGTCGCTGGCATTCCAGG - Intergenic
1095832367 12:46601588-46601610 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
1096840507 12:54376900-54376922 TTCAGTCTCAGCTGCATTCCAGG - Intronic
1097488406 12:60234802-60234824 TTCGGTCTTGCTGGCATTCCAGG - Intergenic
1097635222 12:62114002-62114024 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1097654463 12:62343422-62343444 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1097752957 12:63378213-63378235 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1098052900 12:66472955-66472977 TTCTCTCTCACTGGCATTCCAGG - Intronic
1098151901 12:67555721-67555743 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1098183211 12:67869884-67869906 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1098635597 12:72780329-72780351 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1098780138 12:74676515-74676537 GTCTGTCTCACTGGCATTCCAGG - Intergenic
1099030803 12:77523913-77523935 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1099071400 12:78049230-78049252 TTCTGTCTCACTGGCATTCCAGG + Intronic
1099238958 12:80116061-80116083 TTCTGTCTTGCTGGCATTACAGG + Intergenic
1099486276 12:83232822-83232844 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1099522482 12:83681668-83681690 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1099554745 12:84097554-84097576 TTCGGTCTTGCTGGCATTCCAGG - Intergenic
1099745002 12:86690326-86690348 TTCTGTCTCACTGGCAATCCAGG + Intronic
1099798041 12:87422668-87422690 TTCTGTCTTGCTGGCATTTCAGG + Intergenic
1099897527 12:88667584-88667606 TTCTGTCTCGCTGACATTCCAGG - Intergenic
1100136251 12:91556910-91556932 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1100302625 12:93321997-93322019 TTCTGGGTAAGGGGCATTCCAGG + Intergenic
1100740018 12:97581521-97581543 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1100768767 12:97898318-97898340 TTCTGTCTCGCTGGCGTTGCAGG + Intergenic
1100896241 12:99185870-99185892 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
1101069893 12:101062896-101062918 CTCTGTCTTGCTGGCATTCCAGG + Intronic
1101277557 12:103219043-103219065 TTCTGTCTCCCTGGCATTCCAGG - Intergenic
1101296058 12:103424815-103424837 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
1101472692 12:105013491-105013513 TTCTGTCTCGCTGGTGTTCCAGG + Intronic
1101601274 12:106212402-106212424 TTCTGTCTTACTGGCATTCCAGG + Intergenic
1102235744 12:111293512-111293534 TTCTGTCAGGAGGGCTTTCCCGG - Exonic
1102345603 12:112159202-112159224 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1103169186 12:118799152-118799174 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
1103764350 12:123270751-123270773 TTCTGCATCGAGGGCCTTCCAGG + Intronic
1105355078 13:19652560-19652582 TTTTGTCTCGCTGGCGTTCCAGG - Intronic
1105645816 13:22316459-22316481 TTCTCTTTCGCTGGCATTCCAGG + Intergenic
1105737414 13:23285620-23285642 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1106025779 13:25953985-25954007 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1106042114 13:26103391-26103413 TTCTGTCTCACTGGCGTTCCAGG - Intergenic
1106612338 13:31295826-31295848 TTCTGTCTCACTGGCATTCCAGG + Intronic
1106650833 13:31688374-31688396 TTCTGTCTTGCTGGGATTCCAGG - Intergenic
1106983889 13:35322108-35322130 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1107014872 13:35700318-35700340 TTCTGTGTCGGGTGCAAGCCGGG + Intergenic
1107473485 13:40712863-40712885 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1107551506 13:41480316-41480338 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1107641995 13:42453181-42453203 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1107648141 13:42516412-42516434 TTCTGTCTTGCTGGCGTTCCAGG - Intergenic
1107674111 13:42776962-42776984 TTCTGTCTCGCTGGCGTTCCAGG + Intergenic
1107968875 13:45622393-45622415 TTCTCTCTTGCTGGCATTCCAGG + Intergenic
1108030109 13:46220613-46220635 TTCTATCTCTCTGGCATTCCAGG + Intronic
1108262822 13:48675659-48675681 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1108304576 13:49118484-49118506 TTCTGTCTTGCTGGCGTTCCAGG - Intronic
1108393924 13:49974550-49974572 TTCCAGCTCTGGGGCATTCCGGG - Intergenic
1108599837 13:51983043-51983065 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1109195899 13:59377255-59377277 TTCTATCTTGCTGGCATTCCAGG - Intergenic
1109293710 13:60505068-60505090 TTCTGTCTCACTGGCATTCCAGG - Intronic
1109328628 13:60900465-60900487 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
1109866582 13:68272595-68272617 TTCTGTCTGTGGGGCATACAGGG + Intergenic
1109902826 13:68795878-68795900 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1110135489 13:72062551-72062573 TTCTGTCTCATGGGCATTCCAGG - Intergenic
1110824651 13:79958250-79958272 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1110890259 13:80689723-80689745 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1110942000 13:81362673-81362695 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1111114183 13:83754558-83754580 TTCTGTCTCATTGGCATTGCAGG - Intergenic
1111635048 13:90892815-90892837 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1112151889 13:96773297-96773319 TTCTGTCTCACTGGCATTCCAGG - Intronic
1113424099 13:110193700-110193722 TTCTGACTGAGGGGCATCCCAGG - Intronic
1113804163 13:113103851-113103873 GTCTGTCCCAGGGGCATGCCTGG - Intergenic
1114133589 14:19820941-19820963 TTCTATCTTGCTGGCATTCCAGG + Intronic
1114433763 14:22686147-22686169 CTCTGTCTCGCTGGCATTCCAGG - Intergenic
1114710036 14:24768582-24768604 TTCTGCCTCACTGGCATTCCAGG - Intergenic
1114741720 14:25104695-25104717 TTCTTTCTCGTTGGCATTCCAGG - Intergenic
1114817635 14:25979288-25979310 TTCTGTCTCATTGGCATTCCAGG - Intergenic
1114870140 14:26645808-26645830 TTTTGTCTCACTGGCATTCCAGG + Intergenic
1115008215 14:28511781-28511803 TTCTGTCTTGCTGGCATACCAGG + Intergenic
1115043077 14:28955409-28955431 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1115162358 14:30410425-30410447 ATCTGTCTCACTGGCATTCCAGG + Intergenic
1115339053 14:32272836-32272858 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
1115357134 14:32460698-32460720 TTCTGTCTCTCAGGCATTCCAGG - Intronic
1115511250 14:34139768-34139790 TTCTGTCTTGTTGGCATTCCAGG - Intronic
1115538019 14:34391647-34391669 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1115721119 14:36162220-36162242 TTCTGTCTCACTGGCGTTCCAGG + Intergenic
1115912191 14:38268968-38268990 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1115940363 14:38601828-38601850 TTCTGTCTTGCTGGCGTTCCAGG + Intergenic
1116511914 14:45756759-45756781 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1116572478 14:46535110-46535132 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1116743832 14:48792592-48792614 TTCTGTCTTGCTGGCATTCCGGG - Intergenic
1116771503 14:49131799-49131821 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1116775695 14:49178605-49178627 TTCTCTCTCACTGGCATTCCAGG - Intergenic
1117104239 14:52382282-52382304 TTCTGTCTTGCTGTCATTCCAGG - Intergenic
1117237945 14:53798342-53798364 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1117282184 14:54252157-54252179 TTCTGTCTGGGGAGAATTGCCGG + Intergenic
1117599969 14:57365033-57365055 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
1117617110 14:57545070-57545092 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1117624195 14:57618668-57618690 TTCTGGCTCGCTGGCATTGCAGG - Intronic
1117655440 14:57951412-57951434 TTCTGTCTCGCTGGCATTTCAGG - Intronic
1117797104 14:59405931-59405953 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1117930571 14:60837233-60837255 TTCTGTCTCTCTGTCATTCCAGG + Intronic
1117932220 14:60855324-60855346 TTCTGTCTTGGTGGGGTTCCAGG + Intronic
1119018511 14:71084858-71084880 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1119642711 14:76327062-76327084 GTCTCTCTTGGGGGCCTTCCTGG + Intronic
1120137249 14:80884788-80884810 TTCTGTCTCGCTGGGGTTCCAGG - Intronic
1120271802 14:82322102-82322124 TTCTGTCTCGCTGGGATTCCAGG + Intergenic
1120450064 14:84655581-84655603 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1120554142 14:85907967-85907989 TTCTGTCTCACTGGGATTCCAGG + Intergenic
1120770091 14:88369999-88370021 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1120843186 14:89104834-89104856 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1121470619 14:94151551-94151573 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1121635979 14:95454151-95454173 TGCTCTCTCGGGAGCATCCCAGG + Intronic
1122593893 14:102875260-102875282 TTCAGACTCTGGGGCCTTCCGGG - Intronic
1123576658 15:21676510-21676532 TTCTATCTTGCTGGCATTCCGGG + Intergenic
1123613280 15:22118978-22119000 TTCTATCTTGCTGGCATTCCGGG + Intergenic
1124893919 15:33758271-33758293 TTCTGTCTCGCTGGTATTCCAGG - Intronic
1125219522 15:37317501-37317523 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1125227138 15:37408277-37408299 TTCTGTCTCACTGGTATTCCAGG - Intergenic
1125288491 15:38119851-38119873 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1125784265 15:42301482-42301504 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
1126554054 15:49966249-49966271 TTCTGTCTCACTGGCATTCCAGG - Intronic
1127317905 15:57815107-57815129 TTCTGTCTCGCTGGTATTCCAGG + Intergenic
1128521849 15:68380583-68380605 TGCTGTCTGGGGAGCCTTCCTGG + Intronic
1128883644 15:71265584-71265606 TTTTGTCTCACTGGCATTCCAGG - Intronic
1129499183 15:76019343-76019365 TTCTGTCTCGCTGGTGTTCCAGG + Intronic
1129563176 15:76592950-76592972 TTCTGTCTCGGTGGTGTTCCAGG - Intronic
1130728697 15:86467483-86467505 TTCTCTCTCGCTGGCATTCCAGG + Intronic
1132155479 15:99492758-99492780 TGCTGTGTCAGGGTCATTCCTGG - Intergenic
1202985526 15_KI270727v1_random:410755-410777 TTCTATCTTGCTGGCATTCCGGG + Intergenic
1136232921 16:28898032-28898054 TTCTGTCTCGGGAGAACTCCAGG - Exonic
1137296288 16:47097151-47097173 TTCTGTCTCGCTGGCGTTCCAGG - Intronic
1137336508 16:47554528-47554550 TTCTGTCTCCGCGGAGTTCCAGG + Intronic
1137748493 16:50841162-50841184 TCCTGTCTCGGTGGCGTTCAAGG + Intergenic
1137828066 16:51516911-51516933 TCCTGTCTCGCTGGCATTCCAGG - Intergenic
1137970018 16:52975579-52975601 TTCTCTCTCACTGGCATTCCAGG + Intergenic
1138151520 16:54661791-54661813 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1138273078 16:55710040-55710062 TTGTGGCTCCTGGGCATTCCAGG - Intergenic
1138706484 16:58920653-58920675 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1138886882 16:61090898-61090920 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1139328834 16:66172093-66172115 TTCTGCCTTGGGGGCCTTCAAGG - Intergenic
1140539185 16:75740190-75740212 TTTTGTCTCGGAGGCATACCTGG + Intronic
1141594656 16:85089794-85089816 TTCCGTCTCTGGAACATTCCAGG - Exonic
1144434150 17:15224113-15224135 TTCTGTCTCGCTGGCGTTCCAGG + Intergenic
1145274293 17:21420733-21420755 TTCTGACTCTGGGGCCCTCCTGG + Intergenic
1147706866 17:42431792-42431814 TTCTTTGTCGGGGGCTTTCTGGG - Intergenic
1148126329 17:45239072-45239094 TTCAGTCTGGGGGGCAGTACAGG - Intronic
1148403276 17:47386644-47386666 CTCTGTCTCGCTGGGATTCCAGG + Intronic
1148967352 17:51447101-51447123 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1149053687 17:52336972-52336994 CTCTGTGTCTGGGGCACTCCAGG - Intergenic
1149222853 17:54435977-54435999 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1150545746 17:66155525-66155547 TTCTGTCTCGCTGGCATTCCAGG - Intronic
1150884603 17:69070720-69070742 TTCTGTCTCACTGGCGTTCCAGG - Intergenic
1151064217 17:71132005-71132027 TTCTGTCTCCCTGGCATTCCAGG + Intergenic
1151069257 17:71189644-71189666 TTCTGCTTCTGGGGCATCCCAGG + Intergenic
1152516526 17:80828039-80828061 TTCTGTTTCAGGCGCATCCCTGG + Intronic
1152805977 17:82356526-82356548 TTCTGGCTCGTGGGCAATCTGGG + Intergenic
1153059409 18:980106-980128 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
1153313442 18:3700135-3700157 TTCTGTCTCGCTGGTGTTCCAGG + Intronic
1153562271 18:6383322-6383344 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1153798431 18:8646854-8646876 TTGTGTCTCACTGGCATTCCAGG - Intergenic
1154382263 18:13863249-13863271 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
1155114196 18:22748762-22748784 TTCTGTCTCGCTGACATTCCAGG - Intergenic
1155395288 18:25380215-25380237 TTCTGTCTCGCTTGCATTCCAGG - Intergenic
1155857372 18:30850284-30850306 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1156582334 18:38392686-38392708 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
1156626892 18:38920263-38920285 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1156979315 18:43265826-43265848 TTCTGTCTCGCTGGAATTCCAGG + Intergenic
1157067326 18:44366962-44366984 TTCTGTCTTACTGGCATTCCAGG + Intergenic
1157178902 18:45477995-45478017 TTCTGTCTCACTGGCGTTCCAGG + Intronic
1157430239 18:47619025-47619047 TTCTGTCTCTTTGGCCTTCCCGG + Intergenic
1157695132 18:49716465-49716487 TTCTGTCTCACTGGCGTTCCAGG + Intergenic
1158098608 18:53804286-53804308 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
1158853343 18:61517748-61517770 TTCTGTCTCACTGGCATTCCAGG - Intronic
1159254696 18:65931065-65931087 TTCTGTCTCACTGGCATTTCAGG - Intergenic
1159562164 18:70007386-70007408 CTCTGTCTCACTGGCATTCCAGG - Intronic
1159581295 18:70236846-70236868 TTCTGTCACGCTGACATTCCAGG - Intergenic
1159661260 18:71098128-71098150 TTCTGTCTCATTGGCATTCCAGG + Intergenic
1160076220 18:75680123-75680145 TTCTGCCTAGAGGGCATTTCAGG - Intergenic
1160083407 18:75752799-75752821 CTCTGTGACGGGGGCATTCCAGG + Intergenic
1160466683 18:79083417-79083439 TTCTGTCTTGTTGGCATTCCAGG + Intronic
1163989846 19:20988318-20988340 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
1165254619 19:34568227-34568249 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1165970432 19:39624288-39624310 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1168457667 19:56526495-56526517 TTCTGTTTCACTGGCATTCCAGG - Exonic
1168614858 19:57829442-57829464 TTCTGTCTCCTGCTCATTCCTGG + Intronic
925215056 2:2087170-2087192 TTCAGTCTTGGGTGCATTACGGG + Intronic
925729190 2:6905167-6905189 TTCTGTCTCACTGGTATTCCAGG + Intergenic
926533518 2:14082247-14082269 TTCTGTCTAGTTGCCATTCCAGG - Intergenic
926944008 2:18168204-18168226 TTCTGTCTCATTGACATTCCAGG + Intronic
928305237 2:30164613-30164635 TCCTGGGTCGGGGGCATACCAGG - Intergenic
928398113 2:30958663-30958685 TTCTGTCTGGGTGGCTTTGCGGG - Intronic
928750613 2:34466635-34466657 TTCTGTCTCACTGGCATTCCAGG - Intergenic
928830514 2:35477700-35477722 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
929062935 2:37941905-37941927 TTCTGTCTCGCTGGTGTTCCAGG + Intronic
929257774 2:39830982-39831004 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
930323307 2:49882315-49882337 TTCTGTCTCGCTGGCATTCCGGG - Intergenic
930439891 2:51391803-51391825 TTCTGTCACATTGGCATTCCAGG - Intergenic
931538636 2:63304727-63304749 TTGTGTCTCACTGGCATTCCAGG - Intronic
931814803 2:65890096-65890118 CTCTGTCTCACTGGCATTCCAGG - Intergenic
932511833 2:72300533-72300555 TTCTGTCTCGCTAGCGTTCCAGG + Intronic
932646815 2:73511198-73511220 TTCTGTCTTGCTGGCATTCCAGG + Intronic
932913859 2:75834119-75834141 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
933488314 2:82950556-82950578 TTCTGTCTCATTGGCATTCCAGG + Intergenic
935399409 2:102644443-102644465 TTCTCTCTTGCTGGCATTCCAGG - Intronic
935982791 2:108643645-108643667 TTCTGTCTTGTTGGCATTCCTGG - Intronic
936448355 2:112614903-112614925 TTCTGTCTCGCTGGCGTTCCAGG + Intergenic
936483536 2:112907181-112907203 TCCTGTCTCGGCAGCATTTCTGG - Intergenic
936640302 2:114304313-114304335 TTCTGTCTCACTGGCATTCCAGG + Intergenic
937000002 2:118457294-118457316 TTCTCTCTCACTGGCATTCCGGG + Intergenic
937143101 2:119618715-119618737 TTCTGTCTCACTGGCATTCTAGG - Intronic
937562692 2:123244890-123244912 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
937807257 2:126160901-126160923 TTCTGTGTTGCTGGCATTCCAGG - Intergenic
937893269 2:126956727-126956749 TTCTGTCTCACTGGCGTTCCAGG - Intergenic
938952346 2:136266751-136266773 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
939033239 2:137101518-137101540 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
939640877 2:144638681-144638703 TTCTGTCTCACTGGCATTCCAGG + Intergenic
939652777 2:144785406-144785428 TTCTGTCTCACTGGCATTCCAGG - Intergenic
939840582 2:147182637-147182659 TTCTGTCTTGCTCGCATTCCAGG - Intergenic
939876723 2:147586470-147586492 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
939937793 2:148313652-148313674 TTCTGTCTCATTGGCATTCCAGG + Intronic
939941972 2:148362115-148362137 TTCTGTCTTGCTGGCATTCCAGG - Intronic
940030582 2:149257661-149257683 TTCTGTCTCACTGACATTCCAGG + Intergenic
940114383 2:150192305-150192327 TTCTGTCTCACTGACATTCCAGG - Intergenic
940408120 2:153328817-153328839 TTCTGTCTTGCTGGCATTTCAGG + Intergenic
940547110 2:155102122-155102144 TTCTGCCTCTGTGGCTTTCCAGG + Intergenic
940757914 2:157704608-157704630 TTCTGTCTCACTGGCGTTCCAGG - Intergenic
940821373 2:158359803-158359825 TTCTGTCTCACTGGCATTCCAGG - Intronic
940925144 2:159356117-159356139 TTCTGTCTCGCTGGCACTCCAGG - Intronic
940964495 2:159822163-159822185 TTCTGTCTCACCGGCATTCCAGG - Intronic
941076345 2:161010417-161010439 TTCTGTCTCCTTGGCATTCCAGG - Intergenic
941115039 2:161462412-161462434 TTCTGTCTTGCTGGCGTTCCAGG + Intronic
941119561 2:161513316-161513338 TTCTGTCTTGCTGGCTTTCCAGG - Intronic
941565378 2:167099521-167099543 TTCTGTCTCTCTGGCATTCCAGG + Intronic
941571542 2:167176129-167176151 TTCTGTCTCGTTGGCATTCCAGG + Intronic
941845261 2:170126032-170126054 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
942010894 2:171761546-171761568 TTCTGTCTTACTGGCATTCCAGG + Intergenic
942121089 2:172778242-172778264 TTCTGTCTTGGGTTCTTTCCCGG + Intronic
942732565 2:179076032-179076054 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
942953724 2:181750550-181750572 TTCTGTCTCACTGGCATTCCAGG + Intergenic
943112371 2:183621967-183621989 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
943129938 2:183842003-183842025 TTCTGTCTCGTTGGTGTTCCAGG - Intergenic
943352495 2:186812216-186812238 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
943552516 2:189357726-189357748 TTCTGTCTCACTGGCATTCCAGG + Intergenic
944292006 2:198018360-198018382 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
944635383 2:201671196-201671218 TTCTGTCTTGCTGGTATTCCAGG - Intronic
945187511 2:207154576-207154598 TATTGTCTCTTGGGCATTCCAGG + Intronic
945207197 2:207344586-207344608 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
945409140 2:209488415-209488437 TTCTGTCTCACTGGCCTTCCAGG - Intronic
945486931 2:210407203-210407225 TTCTGTCTCACTGGCATTCCAGG + Intergenic
946065344 2:216982709-216982731 TTCTGTCTCACTGGCGTTCCAGG + Intergenic
946783330 2:223216001-223216023 ATCTGTTTCGGGTGCATTCAGGG - Intergenic
947225878 2:227839700-227839722 TTCTGTCTCACTGGCATTCCAGG + Intergenic
947492090 2:230603770-230603792 TTCTGTCTCACTGGCATTCCAGG - Intergenic
947868558 2:233419021-233419043 GTCTGTCTCTGGGGGCTTCCAGG + Intronic
1169320079 20:4625334-4625356 TTCTCTCTTGCTGGCATTCCAGG + Intergenic
1169397072 20:5241731-5241753 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1169984134 20:11423135-11423157 TTCTGTCTCAATGGCATTCCAGG + Intergenic
1170167930 20:13381087-13381109 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1170266411 20:14470935-14470957 TTCTGTCTTGCTGGCATTCGAGG + Intronic
1170294206 20:14806569-14806591 TTCAGTCTCACTGGCATTCCAGG - Intronic
1170720466 20:18873411-18873433 TTCTGTTTCACTGGCATTCCAGG + Intergenic
1171000823 20:21413963-21413985 TTCTGTCTCACTAGCATTCCAGG - Intergenic
1171209513 20:23306066-23306088 TTCTGTCTCTGCAGCATCCCAGG - Intergenic
1171410265 20:24942312-24942334 GTTTGTCTGGGGGGCATTTCTGG - Intergenic
1171441358 20:25166066-25166088 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1173318672 20:41968192-41968214 TGCTGTCTCGCTGGCATTCCAGG + Intergenic
1173751192 20:45478172-45478194 TTCTGTCTCACTGGCATTCCAGG + Intronic
1175303789 20:57961803-57961825 TCCTGTCTTGGGGTGATTCCAGG + Intergenic
1175549490 20:59808072-59808094 TTCTGTCTCAGGGGCATGACTGG - Intronic
1175686122 20:61030047-61030069 TTCTGTGTTGGGGGCCCTCCTGG - Intergenic
1175777678 20:61663450-61663472 CTCTGGGTCGGGGGCATTTCAGG + Intronic
1176891757 21:14327294-14327316 TTCTGTCTCGTTGGTGTTCCAGG - Intergenic
1177129640 21:17240600-17240622 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1177694549 21:24555019-24555041 TTCTGTCTCATTGGCGTTCCAGG - Intergenic
1178393534 21:32219605-32219627 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1178864477 21:36316687-36316709 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1180596206 22:16975137-16975159 TTCTGTCACTCTGGCATTCCAGG - Intronic
1180835820 22:18928868-18928890 TTCTTTCTCGGGAGCACTGCTGG + Intronic
1181636784 22:24178242-24178264 TCCTGCCCAGGGGGCATTCCAGG - Exonic
1182143810 22:27984487-27984509 TTGTGTCCTGTGGGCATTCCAGG - Intronic
1182204461 22:28609715-28609737 TTCTGTCTCACTGGCATTCCAGG - Intronic
1182521093 22:30884859-30884881 TGCTGATTCAGGGGCATTCCTGG + Intronic
1182881530 22:33738160-33738182 TTCTTACTCGGAGGGATTCCTGG - Intronic
1182952525 22:34390822-34390844 TTCTGTCTCGCTCGCATTCCAGG + Intergenic
1203285911 22_KI270734v1_random:154167-154189 TTCTTTCTCGGGAGCACTGCTGG + Intergenic
949175976 3:1063206-1063228 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
949423552 3:3891633-3891655 TTCTGTCTCACTGGCATTCCAGG + Intronic
949580635 3:5384287-5384309 TTCTGTTTCACTGGCATTCCAGG + Intergenic
949594620 3:5530986-5531008 TTCTCTCTTGCTGGCATTCCAGG + Intergenic
949683442 3:6541501-6541523 TTCTATCTCGCTGGCATTCCAGG + Intergenic
949801225 3:7906347-7906369 TTCTGTCTAGCTGGCATCCCCGG + Intergenic
949955024 3:9260278-9260300 TTCTATCTCTCTGGCATTCCAGG - Intronic
950597490 3:13997291-13997313 TTCTGTCTTGCTGGCATTCCAGG + Intronic
950992000 3:17449363-17449385 TTCTCTCTCTCTGGCATTCCAGG - Intronic
951237742 3:20254700-20254722 TTCTGTCTCACTGGCATTCCAGG + Intergenic
951254520 3:20433125-20433147 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
951687625 3:25362485-25362507 TTCTGTCTCGCTGGCATTCCAGG + Intronic
951777282 3:26324088-26324110 TTCTATCTCACTGGCATTCCAGG + Intergenic
953047206 3:39304657-39304679 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
953074034 3:39551335-39551357 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
953998160 3:47536383-47536405 TCCTGTCTCTGGGGCTTTGCAGG + Intergenic
954524920 3:51261541-51261563 TTCTGTCTCGCTGACATTCCAGG - Intronic
954531041 3:51320454-51320476 TTCTGTCTCACTGGCGTTCCAGG - Intronic
954950502 3:54468556-54468578 TTCTGTCTTGCTGGCATTCCAGG - Intronic
954978718 3:54723404-54723426 TTCTGTCTTGCTGGCATTCCAGG + Intronic
955175138 3:56606287-56606309 TTCTGTCTCACTGGCATTCCAGG + Intronic
955447778 3:59032327-59032349 TTCTGTCTCGCTGGCATTCCAGG - Intronic
956005786 3:64776917-64776939 TTCTGTCTTGCTGGCATTCTAGG - Intergenic
956243373 3:67154401-67154423 TTCTGTCTCACTGGCATTCCAGG - Intergenic
956300255 3:67764485-67764507 TTCTGTCTCACTGGCATTCCTGG + Intergenic
956383093 3:68686467-68686489 TTCTGTCTCACTGGCATTCCAGG + Intergenic
957256643 3:77845387-77845409 TTCTGTCTCTCTGGCATTCCAGG + Intergenic
958520944 3:95184764-95184786 TTCTGTCACCCTGGCATTCCAGG + Intergenic
958586219 3:96091319-96091341 ATCTGTCTTGCTGGCATTCCAGG - Intergenic
958622244 3:96576274-96576296 TTCTGTCTCACTGGCATTCCAGG + Intergenic
958694598 3:97511188-97511210 TTCTGTGTCACTGGCATTCCAGG + Intronic
959025623 3:101236845-101236867 TTCTATCTTGCTGGCATTCCAGG - Intronic
959120142 3:102223102-102223124 TTCTGTCTCGCTGGAGTTCCAGG + Intronic
959291863 3:104485077-104485099 TTCTGTCTCACTGGCATTCCCGG - Intergenic
959505886 3:107156134-107156156 TCCTGTCTCAGTGGGATTCCAGG - Intergenic
959734949 3:109648029-109648051 TTCTGTCTCTCTGGCATTCCAGG - Intergenic
959848050 3:111056787-111056809 TTCTGTCTCACAGGCATTCCAGG - Intergenic
959881228 3:111447117-111447139 TTCTGTCTCATTGTCATTCCAGG + Intronic
960177247 3:114532116-114532138 TTCTGTCTCACTGGCATTGCAGG - Intronic
960378152 3:116928297-116928319 TTCTATCTTGCTGGCATTCCAGG + Intronic
960763340 3:121097321-121097343 TTCTGTCTTGCTGGCATTCCAGG + Intronic
960773184 3:121217193-121217215 TTCTGTCTTGCTGGCATTCCAGG + Intronic
961977487 3:131042240-131042262 TTCTGTCTCGCTGGCATTCCAGG - Intronic
961998280 3:131269279-131269301 TTTTGTCTCGCTGGCATTCCAGG + Intronic
962634809 3:137319598-137319620 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
962765682 3:138560501-138560523 TTCTGTCTCACTGGCATTCCAGG - Intronic
963013994 3:140803297-140803319 TTCTGTCTCATTGGCATTCCAGG + Intergenic
963980204 3:151528832-151528854 TTCTGTCTCACTAGCATTCCAGG - Intergenic
964053069 3:152419741-152419763 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
964053270 3:152421292-152421314 TTCTGTCTTGATGGCATTCTGGG - Intronic
964371394 3:156004098-156004120 TTCTTTCTCCCTGGCATTCCAGG + Intergenic
964374605 3:156036792-156036814 TTCTGTCTTTGGGGCATTTGTGG + Intergenic
964649126 3:158991572-158991594 GTCTGTCTCGCTGGCCTTCCAGG + Intronic
965025475 3:163296896-163296918 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
965091092 3:164163423-164163445 TTCTGTCTCACTGGCATTCCAGG + Intergenic
965618755 3:170621666-170621688 TTCTGTCTCACTGGCATTCCTGG + Intronic
965655072 3:170975290-170975312 TTCTGTCTCCTTGGCATTCCAGG + Intergenic
965880427 3:173382279-173382301 TTCTCTCTCGCTGGCATTCCAGG - Intergenic
966291168 3:178361237-178361259 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
966637945 3:182156718-182156740 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
967181530 3:186909548-186909570 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
967343569 3:188427923-188427945 TTCTGTCTCCCTGGCATTCCAGG + Intronic
967562692 3:190935031-190935053 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
967638578 3:191834583-191834605 TTCTGTCTCACAGGCATTCCAGG - Intergenic
968829137 4:2923149-2923171 TTCTGTCTTGCTGGCATTCCAGG + Intronic
968908390 4:3464703-3464725 TGCTGTCCCGGGTGCCTTCCTGG - Intronic
970144812 4:13024336-13024358 TTCTGACTATGGGGCATCCCTGG - Intergenic
970304694 4:14719071-14719093 TTCTGTCTCACTGGCATTCCAGG - Intergenic
970309711 4:14769375-14769397 TTGTGTCTCGGGTGCATACTTGG + Intergenic
970685221 4:18559545-18559567 TTCTGTCTCCCTGGCATTCCAGG - Intergenic
970727151 4:19060278-19060300 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
970784490 4:19780092-19780114 TTCTGTCTCAGTGGTGTTCCAGG + Intergenic
971430090 4:26556532-26556554 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
971673634 4:29595687-29595709 TTCTGTCTCTCTGGCATTCCAGG + Intergenic
972743306 4:41909519-41909541 TTGTGTCTGGCTGGCATTCCAGG + Intergenic
972755537 4:42042188-42042210 TTCTGTCTCACTGGCATTCGAGG - Intronic
972962713 4:44473840-44473862 TTCTGTCTCACTGGCATTCCAGG - Intergenic
973567997 4:52207723-52207745 TTCTGTCTCACTGGCTTTCCAGG - Intergenic
973660870 4:53105315-53105337 CTCTGTCTCGGTGGTATTCCAGG - Intronic
973715251 4:53669828-53669850 TTCTGTCTTGCTGGCTTTCCAGG + Intronic
973798365 4:54451328-54451350 TTCTGTCTCACTGGCATTCCAGG - Intergenic
974326332 4:60419372-60419394 TTCTGTCTTGCTGGCATTTCAGG + Intergenic
974491655 4:62571925-62571947 TTCTGTCTCACTGGCATTCCAGG + Intergenic
974792971 4:66714024-66714046 TTCTGTCTCACTGGCATTCCAGG - Intergenic
974813931 4:66981873-66981895 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
974851811 4:67412749-67412771 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
975149447 4:71004993-71005015 TTCTGTCTCGCTGGCATTCCAGG + Intronic
975227488 4:71891539-71891561 TTCTGTCTCACTGGGATTCCAGG - Intergenic
975307576 4:72866916-72866938 TTCTTTCTCGCTGGCATTCCAGG - Intergenic
975533084 4:75420943-75420965 TTCTGTCTCACTGGCATTTCAGG + Intergenic
975638757 4:76478106-76478128 TTCTGTCTTGCTGGCATTCTAGG - Intronic
976006769 4:80439672-80439694 TTCTGTCTCACTGGCATTCCAGG - Intronic
976065528 4:81183622-81183644 TTCTGTCTTTCTGGCATTCCAGG - Intronic
976092687 4:81473804-81473826 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
976114827 4:81715374-81715396 TTCTGTCTCGCTGGTATCCCAGG - Intronic
976438261 4:85043774-85043796 TTCTCTCTTGCTGGCATTCCAGG - Intergenic
976439254 4:85054927-85054949 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
976534364 4:86193767-86193789 TTCTGTCTCGCTGGTGTTCCAGG + Intronic
976655950 4:87489101-87489123 TTCTGTCTTGCTGGCATTCCAGG + Intronic
976669476 4:87636346-87636368 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
976715910 4:88122294-88122316 TTTTGTCGCGCTGGCATTCCAGG - Intronic
976861473 4:89671555-89671577 TTCTGTCTCACTGGCATTCCAGG - Intergenic
976903546 4:90208515-90208537 TTTTGTCTCGGTGGCATTCCAGG + Intronic
977046880 4:92079114-92079136 TTCTGACTCACTGGCATTCCAGG - Intergenic
977185683 4:93932810-93932832 TTCTTTCTTGCTGGCATTCCAGG + Intergenic
977467789 4:97403369-97403391 TTCTGTCTCTCTGGCATTCCTGG + Intronic
977632999 4:99263823-99263845 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
977897845 4:102384335-102384357 TTCTGTCTCGCTGGGGTTCCAGG + Intronic
978078910 4:104568162-104568184 TTCTGTCTCACTGGCGTTCCAGG + Intergenic
978179562 4:105776349-105776371 TTTTGTCTCGCTGGCATTCCAGG + Intronic
978236941 4:106471574-106471596 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
978601449 4:110432177-110432199 TTCTGTCTCACTGGCATTCCAGG + Intronic
978664267 4:111164157-111164179 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
978770602 4:112452551-112452573 TTCTGTCTGGGGGAGATTCTGGG - Intergenic
978845593 4:113269286-113269308 TTCTGTCTCACTGGCGTTCCAGG + Intronic
978906662 4:114013179-114013201 TTCTGTCTCACTGGCATTCCAGG + Intergenic
979457565 4:120944196-120944218 TTCTGTCTCACTGGAATTCCAGG - Intergenic
979668308 4:123336696-123336718 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
979998741 4:127464165-127464187 TTCTGTCTCTCTGGCGTTCCAGG + Intergenic
980100345 4:128535879-128535901 TTCTGTCTCGCTAGCATTCCAGG + Intergenic
980151694 4:129055784-129055806 TTCTGTCTCGCTGGGGTTCCAGG + Intronic
980330417 4:131403596-131403618 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
980583672 4:134786617-134786639 TTCTGTCTCATTGGCATTCCAGG + Intergenic
980733261 4:136848970-136848992 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
981273144 4:142867849-142867871 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
981411229 4:144435057-144435079 TTCTGTCTAACTGGCATTCCAGG - Intergenic
981629666 4:146804363-146804385 TTCTGTCTTGCTTGCATTCCAGG - Intronic
981662489 4:147184012-147184034 TTCTGTCTTGCTGGCATTTCAGG - Intergenic
981671518 4:147292600-147292622 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
981788011 4:148502890-148502912 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
981794974 4:148585608-148585630 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
981846490 4:149175978-149176000 TTCTGTCTTGCTGGCATTCTAGG - Intergenic
981939904 4:150271344-150271366 TTCTGTCTCGCTGGCATTCCAGG - Intronic
982060302 4:151598041-151598063 TTCTGTCTCACTGGCCTTCCAGG + Intronic
982298988 4:153859742-153859764 TTCTGTCTCGCTAGCATTCCAGG + Intergenic
982323846 4:154108910-154108932 TTCTGTCTCGCTGGTATTCCAGG - Intergenic
982725636 4:158902996-158903018 TTCTGTCTCGCTAGCATTCCGGG + Intronic
982733387 4:158979830-158979852 TTCTGTCTCACTGGCATTCCAGG - Intronic
982794565 4:159629729-159629751 TTCTGTCTTGCTGGTATTCCAGG + Intergenic
982825706 4:160001782-160001804 TTCTGTCTCACTGGCATTCCAGG - Intergenic
982909254 4:161118258-161118280 TTCTGTCTCACTGGCATTTCAGG + Intergenic
983299058 4:165902255-165902277 TTCTGTCTCACTGGCGTTCCAGG + Intronic
983543258 4:168935391-168935413 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
983596337 4:169472123-169472145 TTCTGTCTTGCTGGCATTCCAGG + Intronic
983788034 4:171759255-171759277 TTCTGTCTCACTGGCATTCCAGG - Intergenic
983840829 4:172455337-172455359 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
983949481 4:173622565-173622587 TTCTGCCTCCCTGGCATTCCAGG + Intergenic
983958835 4:173727959-173727981 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
984269859 4:177537122-177537144 TTCCGTCTCCCTGGCATTCCAGG + Intergenic
984367147 4:178813716-178813738 TTCTGTCAGGGAGGCATTTCAGG - Intergenic
984618611 4:181927140-181927162 TTCCGTCTCGCTTGCATTCCAGG - Intergenic
984902918 4:184600809-184600831 CTCTGTCTCGCTGGCACTCCAGG - Intergenic
985853886 5:2410353-2410375 TTCTGTCTCTGGGCCGATCCTGG + Intergenic
986006046 5:3669924-3669946 TTCTGTGTCAGTAGCATTCCAGG + Intergenic
986110325 5:4709769-4709791 TTCTGTCTTGCTGGCATTTCAGG - Intergenic
986378860 5:7162815-7162837 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
986664947 5:10093717-10093739 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
986675161 5:10177819-10177841 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
986676822 5:10193138-10193160 TTCTGCCTCAGGTGCCTTCCTGG + Intergenic
986729257 5:10623247-10623269 TTCTATCTGTGGGGCATTGCCGG + Intronic
986879559 5:12153630-12153652 TTCTATCTCACTGGCATTCCAGG - Intergenic
986920553 5:12674278-12674300 TTCTGTCTTGCTGGCATTTCAGG + Intergenic
987019229 5:13852498-13852520 TTCTGCCTCAGTGGCATCCCAGG - Intronic
987528232 5:19080684-19080706 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
987656508 5:20814760-20814782 TTCTGTATTGCTGGCATTCCAGG - Intergenic
987704647 5:21447029-21447051 TTCTGTCTCGCTGGCATTTCAGG + Intergenic
987924111 5:24317980-24318002 TTCTGTCTCACTGGCATTCCAGG + Intergenic
988618184 5:32795139-32795161 TTTTGTCTTGCTGGCATTCCAGG - Intergenic
988719179 5:33859137-33859159 TTCTTTCTTGCTGGCATTCCAGG - Intronic
988867731 5:35354053-35354075 CTCTGTCTTGCTGGCATTCCAGG + Intergenic
989084112 5:37657007-37657029 TTCTGTCTCGCTGGCATTCCAGG + Intronic
989320742 5:40131063-40131085 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
989687655 5:44108546-44108568 TTCTGTCTTCCTGGCATTCCAGG + Intergenic
989958852 5:50387164-50387186 TTCTGTCTCGCTGGATTTCCAGG - Intergenic
990183797 5:53191346-53191368 TTCGGTCTCATTGGCATTCCAGG + Intergenic
990351296 5:54919232-54919254 TTTTGTCTTGCTGGCATTCCAGG - Intergenic
990673912 5:58162332-58162354 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
990745886 5:58959099-58959121 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
990837777 5:60041935-60041957 TTCTGTCTCACTGGCCTTCCAGG - Intronic
990897621 5:60715927-60715949 TTCTGTCTCACTGGCTTTCCAGG + Intergenic
991110772 5:62896847-62896869 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
991161346 5:63507390-63507412 TTCTGTCTCACTGGCATTCCAGG - Intergenic
991223543 5:64243218-64243240 TTCTGTCTCACTGGCATTCCAGG - Intronic
991236675 5:64407100-64407122 TTCTGTCCTGCTGGCATTCCAGG - Intergenic
991242306 5:64474180-64474202 TTCTGTCTCACTGGCATTCCAGG - Intergenic
991283262 5:64940128-64940150 TTCTGTCTCACTGGCATTCCAGG + Intronic
991934736 5:71790228-71790250 TTCTGTCTCGCTGGCGTTCCAGG - Intergenic
992038907 5:72809040-72809062 TTCTGTCTTGCTGGCGTTCCAGG + Intergenic
992077832 5:73207198-73207220 TTCTGTCTCACTGGCATTCCAGG - Intergenic
992254910 5:74911778-74911800 TTCTGTCTCACTGGCATTCCAGG + Intergenic
992287257 5:75248273-75248295 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
992292456 5:75293254-75293276 TTCTGTCTTGCTGGCATTTCAGG + Intergenic
992976930 5:82130355-82130377 TTCTGTCTCGCTGGCGTTCCAGG + Intronic
993145277 5:84086174-84086196 TTCTGTCTCACTGGGATTCCAGG + Intronic
993255749 5:85588238-85588260 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
993265444 5:85721434-85721456 TTCTGTCTCGCTGGCATTTCAGG - Intergenic
993381885 5:87217880-87217902 TTCTGTCTCGCTGGCATTCTAGG + Intergenic
993541598 5:89159308-89159330 TTCTGTCTCACTGGCATTCCAGG - Intergenic
993608516 5:90025176-90025198 TTCTATTTAGGTGGCATTCCAGG - Intergenic
993608993 5:90031638-90031660 TTCTGCCTAGCTGGCATTCCAGG - Intergenic
993673926 5:90795127-90795149 TTCTGTCTCGCTGGCATTCCAGG - Intronic
993757654 5:91751224-91751246 TTCTGTCTCACTGGCATTCCAGG + Intergenic
993911521 5:93690182-93690204 TTTTGTCTCACTGGCATTCCAGG - Intronic
994015016 5:94955395-94955417 TTCTGTTTCACTGGCATTCCAGG - Intronic
994142888 5:96361342-96361364 TTCTGTTTCGCTGGCATTCCAGG + Intergenic
994609496 5:102018695-102018717 TTCTGTCTTGCCGGCATTCCAGG - Intergenic
995108173 5:108398910-108398932 TTCTGTGTCACTGGCATTCCAGG - Intergenic
995111828 5:108437391-108437413 TTTTGTCTCGCTGGCATTCCAGG - Intergenic
995162532 5:108998146-108998168 TTCTGTCTTGCTGGCGTTCCAGG + Intronic
995398732 5:111717201-111717223 TTCTGTCTTGCTGGCATTCCAGG + Intronic
995612337 5:113923733-113923755 TTCTGTCTCACTGGCATTCCAGG - Intergenic
995620585 5:114021379-114021401 TTCTGTCTCACTGGTATTCCAGG - Intergenic
995695711 5:114876349-114876371 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
995808531 5:116080307-116080329 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
996129912 5:119769657-119769679 TTCTGTCTCGTTGACATTCCAGG - Intergenic
996270749 5:121602181-121602203 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
996987525 5:129584908-129584930 TTCTGTCTTGCTGGTATTCCAGG + Intronic
997004856 5:129805120-129805142 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
997216614 5:132116889-132116911 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
998322593 5:141246648-141246670 TTCTGTCTCTGGAGAATTCTCGG - Exonic
998543368 5:143004496-143004518 TTCTGTCTAGAAGGCATCCCGGG - Intronic
998691653 5:144594752-144594774 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
998780180 5:145647533-145647555 TTCTGTCTCACTGGCATTCCAGG + Intronic
998972817 5:147611195-147611217 TTGTGTCTTGATGGCATTCCAGG + Intronic
999489863 5:152039309-152039331 TTCTGTCTCTCTGGCATTCCAGG + Intergenic
999602563 5:153283028-153283050 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
999688291 5:154122284-154122306 TTCTGTCTCACTGGCGTTCCAGG - Intronic
1000194801 5:158947198-158947220 TTCTGTCTCACTGGCATTCCAGG + Intronic
1000376149 5:160584040-160584062 TTCTATCTCTTTGGCATTCCAGG + Intronic
1000406454 5:160893176-160893198 TTCTGTCTCACGGGCATTCCAGG - Intergenic
1000417506 5:160998254-160998276 TTCTGTCTCACTGGCTTTCCAGG + Intergenic
1000548036 5:162625837-162625859 TTCTGTCTCGCTGGAGTTCCAGG - Intergenic
1001362699 5:171103612-171103634 TTCTGTCTCACTGGCGTTCCAGG + Intronic
1001952413 5:175825527-175825549 TTCTGTCTCTGGGGATCTCCTGG + Intronic
1002083296 5:176750232-176750254 TTCTGTCTGGGGGCCATCTCAGG + Intergenic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1002673504 5:180889828-180889850 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1002677137 5:180926451-180926473 TTCTGTCTCGCTGCCATTCCAGG - Intronic
1004593195 6:17073579-17073601 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
1005208575 6:23432831-23432853 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1005778390 6:29162041-29162063 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
1006116690 6:31779510-31779532 TTCTGCCTCGGGGTCCTTCCAGG + Exonic
1006198407 6:32263306-32263328 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
1007662988 6:43497774-43497796 TTCTCCCTGGGGGGCCTTCCAGG + Intronic
1007858106 6:44879054-44879076 TTCTGTCTCACTGGCATTCCAGG - Intronic
1008425247 6:51349318-51349340 TTTTGTCTTGCTGGCATTCCAGG + Intergenic
1008575498 6:52856564-52856586 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1008719117 6:54327583-54327605 TTCTGTCTCACTGGCATTCCAGG - Intronic
1008782757 6:55127080-55127102 TTCTGTCTCGCTGACATTCCAGG + Intronic
1008785086 6:55158434-55158456 TTCTGTCTCACTGGCATTCCAGG - Intronic
1008865394 6:56204113-56204135 TTCTGTCTCGCTGGCGTTCCAGG - Intronic
1009290068 6:61870006-61870028 TTCTGTCTCACTGGCATTCCAGG - Intronic
1009305931 6:62089232-62089254 TTCTGTCTGGCTGGCATTTCAGG + Intronic
1009336030 6:62492149-62492171 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1009455237 6:63848812-63848834 TTCTGTCTCGCTGGGGTTCCAGG - Intronic
1009492685 6:64312008-64312030 TTCCTTCTCGCCGGCATTCCAGG - Intronic
1009777136 6:68218966-68218988 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1009880481 6:69560598-69560620 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1009945392 6:70336637-70336659 TTCTGTCTTGTTGGCATTCCAGG + Intergenic
1009959542 6:70501505-70501527 TTCTGTCTCGCTGGGGTTCCAGG + Intronic
1010039183 6:71361332-71361354 TTCTGTCTTGCTGGCGTTCCAGG + Intergenic
1010276311 6:73972234-73972256 TTCTATCTCGCTGGCATTCCAGG - Intergenic
1010459440 6:76097675-76097697 TTCTATCTTGCTGGCATTCCAGG - Intergenic
1010574918 6:77518640-77518662 TTCTCTCTTGCTGGCATTCCAGG - Intergenic
1010668339 6:78655838-78655860 TTCTGTCTCGCTGGGATTCCAGG + Intergenic
1010822716 6:80433673-80433695 TTCTGTCTCATTGGCATTCCAGG + Intergenic
1010936555 6:81869723-81869745 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1010993978 6:82512408-82512430 TTCTGTCTCGTTGGTGTTCCAGG - Intergenic
1011020731 6:82809504-82809526 TTCTGTATTGCTGGCATTCCAGG + Intergenic
1011065473 6:83321285-83321307 TTCTGTCTCGCTGGCATTCTAGG - Intronic
1011174073 6:84540950-84540972 TTCTGTCTCCCTGGCATTCCAGG - Intergenic
1011302673 6:85892644-85892666 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1011333635 6:86236644-86236666 TTCTGCCTCACTGGCATTCCAGG - Intergenic
1011766239 6:90623240-90623262 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1011767355 6:90637091-90637113 TTCTTTTTCGGGGGCATTGGAGG + Intergenic
1011776813 6:90739750-90739772 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1012043381 6:94238811-94238833 TTCTGTATCACTGGCATTCCAGG - Intergenic
1012127964 6:95454260-95454282 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1012207501 6:96478907-96478929 TTCTGTCTCACTGGTATTCCAGG + Intergenic
1012644432 6:101661486-101661508 TTCTGTCTTGCTGGCATTGCAGG + Intronic
1012674735 6:102100882-102100904 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
1013390207 6:109679085-109679107 TTCTGTCTCGCTGGCGTTCCAGG - Intronic
1013452964 6:110303293-110303315 TTCTCTCTTGCTGGCATTCCAGG - Intronic
1013672594 6:112421510-112421532 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1013956885 6:115852430-115852452 TTGTGTCTTGCTGGCATTCCAGG - Intergenic
1013964179 6:115935477-115935499 TTCTGCCTTGCTGGCATTCCAGG - Exonic
1014122849 6:117746155-117746177 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1014223576 6:118823118-118823140 TTCTGTCTCGCTGGGGTTCCAGG + Intronic
1014278810 6:119418071-119418093 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1014352699 6:120363756-120363778 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1014387096 6:120816205-120816227 TTGTGTCTGGCTGGCATTCCAGG + Intergenic
1014413448 6:121154003-121154025 TTCTGTCTTGATGGCATTCCAGG + Intronic
1014466297 6:121760631-121760653 GTCTGTCTTGCTGGCATTCCAGG - Intergenic
1014527852 6:122522393-122522415 TTTTGTCTCACAGGCATTCCAGG + Intronic
1014569015 6:122986319-122986341 TTGTGTCTCACTGGCATTCCAGG - Intergenic
1014922402 6:127228617-127228639 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1014968188 6:127782309-127782331 TTCTGTCTCACTGGCATTCCAGG + Intronic
1015211288 6:130701748-130701770 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1015386946 6:132635254-132635276 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1015500735 6:133930815-133930837 TTCTGTCTCACTGGCATTCTAGG - Intergenic
1015717378 6:136206604-136206626 TTTTGTCAAGGGGGCATTTCTGG - Intergenic
1015802045 6:137070262-137070284 TTCTGTCTCACTGGCGTTCCAGG - Intergenic
1015883309 6:137891405-137891427 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1016111442 6:140230263-140230285 TTCTGTCTCGCTGGCCTTCCAGG - Intergenic
1016590853 6:145742047-145742069 TTGTGTCTCGCTGGCATTCCAGG - Intergenic
1016717523 6:147251419-147251441 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1017197437 6:151716842-151716864 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1017322596 6:153111071-153111093 TTCTGTCTCACTGGCATTCCAGG - Intronic
1018108684 6:160513817-160513839 TTCTGTCTCACTGGCATCCCAGG - Intergenic
1018114663 6:160571886-160571908 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1018824920 6:167401813-167401835 CTCTGTCCCGGGGACATGCCAGG + Intergenic
1019071929 6:169353866-169353888 TTCTGTCTTGCTGGCTTTCCAGG + Intergenic
1019203704 6:170341506-170341528 TTCTGTCTCGCAGGGATTCCAGG + Intronic
1020428610 7:8096355-8096377 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1020629722 7:10625496-10625518 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1020635948 7:10696012-10696034 TTCTGTCTCACTGGCGTTCCAGG - Intergenic
1020693851 7:11391625-11391647 TTCTGTCCTGCTGGCATTCCAGG + Intronic
1020716031 7:11675393-11675415 TTCTGTCTCGCTAGCATTCCAGG - Intronic
1020753443 7:12170869-12170891 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1020884324 7:13803536-13803558 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1020935465 7:14458831-14458853 TTCTGTCTTGCTGGTATTCCAGG - Intronic
1021014634 7:15517800-15517822 TTCTGTCTCACTGGTATTCCAGG - Intronic
1021099497 7:16571824-16571846 TTCTGTCTCTCTGGCATTCCAGG - Intronic
1021167043 7:17354455-17354477 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
1021207825 7:17807084-17807106 TTCTGTGTCGGTGGCATTCCAGG - Intronic
1021224588 7:18012849-18012871 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1021322285 7:19227030-19227052 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
1021749380 7:23779848-23779870 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1021831701 7:24618713-24618735 TTCTGACTCTGGGCCATTCCAGG + Intronic
1022848491 7:34235647-34235669 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1024097022 7:45990316-45990338 TTCTGTCCCCAGGGCACTCCTGG + Intergenic
1024152946 7:46591157-46591179 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1024495415 7:50040786-50040808 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
1025637962 7:63340138-63340160 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
1025644734 7:63407961-63407983 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
1027843325 7:83341753-83341775 TTCTGTCTCACTGGCATTCTAGG - Intergenic
1028326993 7:89540089-89540111 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1028429991 7:90735836-90735858 TTCTGTCTCCCTGGCATTCCAGG + Intronic
1028476360 7:91257887-91257909 TTCTGTCTTGTTGGCATTCTAGG + Intergenic
1028801438 7:94970158-94970180 TTCTGTCTCACAGGCATTCCAGG + Intronic
1029324792 7:99796735-99796757 TTCTGTCTCACTGGCGTTCCAGG + Intergenic
1030141062 7:106304478-106304500 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1030159380 7:106491736-106491758 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1030325875 7:108217930-108217952 TTCTGTCTCACTGGCGTTCCAGG + Intronic
1030612663 7:111706214-111706236 TTCTGTCTCGCTGGTGTTCCGGG + Intergenic
1031031808 7:116743356-116743378 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1031717319 7:125125229-125125251 TTCTGTCTCGCTGCCGTTCCAGG + Intergenic
1031902746 7:127428759-127428781 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1032295959 7:130638739-130638761 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1032312608 7:130802513-130802535 TTCTGTCTCGATGGTGTTCCAGG + Intergenic
1032659786 7:133970356-133970378 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1032883548 7:136115140-136115162 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1032957147 7:136984451-136984473 TTCTGTCTCGCTGGCGTTCCAGG + Intronic
1032966421 7:137103518-137103540 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
1033619219 7:143047534-143047556 TTCTGTCTCCTGGGCTTCCCAGG - Intergenic
1034370805 7:150594754-150594776 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1034715138 7:153235007-153235029 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1035998348 8:4574134-4574156 TTCTGTCTCGTTGGGGTTCCAGG + Intronic
1036553748 8:9838796-9838818 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1037258314 8:16979829-16979851 TTCTGTCTTGCTAGCATTCCAGG + Intergenic
1037285506 8:17294464-17294486 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1037388199 8:18365281-18365303 TTCTATCTTGGGGGCATGCAAGG - Intergenic
1037719619 8:21431483-21431505 TTCTGTCTTGCTGGCATTCTAGG - Intergenic
1038211548 8:25523170-25523192 TTCTATCTCGCTGGCATTCCAGG - Intergenic
1038936479 8:32257296-32257318 TTCTGTCTCACTGGCATTCCAGG + Intronic
1039133825 8:34297702-34297724 TTCTGTCTCGCTGGAGTTCCAGG - Intergenic
1040354980 8:46608566-46608588 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1040736527 8:50515431-50515453 TTCTGTCTCATTGGCATTCCAGG - Intronic
1040779868 8:51095101-51095123 TTCTGTCTCTTTGGCATTCCAGG - Intergenic
1040968839 8:53112495-53112517 TTCTGTCTTGCTGGAATTCCAGG + Intergenic
1041050782 8:53932257-53932279 TTCTGTCTCGCTGGCATTCCAGG - Intronic
1041102783 8:54413321-54413343 TTCTCTCTCTGAGGCATTCCAGG + Intergenic
1041155031 8:54977016-54977038 TTCTGTCTCCCTGGCATTCCAGG - Intergenic
1041323334 8:56637327-56637349 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1041423537 8:57695323-57695345 TTCTGTCTCACTGGCGTTCCAGG - Intergenic
1041459773 8:58098555-58098577 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1041583985 8:59495100-59495122 TTCTGTCTTTCAGGCATTCCAGG + Intergenic
1041666290 8:60448196-60448218 TTTTGTCTTGCTGGCATTCCAGG - Intergenic
1041836606 8:62223554-62223576 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1042110892 8:65380065-65380087 TTCTGTGTCGCTGGCATTCCAGG - Intergenic
1042327199 8:67541052-67541074 TTCTGTCTCACTGGCATTCCAGG + Intronic
1042812936 8:72845951-72845973 TTCTGTCTTTCTGGCATTCCAGG + Intronic
1042969334 8:74391190-74391212 TTCGGTCTCGCTGGCATTCCAGG + Intronic
1043118180 8:76286565-76286587 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
1043253696 8:78106604-78106626 TTCTGTCTCACTGGGATTCCAGG + Intergenic
1043366348 8:79537451-79537473 TTCTGTCTTGCTGGCCTTCCAGG + Intergenic
1043647270 8:82536378-82536400 TTCTGTCTCGCTGGCTTTCTAGG + Intergenic
1043703585 8:83321914-83321936 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
1044503535 8:92990881-92990903 TTCTGTCTCGCTGTCATTCCAGG - Intronic
1044509504 8:93058475-93058497 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1044940284 8:97335151-97335173 TTCTGTCTCACTGGCTTTCCAGG + Intergenic
1045185211 8:99830611-99830633 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1045199637 8:99967360-99967382 TTCTGTCTCGCTGGGGTTCCAGG - Intronic
1045212082 8:100108798-100108820 TTCTGTCTCACTGGCGTTCCAGG - Intronic
1045618876 8:103951731-103951753 TTCTGTCTTGCTGGCATTCTGGG - Intronic
1045783650 8:105897102-105897124 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1045883223 8:107065196-107065218 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1045973310 8:108103912-108103934 CTCTGTCTCGCTGGCATTCCAGG - Intergenic
1046048001 8:108986570-108986592 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1046068018 8:109219021-109219043 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1046106465 8:109672660-109672682 TTCTGTCTCGCTGGCATTCCAGG - Intronic
1046947501 8:119988029-119988051 TTCTGTCTCGCTGGTGTTCCAGG + Intronic
1046972572 8:120238619-120238641 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1047121270 8:121908049-121908071 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
1047133654 8:122051500-122051522 TTTTGTCTCACTGGCATTCCAGG - Intergenic
1048914155 8:139165685-139165707 TTCTGTCTCACTGGCATTCAAGG + Intergenic
1049872401 8:144990824-144990846 TTCTGTCTCACTGGGATTCCAGG + Intergenic
1049964570 9:766874-766896 TTCTGTCTCGCTGGGGTTCCGGG - Intergenic
1050031732 9:1393505-1393527 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
1050391918 9:5153170-5153192 TTCTGTCTCACTGACATTCCAGG - Intronic
1050404459 9:5293205-5293227 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1050852025 9:10300390-10300412 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1050943180 9:11485775-11485797 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1051199405 9:14599582-14599604 TTCTGTCTTGCTGACATTCCAGG - Intergenic
1051353889 9:16223507-16223529 TTCTGTCTTGCTGGCCTTCCAGG - Intronic
1051695841 9:19767305-19767327 TTTTGTCTCACTGGCATTCCAGG + Intronic
1051998434 9:23247861-23247883 GTCTGTCTTGCTGGCATTCCAGG - Intergenic
1052241341 9:26277533-26277555 TTCTGTCTCACTGGCATTTCAGG - Intergenic
1052281246 9:26735585-26735607 TTCTTTCTCACTGGCATTCCAGG + Intergenic
1052329350 9:27251625-27251647 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1052366231 9:27614945-27614967 TTCTGTCTCACTGGCGTTCCAGG + Intergenic
1052371852 9:27674483-27674505 TTCTGTCTCTCGGTCATTACAGG + Intergenic
1052382359 9:27785196-27785218 TTCTGTCTTACTGGCATTCCAGG + Intergenic
1052668036 9:31519377-31519399 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1052752716 9:32508729-32508751 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1052799084 9:32950817-32950839 TTCTGTCTCCTGCGCATACCTGG + Intergenic
1053314070 9:37037118-37037140 TTCTGTCCTGGGGACATTTCCGG - Intergenic
1055125744 9:72716774-72716796 TTCTGTCTCACTGACATTCCAGG + Intronic
1055239199 9:74163624-74163646 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1055386858 9:75771888-75771910 TTCTGTCTCACTGGTATTCCAGG + Intergenic
1055390976 9:75821755-75821777 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1055494550 9:76841446-76841468 TTCTGTCTCACTGGCGTTCCAGG - Intronic
1055628729 9:78201077-78201099 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1055823917 9:80301292-80301314 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
1056176810 9:84044076-84044098 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1056320881 9:85433521-85433543 TTCTGTCTTGCTGGCGTTCCAGG - Intergenic
1056997807 9:91479657-91479679 TTCTGTCTTGCTGGCGTTCCAGG + Intergenic
1057460288 9:95254706-95254728 TTCTGTCTCGCTGGTGTTCCAGG - Intronic
1058182484 9:101815645-101815667 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1058393154 9:104520299-104520321 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1059275339 9:113091525-113091547 TCCTGTCTAGTGGGCAATCCAGG + Intergenic
1059513324 9:114869835-114869857 TTCTGTCTTGCTGCCATTCCAGG - Intergenic
1062079161 9:134611319-134611341 TTCTGTGTTGGTGGCTTTCCAGG + Intergenic
1062297579 9:135840977-135840999 TTCTGCCTCGCTGGCGTTCCAGG - Intronic
1186181345 X:6976211-6976233 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1186370046 X:8937403-8937425 TTCTGTCTCACTGGCGTTCCAGG + Intergenic
1186773338 X:12839369-12839391 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
1186960977 X:14736246-14736268 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1187660819 X:21545016-21545038 TTCTGTCTCGCTGGCATTCCAGG - Intronic
1187784288 X:22866809-22866831 TTTTGTCTTGCTGGCATTCCAGG - Intergenic
1188130045 X:26419776-26419798 TTCTGTCTCACTGTCATTCCAGG + Intergenic
1188193186 X:27197114-27197136 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1188534939 X:31186301-31186323 TTCTGGCTCCGGAGTATTCCAGG - Intronic
1188664608 X:32804105-32804127 TTCTGTCTCGCTGGCGTTCCAGG - Intronic
1188893321 X:35636374-35636396 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1188921951 X:35987619-35987641 TTCTGTCTCACTGGCATTCCAGG + Intronic
1189189607 X:39088934-39088956 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1189210836 X:39280715-39280737 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1189243326 X:39542295-39542317 TTCTCTCTTGCTGGCATTCCAGG - Intergenic
1189575139 X:42343382-42343404 TTCTGTCTGGCTGGCATTCCAGG + Intergenic
1189590619 X:42507161-42507183 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1190341491 X:49300022-49300044 TTCTGTCTTGCTGGCATTCCAGG + Intronic
1190495116 X:51021077-51021099 TTCTTTCTCGCTGGCATTCCAGG + Intergenic
1190505846 X:51125355-51125377 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1190959790 X:55234832-55234854 TTCTGTCTCGCTGGTGTTCCAGG + Intronic
1191005046 X:55702551-55702573 TTCTGTCTCACTGGCATTCCTGG - Intergenic
1191088741 X:56597677-56597699 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1191099002 X:56704943-56704965 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1191138883 X:57094774-57094796 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1191172125 X:57458950-57458972 TTCTGTCTTGGTGGAGTTCCAGG - Intronic
1191206691 X:57842211-57842233 TTCTGTCTCACTGTCATTCCAGG - Intergenic
1191222320 X:58002874-58002896 TTCTCTCTCTCTGGCATTCCAGG - Intergenic
1191601804 X:63016919-63016941 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1191631924 X:63331155-63331177 TTCTGTCTCACTGGCGTTCCAGG - Intergenic
1191676607 X:63797908-63797930 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1191705092 X:64085816-64085838 TTCTGTCTTGCTGGAATTCCAGG - Intergenic
1191762634 X:64662115-64662137 TTCTGTCTCATTGGCATTACAGG + Intergenic
1191793748 X:64999570-64999592 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1191795625 X:65018663-65018685 TTCTGTCTCGCTGGCATTCCAGG - Intronic
1191799949 X:65067151-65067173 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
1191824820 X:65353592-65353614 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1192064304 X:67864748-67864770 TTCTTTCTCACTGGCATTCCAGG + Intergenic
1192228431 X:69246036-69246058 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1192524522 X:71830094-71830116 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1192598526 X:72437470-72437492 TTCTGTCTTGCTGGCATTCCAGG - Intronic
1192674564 X:73182514-73182536 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1192692097 X:73374815-73374837 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
1192712641 X:73607493-73607515 TTCTATCTCGCTGACATTCCAGG + Intronic
1192748886 X:73966949-73966971 TCCTGTCTCTGGGGGATTCAAGG + Intergenic
1192755845 X:74046531-74046553 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
1192884302 X:75320563-75320585 TTCTGTCTCGCTGGGGTTCCAGG + Intergenic
1192964134 X:76159440-76159462 TTCTGTCTTGCTGGCGTTCCAGG - Intergenic
1192980347 X:76332466-76332488 GTCTGTCTCGCTGGCATTCCAGG - Intergenic
1192984257 X:76379834-76379856 TTCTGTCTCACTGGCATTCTGGG - Intergenic
1192992098 X:76471363-76471385 TTCTGTCTTGCTGGCATTCAAGG - Intergenic
1193003674 X:76591438-76591460 TTCTGTCTCCCTGGCATTGCAGG + Intergenic
1193071856 X:77314798-77314820 TTCTGTCTCGCTGGGGTTCCAGG - Intergenic
1193075164 X:77347615-77347637 TTCTGTCTTGCTGGCGTTCCAGG - Intergenic
1193079319 X:77390334-77390356 TTCTGTCTCTCTGACATTCCAGG - Intergenic
1193161398 X:78233073-78233095 TTCTGTCTTGCTGGCGTTCCAGG + Intergenic
1193228455 X:79013441-79013463 TTCTGTCTTGCTTGCATTCCAGG + Intergenic
1193266822 X:79482142-79482164 TTCTGTCTAGCTGGCATTCCAGG - Intergenic
1193334618 X:80273858-80273880 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1193350818 X:80462611-80462633 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
1193361726 X:80586886-80586908 TTCTGTCTCGCTGGGTTTCCAGG + Intergenic
1193389144 X:80906233-80906255 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1193398547 X:81014302-81014324 TTCTGTCTTGCTGGCGTTCCAGG - Intergenic
1193547996 X:82852798-82852820 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1193616021 X:83688904-83688926 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1193645672 X:84066238-84066260 TTCTGTCTCGCTGGGATTCCAGG - Intronic
1193646744 X:84079454-84079476 TTCTGTCTTGCTGGCGTTCCAGG - Intronic
1193649266 X:84109834-84109856 TGCTGTCTCCTGGGCATTCTGGG + Intronic
1193685401 X:84571609-84571631 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1193749473 X:85325296-85325318 TTCTGTCTCTCAGGCATGCCCGG + Intronic
1193829978 X:86278671-86278693 TTCTGTCTCGCTGACATTCCAGG - Intronic
1193878707 X:86895982-86896004 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1193906779 X:87253932-87253954 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1194021232 X:88694643-88694665 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1194098559 X:89674246-89674268 TTCTGTCTTGCAGGCATTCCAGG - Intergenic
1194119021 X:89937747-89937769 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1194139833 X:90196088-90196110 TTCTGTATTGCTGGCATTCCAGG - Intergenic
1194203138 X:90979079-90979101 TTCTGTCTCATTGGCATTCCTGG + Intergenic
1194203495 X:90983436-90983458 TACTGTCTTGCTGGCATTCCAGG - Intergenic
1194208530 X:91040184-91040206 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1194355752 X:92882101-92882123 TTCTGTCTAGCTGGCGTTCCAGG - Intergenic
1194391138 X:93319563-93319585 TTCTGTCTTGCTGGCATTCCAGG - Intergenic
1194419896 X:93660837-93660859 TTCTGTCTCGCGGGCATTCCAGG - Intergenic
1194515355 X:94845203-94845225 TTCTGTCTCGCTGGCGTTCCAGG + Intergenic
1194643435 X:96429599-96429621 TTCTGTCTCACTGGCGTTCCAGG + Intergenic
1194652581 X:96533394-96533416 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1194783153 X:98049367-98049389 TTCTGTCTTACTGGCATTCCAGG + Intergenic
1194959096 X:100214784-100214806 TTCTGTCACACTGGCATTCCAGG + Intergenic
1194963978 X:100266957-100266979 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1195842725 X:109192139-109192161 TTCTGTCTCGCTGGAGTTCCAGG - Intergenic
1196133372 X:112181309-112181331 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1196273192 X:113736011-113736033 TTCTCTCTCGCTGGCCTTCCAGG + Intergenic
1196312353 X:114183612-114183634 TTCTGTCTCACTGGCGTTCCTGG - Intergenic
1196467024 X:115983114-115983136 TTCTGTCTCGCTGGTTTTCCAGG - Intergenic
1196545758 X:116962586-116962608 TTCTGTCTTGCTGGCTTTCCAGG + Intergenic
1196571251 X:117268496-117268518 TTCTGTCTTACTGGCATTCCAGG - Intergenic
1197051158 X:122061162-122061184 TTCTGTCTCGCTGGCATTCCAGG - Intergenic
1197142166 X:123129769-123129791 TTGTGTCTCGCTGGCGTTCCAGG - Intergenic
1197350159 X:125372761-125372783 TTCTGTCTCGCTGGTGTTCCAGG + Intergenic
1197395624 X:125923345-125923367 TTCTGTCTTGCTGGTATTCCAGG + Intergenic
1197614334 X:128675041-128675063 TTGTGTCTTGCTGGCATTCCAGG + Intergenic
1197847023 X:130813876-130813898 TTCTGTCTTGCTGGCGTTCCAGG - Intronic
1197906218 X:131428393-131428415 TTCTGTCTTGTTGGCATTCCAGG - Intergenic
1197926905 X:131656362-131656384 TTCTGTCCTGCTGGCATTCCAGG - Intergenic
1198002301 X:132451681-132451703 TTCTGTCTCACTGGTATTCCAGG + Intronic
1198060598 X:133042220-133042242 TTCTGTCTCGCTGGGGTTCCAGG + Intronic
1198555787 X:137792163-137792185 TTCTGTCTCGCTGGTGTTCCAGG - Intergenic
1199004146 X:142675380-142675402 TTCTTTCTTGCTGGCATTCCAGG + Intergenic
1199094447 X:143723605-143723627 TTCTGTCTCGCTAGCATTCCAGG - Intergenic
1199377188 X:147127073-147127095 TTCTGTCTTCCTGGCATTCCAGG - Intergenic
1199469844 X:148182053-148182075 TTCTGTCTCTCTGACATTCCAGG + Intergenic
1199477392 X:148260416-148260438 TTCTGTCTCGCTGGCATTCCAGG + Intergenic
1199524921 X:148781710-148781732 TTCTGTCTCGCTGGCATTCCAGG + Intronic
1200388521 X:155918318-155918340 TTATGTCTCACTGGCATTCCAGG + Intronic
1200451581 Y:3335621-3335643 TTCTGTCTTGCAGGCATTCCAGG - Intergenic
1200471897 Y:3595301-3595323 TTCTGTCTCACTGGCATTCCAGG + Intergenic
1200485579 Y:3765057-3765079 TTCTGTATTGCTGGCATTCCAGG - Intergenic
1200548970 Y:4554505-4554527 TTCTGTCTCATTGGCATTCCTGG + Intergenic
1200664099 Y:5999083-5999105 TTCTGTCTAGCTGGCGTTCCAGG - Intergenic
1201394791 Y:13536832-13536854 TTCTGTCTTGCTGGCATTCCAGG + Intergenic
1201922163 Y:19245435-19245457 TTCTGTCTCACTGGCATTCCAGG - Intergenic
1201931963 Y:19360435-19360457 TTTTGTCTCGCCGGGATTCCAGG - Intergenic
1201961945 Y:19690491-19690513 TTCTGACTTGCTGGCATTCCAGG + Intergenic