ID: 1095675028

View in Genome Browser
Species Human (GRCh38)
Location 12:44906696-44906718
Sequence CTAGAGGAAGAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1135
Summary {0: 1, 1: 0, 2: 5, 3: 112, 4: 1017}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095675024_1095675028 24 Left 1095675024 12:44906649-44906671 CCTGAATAACTTAACGAACAAAA 0: 1
1: 0
2: 1
3: 19
4: 322
Right 1095675028 12:44906696-44906718 CTAGAGGAAGAGATGGAGAAAGG 0: 1
1: 0
2: 5
3: 112
4: 1017

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095675028 Original CRISPR CTAGAGGAAGAGATGGAGAA AGG Intronic
900965410 1:5953882-5953904 ATATAGGAAGAGATGGAGCTAGG - Intronic
901261895 1:7877534-7877556 CCAGAAGAAGAGATGGACAAAGG + Intergenic
901821554 1:11833612-11833634 CTGGTGGAAGAGCTGGAGGATGG - Exonic
901866573 1:12110436-12110458 ATAGAGGGAGAGATGGGGCACGG - Intronic
902476104 1:16688709-16688731 ATTGAGGAAGACAAGGAGAAGGG - Intergenic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
902973341 1:20070978-20071000 AGAGAGGGAGAGATGGAGGAAGG - Intronic
903880164 1:26502731-26502753 CAGGAGAATGAGATGGAGAAAGG - Intergenic
904308372 1:29605965-29605987 AAAGAGGAAGAGATGTAGAATGG - Intergenic
904596564 1:31650007-31650029 CTAGACGAAGAGATGGATTCAGG - Intergenic
904871396 1:33621188-33621210 CTAGAAGGAGAGATGGACATGGG - Intronic
905327888 1:37170833-37170855 TGGGAGGAAGAGATGGAGAGGGG - Intergenic
905615165 1:39391962-39391984 CTGGAAGAAGAGTGGGAGAAGGG + Intronic
905844197 1:41213442-41213464 ACAGAGGAGGAGATGGAGGAAGG - Intronic
906532650 1:46532551-46532573 TGGGAGGAAGAGAGGGAGAAGGG - Intergenic
906693796 1:47810761-47810783 TTAGGGGAAGAGAGGGAGCAGGG + Intronic
906779848 1:48563458-48563480 AGAGAGGAAGAGAGGGAGAGAGG + Intronic
907389598 1:54149617-54149639 CTAAAGGGAGAGAAGGAGCATGG - Intronic
907835738 1:58106877-58106899 AGAGAGGAAGGGAAGGAGAAAGG - Intronic
908558764 1:65284298-65284320 AGAAAGGCAGAGATGGAGAAAGG - Intronic
908836370 1:68232626-68232648 GTAGAGGAAGAGAGGGAGGGAGG - Intronic
909112330 1:71494911-71494933 GAAGAGGAAGAGAAAGAGAAAGG - Intronic
910202203 1:84711533-84711555 AGAGAAGAAGAGCTGGAGAAAGG - Intergenic
910766413 1:90787110-90787132 CCAGAGGAATAGAAGGAGACAGG - Intergenic
910905773 1:92175996-92176018 CTATAGGAAGCGAAGGAAAAGGG - Intronic
911104152 1:94117059-94117081 AGAGAGGAAGAGAGAGAGAAAGG - Intronic
911157563 1:94652129-94652151 CTGGAGGAGGACATGGAAAATGG + Intergenic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
911365755 1:96935530-96935552 CTAGAAGAAGAGATTGATAATGG + Intergenic
911406869 1:97452126-97452148 CTAAGTGAAGATATGGAGAATGG - Intronic
911642061 1:100300039-100300061 AGAGAGGAAGAAAGGGAGAAAGG - Intergenic
911705830 1:101011731-101011753 TTAGAGCAAAATATGGAGAAAGG + Intronic
911898572 1:103471353-103471375 AAAAAGGAAGAGAGGGAGAAAGG - Intergenic
912402392 1:109405911-109405933 CTGGAAGTAGGGATGGAGAAGGG + Intronic
912515447 1:110213871-110213893 ATAGAGATAGAGATGGGGAAAGG + Intronic
912540108 1:110408141-110408163 CTAAAGGACGAGATGGAGCAAGG + Intergenic
912726215 1:112061030-112061052 CTGCAGGAAGAGATGTAGATGGG + Intergenic
913176009 1:116273768-116273790 CTAGAGAGAGAGAGGGAGAGAGG - Intergenic
913500833 1:119471269-119471291 CCTGAGGAGGAGATGGAGCAAGG + Intergenic
913612355 1:120520568-120520590 ATCGAGGAAGACAAGGAGAAGGG - Intergenic
913707542 1:121441835-121441857 ATGGAGGAAGGGATGGAAAAGGG - Intergenic
913708854 1:121458738-121458760 ATAAAGGAAGAGAAAGAGAAAGG - Intergenic
914409195 1:147408560-147408582 CAAGAGCAAGAGAGTGAGAATGG - Intergenic
914578834 1:149001670-149001692 ATCGAGGAAGACAAGGAGAAGGG + Exonic
914827832 1:151147818-151147840 CTAGAGGAAAGGAGGGGGAAGGG + Intergenic
914852877 1:151327734-151327756 CTCGAGGGAGAGAGGGCGAAGGG + Intergenic
915175869 1:154014411-154014433 CTAGAAAAAGAGACTGAGAAGGG - Intronic
915243776 1:154542191-154542213 CTAGAGGAAGAAAGGGAAAAGGG - Intronic
915274765 1:154780815-154780837 CTAGAGGAAGAAAGGGAGGCGGG + Intronic
915622322 1:157093128-157093150 CTAGAGAAAGAAAGAGAGAAAGG + Intronic
915825654 1:159073237-159073259 CTTCAGGAGGAGAAGGAGAAAGG - Exonic
915842652 1:159228042-159228064 ATAGAGGAAGAGAAAGAGGAGGG - Intergenic
915883770 1:159701582-159701604 CTTGAGGGTGAGATGGAGCAGGG + Intergenic
915897480 1:159823280-159823302 CCAGGAGGAGAGATGGAGAAGGG - Intergenic
916602533 1:166306930-166306952 AAAGAGGAAGAGATGAAGAAGGG + Intergenic
916713994 1:167434908-167434930 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714016 1:167434970-167434992 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714029 1:167435007-167435029 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714042 1:167435044-167435066 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714068 1:167435118-167435140 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714081 1:167435155-167435177 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714094 1:167435192-167435214 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714107 1:167435229-167435251 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714120 1:167435266-167435288 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714125 1:167435278-167435300 CCAGAGGAAGGGCTGGAGGAAGG - Intronic
916714132 1:167435303-167435325 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714137 1:167435315-167435337 CCAGAGGAAGGGCTGGAGGAAGG - Intronic
916870064 1:168904047-168904069 CTAGAGGAGAAGAGGCAGAAAGG - Intergenic
917518030 1:175724334-175724356 CAAGAGGAAGAGAGCGAGAAGGG + Intronic
917587019 1:176437498-176437520 CTAGAGCAAGAGATATAAAAAGG - Intergenic
917926839 1:179796499-179796521 ATAGAGGGAGAGGTGGAGATGGG - Intronic
918224738 1:182471283-182471305 CAAGATGATGAGATGGAAAAAGG + Intronic
918451693 1:184664808-184664830 CCAGAGGAGGGGATGGGGAAGGG + Intergenic
918818643 1:189225019-189225041 CGAGAGGGAGAGAGGGAGAGAGG - Intergenic
918923540 1:190748069-190748091 ATAAAGGAAGAGCTGAAGAAAGG - Intergenic
919970555 1:202574550-202574572 TTAGAGGAAGGGAGAGAGAAAGG + Intronic
920668877 1:207987749-207987771 CCAGAGGAAGAGACGGGGAGAGG - Intergenic
920755495 1:208727114-208727136 CAGGAAGAAGAGATGGACAACGG + Intergenic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
920873697 1:209815339-209815361 CTAGAGGAAGAGAGAAAGGAAGG - Intergenic
921320240 1:213931564-213931586 AGAAAGGAAGTGATGGAGAAAGG + Intergenic
921453022 1:215332536-215332558 CTTGAGGATGAGGTGGAGTAAGG + Intergenic
921568063 1:216744732-216744754 CTAGAAGAACAGATGGAAGATGG - Intronic
922420931 1:225460829-225460851 CTAGAGGAAATGATGGGCAAAGG - Intergenic
922897920 1:229114852-229114874 CCTGAAGATGAGATGGAGAATGG - Intergenic
923099681 1:230802480-230802502 CGAGAGGGAAAGAGGGAGAATGG + Intergenic
923190196 1:231612943-231612965 ATAGAGGAAGCTGTGGAGAAGGG - Intronic
923860025 1:237883796-237883818 AGAGAGGAAGAGAGGGAGAAAGG + Intronic
924012225 1:239677606-239677628 AAAGAGGAAAAGAGGGAGAAGGG + Intronic
924203837 1:241689996-241690018 CCAGAAGAAGAAAGGGAGAAAGG + Intronic
924261202 1:242233528-242233550 CTAAAGGAAGAGAGAGAGAGAGG + Intronic
924350465 1:243109420-243109442 CTAGAGTAAGAGATGGACGAAGG - Intergenic
1062778768 10:181187-181209 CTATGGGTAGAAATGGAGAATGG + Intronic
1063194406 10:3727742-3727764 CAGGAGGGAGAGAGGGAGAAAGG - Intergenic
1063290268 10:4738628-4738650 AAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1063423866 10:5936300-5936322 TTAGAGGAAGTAAGGGAGAACGG + Intronic
1063691598 10:8292845-8292867 CTGGAGGAAGAAATGCAGCACGG - Intergenic
1063984159 10:11483573-11483595 AGAGAGGAAGAGAGGGAGAGAGG + Intronic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064121741 10:12624958-12624980 AAGGAGGAAGAGAAGGAGAAGGG - Intronic
1064420776 10:15188951-15188973 CAGGAGGAGGAGCTGGAGAATGG - Intergenic
1064437524 10:15324244-15324266 CTTTAGGAAAAGACGGAGAAAGG - Intronic
1064444921 10:15384592-15384614 CAGGAGGAGGAGATGGTGAAAGG + Intergenic
1064817517 10:19283509-19283531 GTGGTGGAAGAGATGGAAAAGGG - Intronic
1065182362 10:23139394-23139416 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1065448150 10:25824184-25824206 CAAGAGCAAGAGAGAGAGAATGG + Intergenic
1065550036 10:26860870-26860892 CGAGAGGAAGCGATGCAGAGGGG - Exonic
1065638273 10:27753127-27753149 AAAGAGGGAGAGAAGGAGAAAGG - Intergenic
1066039758 10:31536630-31536652 CTGGTGGAAGAGAAGGAGACAGG + Intergenic
1066045934 10:31595455-31595477 ACAGAGGAAGAGAGAGAGAAAGG + Intergenic
1066586746 10:36944248-36944270 CTAGAGGAAGAGCAGCACAATGG - Intergenic
1067191812 10:44076853-44076875 CTAGAAGAAGAGAGGGATCATGG - Intergenic
1068087581 10:52393615-52393637 CAAGAGGAAGAAATGGGGGAGGG - Intergenic
1068778023 10:60888661-60888683 CCAGAGGAAGAAAGGGAGGAGGG - Exonic
1069221325 10:65887471-65887493 CAAGAGGAAGAGTTAGGGAAAGG - Intergenic
1069562950 10:69443888-69443910 CTAGAGGAAGAGGAAAAGAAGGG + Intergenic
1069994709 10:72335273-72335295 CTAGCTGGAGGGATGGAGAAAGG + Exonic
1071025154 10:81104089-81104111 GTTGAGGCTGAGATGGAGAATGG - Intergenic
1071042485 10:81330316-81330338 ATGGAGGAAAAGAGGGAGAAGGG + Intergenic
1071185466 10:83039062-83039084 CTATAGGAAGAGATAAAGACAGG + Intergenic
1071207318 10:83296321-83296343 CAAGAACAAGAAATGGAGAAAGG + Intergenic
1071324692 10:84501428-84501450 CTAGCTGAGGAGAAGGAGAAAGG - Intronic
1071917045 10:90305129-90305151 GGAGAGGTAGAGCTGGAGAAGGG - Intergenic
1072076405 10:91978534-91978556 CTAGACAAAGAGAAAGAGAAAGG - Intronic
1072446436 10:95502796-95502818 CAAGTGGTAGAGAAGGAGAAAGG - Intronic
1072446707 10:95505020-95505042 CAAGTGGTAGAGAAGGAGAAAGG + Intronic
1072582190 10:96749213-96749235 CTACAGGTAGAGATGCAAAATGG + Intergenic
1072828083 10:98628721-98628743 CTAGAGGCAGAGTTGTATAAAGG + Intronic
1072845926 10:98830332-98830354 GAAGAGGAAAAGATGAAGAAAGG + Intronic
1073133392 10:101205342-101205364 GTAGGGGAAGAGATGCTGAAAGG + Intergenic
1073249127 10:102111145-102111167 CTGGAGGAAGTGAAGGAGAGAGG + Intronic
1073267591 10:102237320-102237342 CAAGAGGAAGAGAAGGGGTATGG + Intronic
1073479983 10:103780283-103780305 CTTGGGGAAGGGAAGGAGAAAGG - Intronic
1073514941 10:104067957-104067979 CAAGAGGAAGAGAGAGAGACAGG + Intronic
1073650648 10:105354579-105354601 CATGAGGAAGTGATGGAGAGAGG + Intergenic
1073788750 10:106918593-106918615 ATAGAGGAGGAGAGGGAGAAAGG + Intronic
1074122726 10:110505099-110505121 CTAGAGGAAGAGAGGAAAGAGGG + Intronic
1074230636 10:111531657-111531679 GTTGAGGAAGAGACGGAGACAGG - Intergenic
1074273543 10:111979031-111979053 CTGGAGGAGGAGCGGGAGAAAGG + Intergenic
1074617730 10:115087104-115087126 CAAGAGGAAGAGAGGAAGCAGGG + Intergenic
1075019757 10:118943351-118943373 CTAAAGGAAGAAGGGGAGAATGG - Intergenic
1075550466 10:123389031-123389053 CTACAGGATGAGATGTAGGAGGG - Intergenic
1075725554 10:124609006-124609028 CAAGAGTAAGAGCTTGAGAAGGG + Intronic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1077345038 11:2043651-2043673 AGAGAGAAAGAAATGGAGAAAGG - Intergenic
1077388517 11:2287629-2287651 AGGGAGGAAGAGATGAAGAAAGG + Intergenic
1077768390 11:5187403-5187425 ATAGAAAAAGAGATGGAGAAAGG + Intergenic
1077772497 11:5235423-5235445 GAGGAGGAAGAAATGGAGAAAGG + Intergenic
1077981821 11:7308679-7308701 CCAGAAGATGAGAGGGAGAAAGG - Intronic
1078127309 11:8580460-8580482 CTAGAGGCTGGGAAGGAGAATGG + Intronic
1078417009 11:11174123-11174145 CTAGTAGGAGAGATAGAGAAAGG - Intergenic
1078552817 11:12292186-12292208 GAAGAGGAAGAGAAGGAGAAGGG - Exonic
1078955465 11:16189254-16189276 CTAGACGAAGAGTTGGAGCATGG + Intronic
1079015187 11:16862750-16862772 GTAGGGGAAGAGATGGTGATGGG - Intronic
1079225254 11:18599481-18599503 CTAGAGGCAGAGATTTGGAAAGG - Intergenic
1079292111 11:19197470-19197492 GGAGAGAAAGAGATGGAGAGAGG - Intronic
1079298279 11:19254332-19254354 TTAGTGGAAAAGATGGAAAAGGG - Intergenic
1079670939 11:23170199-23170221 CAAGAGAAAGAGAGGTAGAAGGG - Intergenic
1080102239 11:28473010-28473032 GTAGAGGAATAAATGGATAAAGG + Intergenic
1080243887 11:30158037-30158059 AGAGGGGAAGAGATAGAGAATGG + Intergenic
1080303800 11:30815060-30815082 GTATAGGTAGAGAAGGAGAAAGG + Intergenic
1080885605 11:36364892-36364914 CTAGAGGAAGGAAGAGAGAAAGG - Intronic
1080946549 11:36980744-36980766 CTAGAGCAGGAGAAAGAGAAGGG + Intergenic
1080956151 11:37098288-37098310 GTAGAGAAAGAGCTGGAGACGGG + Intergenic
1081132742 11:39400775-39400797 CTAGAGGCAGAGAAGGGTAAGGG + Intergenic
1081162764 11:39771469-39771491 TAAGAGCAAGAGATGTAGAAGGG + Intergenic
1081558381 11:44188839-44188861 CCAGAAGAAGAGGTGGGGAATGG + Intronic
1081570695 11:44289040-44289062 CTAGTGGAAGAGATGCATGAGGG + Intronic
1081613103 11:44575196-44575218 AAAGAGAAGGAGATGGAGAAAGG + Intronic
1081699021 11:45140795-45140817 CTAGAGAAAGGGATGGGGACTGG - Intronic
1081726408 11:45332587-45332609 CTAGTGGACGAGATGGTGAATGG + Intergenic
1081772893 11:45660721-45660743 CTAGGGGAGGAGATGGAGGGGGG - Intronic
1082109896 11:48262923-48262945 TTGGAGGAAGGTATGGAGAAGGG + Intergenic
1082192569 11:49265242-49265264 AAGGAGGAAGAGAGGGAGAAGGG + Intergenic
1082228183 11:49732809-49732831 CCAAAGGAAGATATGTAGAAAGG - Intergenic
1082766916 11:57176693-57176715 ATGGAGGAAGAAATGGAAAAAGG - Intergenic
1082914709 11:58420054-58420076 GGAGAGGAAGAGATGGTGAGAGG + Intergenic
1083079874 11:60080177-60080199 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1083749186 11:64752072-64752094 CTGGAGGCAGAGACGGGGAAGGG + Intronic
1085115523 11:73928232-73928254 CTAGAGGAAGAGATGGTGGAGGG + Intergenic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085347231 11:75776059-75776081 CCAGAGGAAGGGAGAGAGAAGGG - Intronic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1086439744 11:86816192-86816214 CTAATTGAAGAGATGGAGGAAGG - Intronic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086506464 11:87509699-87509721 CTAGATGAAGAGTTGGAAACTGG - Intergenic
1086526864 11:87738080-87738102 AAAGAGGAAGAGAGGAAGAAAGG - Intergenic
1086621878 11:88896344-88896366 CCAAAGGAAGATATGTAGAAAGG + Intronic
1086927045 11:92651960-92651982 CCAGAGGAAAAGATGGACAATGG - Intronic
1087066161 11:94029896-94029918 CTTGTGGAGGTGATGGAGAAAGG + Intronic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087095754 11:94315893-94315915 CTAGAGTAAGGGAGGGGGAAGGG - Intergenic
1087096664 11:94325750-94325772 CTAGCATAAGAGGTGGAGAAGGG + Intergenic
1088385983 11:109256987-109257009 AGAGGGGAAGAGAAGGAGAATGG - Intergenic
1089135302 11:116244359-116244381 GGAGAGGAAGAGATGAAAAAGGG + Intergenic
1089410358 11:118236328-118236350 AGAGAGGAAGGGAAGGAGAAAGG + Intronic
1090274748 11:125411514-125411536 AAGGAGGAAGAGATGGGGAAGGG - Intronic
1090284936 11:125491662-125491684 TTGTAGGTAGAGATGGAGAATGG - Intronic
1090347964 11:126086187-126086209 CTAGAAGCAGACCTGGAGAAAGG + Intergenic
1090440696 11:126723016-126723038 TAAGAGGAATAGATGAAGAAAGG - Intronic
1090469437 11:126967187-126967209 AAAGAGGAAGAGCTGGACAAAGG - Intronic
1202827967 11_KI270721v1_random:98523-98545 AGAGAGAAAGATATGGAGAAAGG - Intergenic
1091693199 12:2610909-2610931 AGAGGGGAGGAGATGGAGAAGGG + Intronic
1091693209 12:2610974-2610996 AGAGGGGAGGAGATGGAGAACGG + Intronic
1091693235 12:2611104-2611126 AGAGGGGAGGAGATGGAGAAGGG + Intronic
1091693249 12:2611169-2611191 AGAGGGGAGGAGATGGAGAAGGG + Intronic
1091693262 12:2611234-2611256 AGAGGGGAGGAGATGGAGAAGGG + Intronic
1091693273 12:2611299-2611321 AGAGGGGAGGAGATGGAGAACGG + Intronic
1091693301 12:2611427-2611449 AGAGGGGAGGAGATGGAGAAGGG + Intronic
1091693308 12:2611448-2611470 GGAGGGGAGGAGATGGAGAAGGG + Intronic
1091693322 12:2611513-2611535 AGAGGGGAGGAGATGGAGAAGGG + Intronic
1091705958 12:2693539-2693561 AGTGAGGAAGGGATGGAGAAAGG - Intronic
1092210811 12:6645338-6645360 CTGCAGGAAGAGAAGGAAAATGG + Intronic
1092287388 12:7136623-7136645 CGAGATGAAGAGTTGGAGAATGG + Intronic
1092393102 12:8099177-8099199 ATAGAGCAAGAGAGGAAGAAAGG + Intergenic
1092756748 12:11770581-11770603 GTAGAGGAAGGGAAGGAGGAAGG - Intronic
1093123066 12:15295978-15296000 CAGGAGGAAGAGAGAGAGAAAGG - Intronic
1093151818 12:15630688-15630710 CAAGAGGAAGAGAAGTAGGAAGG + Intronic
1093338168 12:17935713-17935735 TTAGAAGTAAAGATGGAGAATGG - Intergenic
1093374646 12:18409914-18409936 CAGGAGGAAGAGATGGGGAGAGG + Intronic
1094200510 12:27790644-27790666 CTTGAAAAAGAGATGGACAATGG - Intronic
1094481644 12:30887129-30887151 CCAGAAGAAGAGACAGAGAAAGG + Intergenic
1094715560 12:33011611-33011633 TTAGAGGAAGAGATCAAGGATGG + Intergenic
1094762011 12:33544841-33544863 CCAGAGCAAGAGAAAGAGAAGGG + Intergenic
1095426154 12:42076496-42076518 CTAGAGGAAGTGAAGTGGAAAGG + Intergenic
1095452358 12:42346221-42346243 GTAGGGGAAGAAATGGGGAATGG - Intronic
1095675028 12:44906696-44906718 CTAGAGGAAGAGATGGAGAAAGG + Intronic
1096196911 12:49654623-49654645 CTAGAGGAAGAGCTTAGGAAAGG + Intronic
1096242746 12:49968019-49968041 GGAGAGGAAGAGAGGGAGGAAGG - Intronic
1096587090 12:52629842-52629864 CAAGGGGAACAGATTGAGAAGGG - Intergenic
1096617525 12:52842426-52842448 ATAGAGGAAGAGATTGGCAAGGG - Intronic
1096668405 12:53182125-53182147 CTAGAGGAAGGAAAGGAGACAGG + Intronic
1097042339 12:56163417-56163439 CTAAAGGAAGGGCTGGTGAAAGG - Exonic
1097053890 12:56238915-56238937 CCAGAGTGAGAGGTGGAGAAGGG + Exonic
1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG + Exonic
1097359378 12:58641621-58641643 CTAGAGGAAGAGAGCAAGATTGG + Intronic
1098213227 12:68188016-68188038 CAAGAAGAAGAGAGGGAGAATGG + Intergenic
1098267663 12:68738739-68738761 CTAGAGGTAGAGGTAGTGAAAGG - Intronic
1098392189 12:69981228-69981250 GTAGAGGAAGGGAGGGAGACAGG - Intergenic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1099344044 12:81475815-81475837 CTGGAGGCTGAGAAGGAGAATGG - Intronic
1099437544 12:82661757-82661779 ATAGAGGACGAGTTGGAGAGGGG - Intergenic
1099458878 12:82898682-82898704 TGACAGGAAGAGAGGGAGAAAGG + Intronic
1099582620 12:84470583-84470605 CAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1099679543 12:85807341-85807363 CTAAAGTAGGGGATGGAGAAAGG - Intronic
1099739901 12:86620853-86620875 CAGGAGGAAGAGAGAGAGAAAGG - Intronic
1099894074 12:88622914-88622936 CAAGAGAAAGAGATGAAGAGAGG - Intergenic
1100343188 12:93701238-93701260 CAGGAGGAAGAGGAGGAGAAGGG - Intronic
1100724225 12:97391895-97391917 CTTGAGGAAGAAATGAAGAAAGG - Intergenic
1100785532 12:98074022-98074044 CTGCAGGGAGAGATGGTGAAGGG - Intergenic
1101496223 12:105256819-105256841 TGAGGGGAAGAGATGGAAAATGG - Intronic
1101664606 12:106800348-106800370 CAGGAGGAAGAGAGAGAGAAGGG + Intronic
1101799603 12:108009269-108009291 ATATAGGACGATATGGAGAAAGG - Intergenic
1101972487 12:109325318-109325340 CTAGAACAAGCGATGGGGAAAGG + Intergenic
1102090307 12:110181795-110181817 CTAGAAGCAGAGCTCGAGAAGGG + Intronic
1102122598 12:110453988-110454010 TTACAGGAAGAGGAGGAGAAGGG + Intronic
1102233202 12:111277599-111277621 CTAGAGGGAATGATGGACAAAGG - Intronic
1102425101 12:112837906-112837928 ATAGAGGAAGGGAGGGAGGAAGG - Intronic
1102437437 12:112936331-112936353 CTGGAGGCAGAGATGAGGAAAGG + Intergenic
1102443730 12:112985248-112985270 CTAGGAGAAGAGATGGGCAAAGG - Intronic
1102526574 12:113516251-113516273 ATGGAGGAAGGGATGGAGGAAGG - Intergenic
1102639605 12:114355480-114355502 CTAGAGAAAGAGAGAGAGAGAGG - Exonic
1102655834 12:114481527-114481549 CTTGAGGAAGAGATGCATACAGG + Intergenic
1102682265 12:114698768-114698790 GGAGAGGGAGAGATGGAGAGGGG - Intergenic
1102772343 12:115489219-115489241 CGAGAGGAAGAAATTGAGGAAGG + Intergenic
1102922795 12:116805169-116805191 ATAGAGGAAGTGATGGAGCCAGG - Intronic
1103173236 12:118840328-118840350 CATGTGGAAGAGATAGAGAATGG - Intergenic
1103197860 12:119060957-119060979 CTACAGGAGGAGGTGGGGAAGGG - Intronic
1103204736 12:119119793-119119815 AGAGAAGATGAGATGGAGAATGG + Intronic
1103809604 12:123602775-123602797 CTAGTGCAAGAGCTAGAGAAAGG + Intronic
1104091454 12:125521215-125521237 GAAGAGGAAGAGAAGGAGGAAGG - Intronic
1104198580 12:126565748-126565770 CTACAGAATGAGAGGGAGAAAGG - Intergenic
1104289016 12:127451456-127451478 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1104477691 12:129084103-129084125 CTAGAGGAAGAGGTGCACCAAGG - Intronic
1104572153 12:129934803-129934825 CTAGAGGCAAAGATGGGGAGTGG + Intergenic
1104649160 12:130518975-130518997 CAAAAGGAAGAGAAGCAGAAGGG + Intronic
1105406279 13:20135030-20135052 CTAGAGCAAGAGACAGAAAATGG - Intergenic
1105600852 13:21885794-21885816 CTGGAGGGAGAGATTAAGAAGGG + Intergenic
1105652025 13:22389429-22389451 TTGGGGGAAGAGATGGTGAAGGG + Intergenic
1106148967 13:27079501-27079523 CTAGGGGAGGAGCTGGAGGAAGG + Intronic
1106380771 13:29236720-29236742 GTGGAGGAAGAGAGAGAGAAAGG + Intronic
1107462412 13:40616845-40616867 CAAAAGGGACAGATGGAGAAAGG + Intronic
1107488378 13:40854507-40854529 CTAGAAGAAGGGAAGGAGAAAGG - Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108105038 13:46999487-46999509 AAGGAGGAAGAGATGCAGAATGG - Intergenic
1108106238 13:47013771-47013793 AAGAAGGAAGAGATGGAGAAAGG + Intergenic
1108305796 13:49131220-49131242 GTAGAGGAGGATGTGGAGAACGG - Exonic
1108359718 13:49658088-49658110 CAAGAGGAAGAGAGCGCGAAAGG + Intergenic
1108870911 13:54984661-54984683 CTAAAGCATGAGATGGAGAAGGG - Intergenic
1109171347 13:59100994-59101016 CTATAGCAAGAGATGGATTATGG + Intergenic
1109310565 13:60687747-60687769 CTAGAGGCTGAGAAGGGGAAGGG - Intergenic
1110067441 13:71126556-71126578 ATAGAAGAAGAAAGGGAGAAAGG + Intergenic
1110154483 13:72297916-72297938 GTAGAGCCATAGATGGAGAAGGG - Intergenic
1110706911 13:78607716-78607738 ATGGAGGAAGGAATGGAGAAAGG + Intergenic
1110972914 13:81788932-81788954 CTAGAGGCTGAGATGGGCAATGG + Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111674855 13:91374797-91374819 ATGGAGGAAGAAAGGGAGAATGG + Intergenic
1111956121 13:94760478-94760500 AAAGAGGAAGAGAAGGAGGAAGG - Intergenic
1112021887 13:95378979-95379001 CTATAGGAACAAATGGGGAAGGG - Intergenic
1112280131 13:98055837-98055859 CTATAGGAAGAGGTGAGGAACGG + Intergenic
1112487210 13:99830699-99830721 GGAGAGGGAGAGATGGAAAAGGG + Intronic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1113058655 13:106297436-106297458 CAGGAGGAAGAGAGAGAGAAGGG - Intergenic
1113172598 13:107522309-107522331 CTATATGGAGAGATTGAGAAAGG - Intronic
1113235611 13:108269716-108269738 GTAGGGGTAGAGATGCAGAAAGG + Exonic
1113358816 13:109609661-109609683 AGAGAGGGAGAGAGGGAGAAAGG + Intergenic
1113797978 13:113069808-113069830 CTAGAGGGAGAGAAGCAGGAAGG + Intronic
1114553418 14:23547492-23547514 CAAGAGGAAGATGTGGAGGAGGG - Intronic
1115348568 14:32368563-32368585 CTAGAGGTAGAGGTGGGGGAAGG + Intronic
1115733964 14:36303276-36303298 CTAAAGAAAGAGCTGGAGAAAGG + Intronic
1115746310 14:36441292-36441314 TTTGAGGAAGAGAGGGAAAATGG + Intergenic
1115788213 14:36850112-36850134 CCAGAGGAAGAGATGTATAAAGG + Intronic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1115940618 14:38604601-38604623 CTAGAAGAAGAGAAAAAGAATGG + Intergenic
1116070675 14:40040938-40040960 ATAGAGGAAGGGAGGAAGAAAGG - Intergenic
1116275800 14:42829516-42829538 CTAGAGGAAGAGTTTGGGAATGG - Intergenic
1116563646 14:46416719-46416741 CCAGAAGAAGAGAGAGAGAAAGG + Intergenic
1118113614 14:62750148-62750170 CTAGAGGAGGAGGTGAAGACTGG + Intronic
1118166194 14:63339040-63339062 CAAGAGGAAGAGAGAGAGGAGGG + Intergenic
1118201672 14:63679870-63679892 CAGGAGGAAGAGAAGGTGAAGGG + Intergenic
1118517148 14:66543026-66543048 CTGGAGGAAGAGAGAGAGAGTGG + Intronic
1118693004 14:68358030-68358052 GAAGAGGAAAAGATGGGGAAGGG + Intronic
1118765179 14:68904737-68904759 CTAGAGGGAGAAAAGGAGGAAGG + Intronic
1118770371 14:68938892-68938914 CAAGAGGAGGAGATGGGGAGGGG + Intronic
1118998778 14:70862077-70862099 AGAGAGAAAGAGAGGGAGAAAGG + Intergenic
1119499527 14:75112357-75112379 CTAGAGGAACAGAGGGATAAAGG + Intronic
1119634883 14:76265839-76265861 CAGGAGGAAGAGACAGAGAAGGG + Intergenic
1119635873 14:76273037-76273059 AGAGAGGAAGAGAGAGAGAAGGG + Intergenic
1120187114 14:81405180-81405202 TTAGCAGAAGAGATGGAAAAGGG - Intronic
1120215863 14:81679971-81679993 CTAGGGGACGAGTTGGAGATGGG + Intergenic
1120562260 14:86009830-86009852 CTAGAGCAAAAGGTGGAGTAAGG - Intergenic
1120711736 14:87799574-87799596 AAAGAGGAAGAGACAGAGAAAGG - Intergenic
1120848559 14:89147804-89147826 CAAGAGGAAGAGAGAGAGAGGGG + Intronic
1121007598 14:90500275-90500297 CAAGAGGAAGAGATGGGGAAAGG + Intergenic
1121170800 14:91852733-91852755 CAAGAGAAAGAGAAAGAGAAGGG + Intronic
1121511364 14:94515435-94515457 CTAGAGGCAGTGAAGGAGCAGGG + Intronic
1121592326 14:95125595-95125617 GGAGAGGAAGAGAGGGAGAAGGG + Intronic
1121714742 14:96065578-96065600 TTGGAGGAAGAGAGAGAGAAGGG - Intronic
1121828666 14:97031281-97031303 AGAAAGGAAGAGATGGATAAAGG - Intergenic
1121983729 14:98478366-98478388 ATAGAGGAAGACAGGCAGAAAGG + Intergenic
1122059025 14:99124424-99124446 TTAGAGGCAGAAGTGGAGAAGGG - Intergenic
1122288269 14:100665679-100665701 CAAGAGGAAGAGAGGGAGGGCGG + Intergenic
1122852994 14:104546782-104546804 CTTGAGGAAGACATGGGGATGGG - Intronic
1122943096 14:104991817-104991839 CTAGAGCAGGAGGTGGGGAAAGG + Intronic
1124020568 15:25918591-25918613 CCAGAGGGTGAGAAGGAGAAGGG - Intergenic
1124209267 15:27749016-27749038 CTAGAAGAAGAAAAAGAGAATGG + Intergenic
1124682931 15:31751889-31751911 CCAAAGGAAGAGAAGGAGAGAGG + Intronic
1124789347 15:32712859-32712881 ATAGAGGAAGAGATAAAGAGAGG - Intergenic
1125747040 15:42004349-42004371 AGAGAGGGAGAGAGGGAGAAAGG + Intronic
1126438915 15:48666008-48666030 CTAGAGAAAGAGAGAGAGAAAGG + Intergenic
1126730300 15:51675459-51675481 GTAGAGGACAAGGTGGAGAAGGG - Intergenic
1126793533 15:52242008-52242030 CTAGAGGAAGGGAGGGTGTACGG - Intronic
1126900221 15:53307257-53307279 CTATAGGAAGAAATGGAGCTTGG + Intergenic
1127221443 15:56885264-56885286 AGAGAGGGAGAGAGGGAGAAAGG + Intronic
1127332502 15:57952663-57952685 TTAGAGGAACAGAAGGAGCATGG - Intergenic
1127527510 15:59808217-59808239 CAAAAGCAAGAAATGGAGAAAGG + Intergenic
1127535444 15:59885813-59885835 GAAGAGGAAGAGATTGACAAGGG + Intergenic
1127972137 15:63969965-63969987 TTAGAGGTAGAGATGAAGGAGGG - Intronic
1128005897 15:64240338-64240360 CTAGAAGAAGAGATGAAAAAAGG + Intronic
1128214965 15:65928134-65928156 CTAGAGAATATGATGGAGAAGGG - Intronic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128470315 15:67946195-67946217 CAAGAGGAAGAGAAGGGGAAGGG + Intergenic
1128610418 15:69068493-69068515 ATAGAGGAAGACAGGGAGGAAGG - Intergenic
1128752156 15:70157518-70157540 TAAGAGGAAGAGAAGGAAAAAGG - Intergenic
1129599944 15:76992934-76992956 CTCGAGGTAGAACTGGAGAAAGG + Intergenic
1129675184 15:77629475-77629497 CTTTAGGAAGAGAGGGAGACTGG - Intronic
1129786713 15:78314553-78314575 CTGGAGGTAGAGATTCAGAAGGG + Intergenic
1129990612 15:79959313-79959335 TTGGAGGAAGAGAAGGAAAAAGG + Intergenic
1130157089 15:81360528-81360550 CTAGAAGCAGAGCTTGAGAAAGG + Intronic
1130219701 15:82009122-82009144 CTAGTGGAAGCTATTGAGAAAGG - Intergenic
1130281450 15:82523060-82523082 CTAGAGACAGAGTTTGAGAAGGG - Intergenic
1130424972 15:83787839-83787861 CTGGAGGGAGAGGTTGAGAAAGG - Intronic
1130443149 15:83975368-83975390 CTAGAGGAGGAGTTAGAGCAGGG - Intronic
1130484542 15:84391377-84391399 CTAGAGACAGAGTTTGAGAAAGG - Intergenic
1130503071 15:84513355-84513377 CTAGAGACAGAGTTTGAGAAGGG + Intergenic
1130543329 15:84837806-84837828 CTACAGTGAGAGATGGAAAAAGG - Intronic
1130595117 15:85243877-85243899 CTAGAGACAGAGTTTGAGAAGGG - Intergenic
1130912639 15:88281611-88281633 TTAGCGGCAGAGATGGAGATGGG - Intergenic
1130988790 15:88862457-88862479 GTAGAGTGAGAGATGGGGAAAGG - Intronic
1131714712 15:95095801-95095823 AAAGAGGAAGAGAAGGAGCAAGG + Intergenic
1131869170 15:96743894-96743916 CTTGTGGAAGGGATGGAGGAAGG + Intergenic
1131883690 15:96886372-96886394 CTAGAGGGTGAGTTAGAGAAAGG - Intergenic
1132125242 15:99217966-99217988 GCAGAGGAAAAGGTGGAGAAAGG - Intronic
1133460762 16:5984203-5984225 GAAGAGGAAGAGAAGAAGAAGGG - Intergenic
1133485358 16:6214513-6214535 GGAGAGGAAGAGAGGGAGATGGG + Intronic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1133839487 16:9394712-9394734 AGAGAGGAAGGGAGGGAGAAAGG - Intergenic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1133981709 16:10637465-10637487 GGAGAGGAAGGGAGGGAGAAAGG + Intronic
1134287995 16:12879180-12879202 AGAGAGGAAGAGATGGAGGAAGG - Intergenic
1134326219 16:13210261-13210283 CTAGAGGAAAAACTGGACAAGGG - Intronic
1134339028 16:13328158-13328180 CTAGAAGAAGTGATGGTGAGAGG - Intergenic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134604854 16:15562448-15562470 AGAGAGGAGAAGATGGAGAAAGG - Intronic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134821801 16:17252985-17253007 CTAAATGAGGAGATGGAGACAGG - Intronic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1135052997 16:19207515-19207537 CAGGAGGAAGAGACAGAGAATGG + Intronic
1135475988 16:22775496-22775518 CTAGAGGAAGAGAGAGAGAGAGG + Intergenic
1135640255 16:24113584-24113606 AGAGAGGAAGAGAGAGAGAAAGG - Intronic
1135941414 16:26825365-26825387 CCAGAGGGAGAGAGGGAGAGAGG - Intergenic
1135967069 16:27044645-27044667 CTTGAGGAAGAGGAGGAGGAAGG - Intergenic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136607777 16:31348194-31348216 CTAGAGGAAGTGGGGAAGAATGG + Intergenic
1137277941 16:46949407-46949429 GTAGAGCAAGAGATGGATACTGG - Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137744652 16:50811959-50811981 AGAGAGAAAGAGAGGGAGAAGGG - Intergenic
1137933856 16:52614555-52614577 CTAGTGCAAGAGATGGAGAAGGG + Intergenic
1137977285 16:53042398-53042420 ACAGAGGAAGAGAGGGAGGAGGG - Intergenic
1138322058 16:56123027-56123049 ATAGTGGAAATGATGGAGAATGG - Intergenic
1138469872 16:57225610-57225632 CTAGAGAAAGAAATTGAAAATGG - Intronic
1138594159 16:58020715-58020737 GGAGAGGAAGAGATAGAGGAGGG - Exonic
1138607322 16:58097430-58097452 CTAGTGGAAGGGCTGGAGATGGG + Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139322712 16:66128237-66128259 AGAGAGGAAGAGATGGGAAAAGG - Intergenic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140315655 16:73894298-73894320 CTAGGGAAAGAGAGAGAGAATGG + Intergenic
1140557453 16:75938082-75938104 CTAGAGGAAGGGAGGGAAGAGGG - Intergenic
1141017597 16:80465213-80465235 CTCAAGGAAGGGATGGAGGAAGG - Intergenic
1141726361 16:85791768-85791790 TGAGAGGAAGAGATGGATGATGG - Intronic
1141775574 16:86120914-86120936 CTAGAGGAGGAGGAGGAGAAGGG - Intergenic
1141951666 16:87343766-87343788 CTACAGGAGGAGATGGGCAAAGG + Intronic
1142481687 17:222809-222831 CAAGAGGAAGAAATGGAAAAAGG - Intronic
1142846556 17:2681819-2681841 CCAGAGGAAAAGAGGGAGGAGGG - Exonic
1142957525 17:3531787-3531809 GGGGAGGAGGAGATGGAGAACGG - Intronic
1143277561 17:5723032-5723054 CAAGAGGTAGAGATGGGGTAAGG - Intergenic
1143427352 17:6850550-6850572 CCAGAGGAAGAGAGAGAGAGGGG + Intergenic
1143476615 17:7206964-7206986 CCAGAAGAGGAGATGGAGGAAGG + Intronic
1143752261 17:9036933-9036955 CAAGTGGAAGAGCTGGAGAGTGG - Intronic
1143934965 17:10474088-10474110 ATAGAGGGAGAGATGGGCAAGGG + Intergenic
1144018629 17:11220734-11220756 GGAGAGGAAAAGAGGGAGAAGGG - Intergenic
1144555546 17:16279634-16279656 CTGGAGCAAGAGAAGGACAATGG - Intronic
1144952564 17:19002118-19002140 TTAGAGGAAGAGGAGGAGGAGGG - Intronic
1146297226 17:31659370-31659392 GGAGAGAAAGAGAGGGAGAAAGG + Intergenic
1146562818 17:33886181-33886203 CTGGCTGAAGAGATGGACAAAGG + Intronic
1146665789 17:34702297-34702319 CTAGGGGTAGAGATAGAAAAGGG + Intergenic
1146670847 17:34736496-34736518 GGAGAGGAGGAGAGGGAGAAGGG + Intergenic
1146930860 17:36776925-36776947 AGAGAGGAAGGGAGGGAGAAAGG + Intergenic
1146973184 17:37089249-37089271 ATAAAGGAAGAGAAGGAGAAGGG - Intronic
1147226348 17:38980971-38980993 CAAATGGAAGAGATAGAGAAGGG + Intergenic
1147303854 17:39549950-39549972 GTAGAGGAAGACATGGGGCAGGG - Intronic
1147598901 17:41733989-41734011 GCAGAGGAGGAGATGGAGAAGGG + Intronic
1147873098 17:43601612-43601634 CTACAGAAAGCGTTGGAGAAAGG + Intergenic
1148031514 17:44624586-44624608 AAAGAGGAAGAGAGGGAGACAGG + Intergenic
1148565416 17:48629717-48629739 CTAGAGGAAGGGAAGGAAATGGG + Intronic
1148816088 17:50329205-50329227 GTAGAGGAACAGAGGGACAAGGG + Intergenic
1149090576 17:52773353-52773375 CTTGAGGAAAAGAAGGAAAAAGG + Intergenic
1149459156 17:56813141-56813163 CCTGAGGAAGAGCTGCAGAATGG + Intronic
1149719004 17:58824117-58824139 TTAGAGAAAGGGTTGGAGAAAGG + Intronic
1150017580 17:61573772-61573794 CTATTGGAAGGGATGGAGGAAGG - Intergenic
1150545005 17:66147323-66147345 CTAGATTAAAAGATGGGGAAAGG - Intronic
1150556905 17:66262703-66262725 CTGGGGGCAGGGATGGAGAAGGG + Intergenic
1150856250 17:68755808-68755830 TAAAAGGAAGAGGTGGAGAAGGG - Intergenic
1151480512 17:74367846-74367868 GGAGAGGGAGAGATGGAGGAGGG - Intronic
1151574864 17:74947796-74947818 CTAGAGGAAGATGTTGATAATGG + Intronic
1151941026 17:77292076-77292098 GCCGAGGAAGAGATGGGGAAGGG - Intronic
1151996580 17:77613150-77613172 CTCCAGGAGGTGATGGAGAAGGG + Intergenic
1152060695 17:78072439-78072461 CTAGAGAGAGACATGGAGATGGG + Intronic
1152175764 17:78786163-78786185 AAAGATGAAGAGATGGGGAAGGG - Intergenic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152291906 17:79444547-79444569 CCAGAGGAAGTGGTGGAGAGAGG - Intronic
1152358959 17:79821377-79821399 CTAAAGGAAGGGAGGAAGAAAGG - Intergenic
1153954016 18:10080841-10080863 CAAGAGCAAGAGAGGGAGAGTGG - Intergenic
1154097100 18:11428567-11428589 CTAAAGGAAGAAATGGAAAAAGG - Intergenic
1155155153 18:23151445-23151467 ACAGAGGTAGAGATGGTGAAGGG + Intronic
1155227181 18:23738798-23738820 CTAGAGCAAGTGATGCAAAAAGG - Intronic
1155439851 18:25851024-25851046 ATAGAGAAAGAGATGAAAAAGGG - Intergenic
1155692411 18:28641958-28641980 TTAAAGGAAGAGATGCAGAAGGG + Intergenic
1155758166 18:29528555-29528577 CTAGTGGTGGAGAGGGAGAAGGG + Intergenic
1155833456 18:30547509-30547531 CTTGAGGAAAAGAGAGAGAAGGG - Intergenic
1155982921 18:32199404-32199426 CTAGTGGAAGTTATTGAGAAGGG + Intronic
1156381660 18:36567288-36567310 AGGGAGGAAGAGATGGAGGAAGG + Intronic
1156721741 18:40078627-40078649 ATAGAGGAAGAAAAGAAGAAAGG + Intergenic
1156918175 18:42486016-42486038 AAAGAGGAAGAGAAGGAGAGGGG - Intergenic
1157405524 18:47419459-47419481 CCAGAGGAAGAAAAGGAGAAGGG - Intergenic
1157572142 18:48720257-48720279 CTAGGGGATGAGATGGGGACGGG + Intronic
1158269235 18:55695030-55695052 AGAGAGAAAGAGAGGGAGAAAGG + Intergenic
1158313201 18:56181475-56181497 CTGTAGGAAGAAATGGAAAAAGG + Intergenic
1158409629 18:57193980-57194002 CTAGAGGTGGGGATGGGGAAGGG - Intergenic
1158489409 18:57896379-57896401 CAAGAGAAAGAGATAGAGAAGGG + Intergenic
1158662670 18:59402720-59402742 CTAGAGGGGAAGACGGAGAAAGG + Intergenic
1159271956 18:66164355-66164377 ATAAAGGAAGAGATGGAATATGG - Intergenic
1159351449 18:67280345-67280367 ATAGAGAAAGAGAGGAAGAAAGG + Intergenic
1159646909 18:70929963-70929985 ATTTAGGAGGAGATGGAGAAAGG - Intergenic
1160758664 19:771750-771772 GTAGAGGAGGAGGGGGAGAAAGG - Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160932187 19:1576086-1576108 CAAGAGGGAGAGATAGAGACAGG + Intronic
1161273102 19:3401145-3401167 GGAGAGGAAGAGAAGGAGGAGGG + Intronic
1161329076 19:3677914-3677936 ATAAAGGGAGGGATGGAGAATGG + Intronic
1161329329 19:3678784-3678806 ATGGAGGGAGGGATGGAGAATGG + Intronic
1161329376 19:3678930-3678952 GTGGAGGGAGGGATGGAGAATGG + Intronic
1161370591 19:3908799-3908821 AAAGAGGATGAGGTGGAGAAAGG - Intronic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1162071458 19:8154832-8154854 CTCGAGGAAGGCATGGAGACAGG + Intronic
1162134325 19:8545809-8545831 CTAAGTGATGAGATGGAGAAGGG - Intronic
1162320169 19:9966874-9966896 CAAGGGGCAGAGATAGAGAAAGG + Intronic
1162465240 19:10835788-10835810 CTAGAGTAAGAGATCCAGAGGGG - Intronic
1162666488 19:12217664-12217686 CTAGAGGAAGACAGGAAGAAAGG - Intergenic
1163039900 19:14594444-14594466 CAAGAGGAAGTGATGGAAACAGG - Intronic
1164526408 19:29016626-29016648 AGAGAGGAAGAGGAGGAGAAAGG - Intergenic
1164731055 19:30504589-30504611 AGAGAGGAAGAGTTGGAGAGAGG - Intronic
1165188839 19:34045204-34045226 AAAGAGGAAGAGAGGGAGAGAGG + Intergenic
1165475655 19:36028977-36028999 AAAGAGTAGGAGATGGAGAAGGG - Intronic
1165583834 19:36894844-36894866 CTAGGAGAAGAGATGGGCAAAGG + Intronic
1165599140 19:37037920-37037942 CTAAAAGAAGAGCTGGAGTAAGG + Intronic
1165640379 19:37380133-37380155 TTAGAGGAAGAGCTAGAGAATGG - Intronic
1166146309 19:40838741-40838763 AAGGAGGAAGAGATGGAGAAAGG - Intronic
1166289593 19:41853958-41853980 AAAGAGGAAGTGATGGAGATTGG + Intergenic
1166778978 19:45330211-45330233 AGAGAGGAAGAGAGGGAGGAAGG - Intergenic
1167124319 19:47538971-47538993 CTAGAGGATGAGGAGGAGTAGGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167277644 19:48548535-48548557 CTAGATGAATGGATGGAAAATGG + Intergenic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167633052 19:50637757-50637779 AAGGAGGAAGAGATGGAGAAGGG + Exonic
1167775590 19:51552659-51552681 GAAGAGGAAGAGAGGGAGAGGGG + Intergenic
1168373754 19:55858444-55858466 CTGAAGCAAGAGATGCAGAAAGG + Exonic
1168445186 19:56405533-56405555 AAAGGGGAAAAGATGGAGAAAGG + Intronic
1202710123 1_KI270714v1_random:14562-14584 ATTGAGGAAGACAAGGAGAAGGG - Intergenic
924973351 2:151372-151394 GTAGAGTAAAAAATGGAGAAAGG - Intergenic
925290633 2:2746067-2746089 CAAGAGGAAGAGAGAGAGAGCGG + Intergenic
925356659 2:3246746-3246768 AGAGAGGAAGAGAGGGAGGAAGG + Intronic
925539899 2:4955593-4955615 CTACATGAAGAAATGTAGAAAGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
926591510 2:14744824-14744846 ATGGAGGAAGGGATGCAGAATGG + Intergenic
927203093 2:20590562-20590584 CATGAGGAAGAGGTGGAGTACGG - Intronic
928221414 2:29406333-29406355 CTGGAGGAAGAAATGGAAACAGG - Intronic
928357719 2:30635306-30635328 AGAGAGGAGGAAATGGAGAATGG - Intronic
928394166 2:30931356-30931378 CAAGAGGAAAAGATGGAAAGAGG + Intronic
928952626 2:36826510-36826532 CTAGAGGAAAAGAAGGAGCAGGG - Intergenic
929013602 2:37472337-37472359 GAGGAGGAAGAGAAGGAGAAAGG + Intergenic
929224717 2:39500975-39500997 CTAGAGGAAGGGAAAGATAAGGG + Intergenic
929236562 2:39611174-39611196 ATAGAGTGAGATATGGAGAAAGG + Intergenic
929524489 2:42687868-42687890 CTGGAGTCAGAGATGAAGAAGGG - Intronic
929615108 2:43300526-43300548 CTACTGGAAGAAATGGAAAAAGG + Intronic
930246601 2:48990015-48990037 CAAAAGGAGGAGATGGGGAAGGG - Intronic
930423618 2:51184995-51185017 AGAGATGAAGAGAAGGAGAAGGG + Intergenic
930551625 2:52841796-52841818 AGAGAGGCAGAGATGGAGGAAGG + Intergenic
930599975 2:53431909-53431931 CTAGCAGAAGAGATGGACATTGG - Intergenic
930821273 2:55650133-55650155 GTAGAGGTAGAGGTGGAGAGAGG - Intronic
931046823 2:58363152-58363174 GTAGAGGATGAGCTGGAGCAGGG - Intergenic
931063694 2:58560376-58560398 GTATATGAAGAAATGGAGAAAGG + Intergenic
931071543 2:58657123-58657145 CTAGAGGAAGACGAGGTGAAGGG + Intergenic
931078007 2:58737929-58737951 AGAGAGGAAGAGAAAGAGAAAGG + Intergenic
931132823 2:59357195-59357217 CTACAGGCATAGATTGAGAATGG + Intergenic
931183981 2:59931757-59931779 GTTGGGGAAGAGATGGAGAGTGG + Intergenic
931312759 2:61097978-61098000 CTCTAAGAAGAGATGGAAAATGG - Intronic
931828691 2:66028166-66028188 CGAGAGGAAGAGAGAGAGAAGGG - Intergenic
931878995 2:66546536-66546558 CCAGGGGAAGAGATGGACAGAGG - Intronic
932000988 2:67884223-67884245 GCAGAGGAAGAGAAGGAGAAGGG - Intergenic
932080393 2:68709249-68709271 GTAGGGAAAGAAATGGAGAACGG - Intronic
932120950 2:69099600-69099622 GAAGAGAAAGAGATGGACAATGG - Intronic
932211596 2:69936021-69936043 CTGGAAGAAGGGCTGGAGAAAGG - Intronic
932387988 2:71356091-71356113 CTATGGGAAGAGGTGGAGATAGG - Intronic
933119807 2:78522367-78522389 GGAGAGGAAGAGAAGGAGAGTGG + Intergenic
933547385 2:83731606-83731628 AGAGAAGAAGAGATGAAGAAAGG + Intergenic
933555931 2:83830721-83830743 AGAGAGGAAGAGATGAAGAAAGG + Intergenic
933743174 2:85550930-85550952 TTAAAGGAAAAGGTGGAGAATGG - Exonic
933982660 2:87565784-87565806 CCAGAGGAAAAGAGGGAGGAAGG + Intergenic
934322209 2:91981033-91981055 CTAGAGGAAGAGCGGTGGAAGGG - Intergenic
934603355 2:95675819-95675841 GGAGAGGAAGAGAGGAAGAAGGG - Intergenic
934761873 2:96861038-96861060 CTGCGGGAAGAGCTGGAGAAAGG - Exonic
935498468 2:103809638-103809660 CGGGAGGAAGAGATAGTGAAGGG - Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
935839934 2:107098197-107098219 GTAGAGCCAGAGATGTAGAAAGG - Intergenic
936144049 2:109967358-109967380 AGATAGGAAGAGATGGAGAAAGG - Intergenic
936180731 2:110265319-110265341 AGATAGGAAGAGATGGAGAAAGG - Intergenic
936200638 2:110404111-110404133 AGATAGGAAGAGATGGAGAAAGG + Intronic
936259588 2:110947612-110947634 CTGGAGGCAGAGGGGGAGAAGGG - Intronic
936311180 2:111385009-111385031 CCAGAGGAAAAGAGGGAGGAAGG - Intergenic
936392746 2:112090213-112090235 CTAGAGGAAGTGATGTTCAAGGG + Intronic
936908228 2:117562153-117562175 AGAGAGGAAGAGAGGGAGAGAGG + Intergenic
937192685 2:120119614-120119636 AAAGAGAAAGAAATGGAGAAAGG - Intronic
937431427 2:121842011-121842033 CTAGAGAGAGAGAGAGAGAATGG + Intergenic
937730138 2:125220745-125220767 CCAGAAGAAGAGAAGGGGAAAGG - Intergenic
937837568 2:126487875-126487897 AAAGAGAAAGAGATGGAGAAAGG - Intergenic
938873468 2:135507337-135507359 CTATAGGGAGAGATAGAGAATGG + Intronic
938932332 2:136097779-136097801 CTAAAGGAAGAAACGTAGAAAGG - Intergenic
939267158 2:139889003-139889025 CTAGAGTAAGAGATAGGGCAGGG + Intergenic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
940580920 2:155578945-155578967 CTAGAGGCAGGGAAGGAGAAGGG + Intergenic
940687853 2:156876406-156876428 GCAGAGAAAGAGAGGGAGAAAGG - Intergenic
940852486 2:158701712-158701734 AGAGAGGAAGAGAGAGAGAAAGG - Intergenic
941090497 2:161169112-161169134 TTAAAGAAAGAGATGGACAAAGG + Intronic
941152870 2:161937379-161937401 GTGGAGGAAGAGATGGGGTATGG - Intronic
941221026 2:162781511-162781533 CTAGTGGAAGAGAATGAGGAAGG + Intronic
941573821 2:167205036-167205058 CTAGAGAGAAAGATGCAGAAAGG - Intronic
941862200 2:170294834-170294856 CTGGTGGAAGATATTGAGAATGG + Intronic
942256245 2:174101780-174101802 GAAGAGGAAGAGATGAATAAAGG + Intronic
942446985 2:176084688-176084710 AGAGAGGGAGAGAGGGAGAAAGG + Intergenic
942471499 2:176265420-176265442 CAGGAGGAAGAGAAAGAGAAGGG - Intergenic
942477991 2:176349292-176349314 GAAAAGGAAGAGAAGGAGAAGGG - Intergenic
942650722 2:178164601-178164623 CAAGAGGAAGAGAGAGAGAAGGG + Intergenic
942758375 2:179368538-179368560 ATAAAGGAAGGGAGGGAGAAAGG + Intergenic
943329913 2:186546784-186546806 CTAAAGGAAGTGAAGAAGAATGG - Intergenic
943483048 2:188446000-188446022 CTAGAGGAATGGCTGAAGAATGG - Intronic
943532091 2:189095470-189095492 CGAGAGAGAGAGAGGGAGAAAGG - Intronic
943924216 2:193750806-193750828 AAAGAGGGAGAGAAGGAGAATGG - Intergenic
944384044 2:199144323-199144345 CTAGAGGAAGAGGTGGTGGGAGG - Intergenic
944494251 2:200290541-200290563 GTAGAGAACGAGATAGAGAATGG + Intergenic
944754303 2:202743916-202743938 CCAGAAGAAGAGATGGTCAAAGG + Intronic
944812008 2:203336473-203336495 GCAGATGAAGAGATTGAGAAAGG - Intronic
945034760 2:205695479-205695501 GTAGAGGAAGGGATGGGGAAAGG + Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946211390 2:218150108-218150130 ATGGGGGAAGAGATGGTGAAAGG - Intergenic
946434270 2:219641576-219641598 TTGGAGGAGGAGCTGGAGAATGG + Intronic
946632797 2:221689451-221689473 GTAGAGAAAGAGGGGGAGAATGG + Intergenic
946708013 2:222478171-222478193 CGAGAGGGAGAGAGGGAGAGAGG + Intronic
946820131 2:223620585-223620607 CAAGAGGCAGAGATGGGGAAGGG - Intergenic
946949794 2:224861220-224861242 CTATAGAAAGAGATAGAAAAGGG + Intronic
947111196 2:226721350-226721372 CAAGAGGTAGAGGTGGAGAGAGG + Intergenic
947664112 2:231892508-231892530 CTAGAGGAAGGGAAAGAGATTGG - Intergenic
948041533 2:234905510-234905532 GAAGAGGAAGAGAGAGAGAAAGG + Intergenic
948751820 2:240137487-240137509 TTGGAGGAAGAGAGGGAGAGAGG + Intergenic
1169117020 20:3072340-3072362 CTGGAGGAAGAGGTGGAGTCAGG - Intronic
1169326629 20:4681984-4682006 CCAGAGGAAGAGACTGAAAAGGG - Intergenic
1170390403 20:15866904-15866926 CTACAGGACAAGATGGAAAATGG + Intronic
1170462650 20:16591941-16591963 ATAAAGGAAGAGAAGGAGTATGG + Intergenic
1170510042 20:17067140-17067162 CTAAAGGCAGAGGTGGTGAAAGG + Intergenic
1170721298 20:18881743-18881765 CCAGAAGAAGAGAGGGTGAAAGG - Intergenic
1170760599 20:19246784-19246806 ATAGAGATAGAGATAGAGAAAGG - Intronic
1170761307 20:19253770-19253792 CTTCTGGAGGAGATGGAGAAAGG + Intronic
1171028593 20:21655291-21655313 CTAGAGGAGGAGGTGAAGATTGG - Intergenic
1171385144 20:24764825-24764847 CTAAAGCAAGTGATGGGGAAGGG - Intergenic
1171526134 20:25813002-25813024 CTAGAAGCAGAGCTGGAGTAAGG + Intronic
1171550693 20:26042883-26042905 CTAGAAGCAGAGCTGGAGTAAGG - Intergenic
1172740722 20:37164366-37164388 AGAGAGGAAGAGAAGGAGGAGGG - Intronic
1173073408 20:39792460-39792482 TCAGAGGAAGAGATTGGGAAAGG + Intergenic
1173388426 20:42609677-42609699 CTAGAGGAAGAGAAGCTGGAAGG - Intronic
1173673871 20:44817116-44817138 CAAGAGGGAGGGAGGGAGAAAGG - Intergenic
1173751789 20:45482188-45482210 AAAGAGGAAGAAATAGAGAAGGG - Intergenic
1173838935 20:46144449-46144471 CCAGATGAAGAAAAGGAGAAGGG - Intergenic
1173902319 20:46600179-46600201 AGAGAGGAAGAGAGGGAGGAAGG + Intronic
1175344147 20:58259423-58259445 AGAAAGGAAGGGATGGAGAAAGG + Intergenic
1175689815 20:61057182-61057204 CCAGGGGAAGAGATGGCTAAAGG + Intergenic
1176870084 21:14076917-14076939 ACAGAGGAAGGGAGGGAGAAAGG + Intergenic
1177160914 21:17547004-17547026 CTAGAGAAAGAAATGTACAAGGG - Intronic
1177304331 21:19293161-19293183 CTAAAGCAAGACATGGATAAAGG - Intergenic
1177429379 21:20971074-20971096 AAAGAGGAAGAAATGGAAAAGGG + Intergenic
1178976192 21:37223129-37223151 TTAGAGCAAGAGATGAGGAAAGG - Intergenic
1179058558 21:37958285-37958307 TGAAGGGAAGAGATGGAGAATGG - Intronic
1179061477 21:37983235-37983257 CTAGAGGAAGGTAAGGAGGAAGG - Intronic
1179318459 21:40268171-40268193 CTTGAGAAAGACATGGAGATGGG - Intronic
1179470226 21:41605465-41605487 CGAGGGGAAGAGATTGTGAATGG - Intergenic
1179567486 21:42258334-42258356 ATAGAGGGAGGGATGGAGGAGGG - Intronic
1179607102 21:42523696-42523718 GGAGAGGAAGAATTGGAGAAAGG + Intronic
1179782523 21:43711139-43711161 CCAGAAGAGGAGAGGGAGAAAGG + Intergenic
1180024921 21:45155653-45155675 CTAGATGGAGAGATGGATGATGG - Intronic
1180204942 21:46253992-46254014 CAGGAGGAAGAGAGAGAGAAGGG - Intronic
1181360477 22:22330458-22330480 GGAGTGGAAGAGATGAAGAAAGG + Intergenic
1181759228 22:25046407-25046429 AGAGAGGAAGGGATGGAGAGAGG - Intronic
1181759232 22:25046423-25046445 AGAGAGGAAGGGATGGAGAGAGG - Intronic
1181865619 22:25852279-25852301 CAAGAGGATGTGATGAAGAATGG - Intronic
1181999251 22:26906789-26906811 ATGGAAGAAGGGATGGAGAAAGG + Intergenic
1182020171 22:27075060-27075082 GTAGAGGAAGAGATAGAAAGAGG + Intergenic
1182056239 22:27357434-27357456 CAGGAGGAAGAGAGGGAGAGAGG - Intergenic
1182100769 22:27655915-27655937 CTAGAGGGACAGATGGATGAGGG + Intergenic
1182266222 22:29117706-29117728 CATGAGGAACAAATGGAGAAAGG + Intronic
1182672167 22:32005532-32005554 AGAGAGGAAGAAAGGGAGAATGG + Intergenic
1182748258 22:32622264-32622286 CCAGAGGAGGAGGTGGAGATGGG - Intronic
1183274723 22:36886650-36886672 GTGGAGAAAGAGGTGGAGAAAGG - Intergenic
1183281488 22:36934973-36934995 TTAGAGGTGGAGATGGGGAAAGG - Intronic
1183400256 22:37599483-37599505 CTAGGAGAAGAGAAGGAAAAGGG + Intergenic
1184117890 22:42432555-42432577 CCAGAAGAAGAGCTGGAGACGGG + Intergenic
1184267386 22:43356302-43356324 CTAGAGGAAGAAAAGAAGGAAGG - Intergenic
1184281663 22:43440908-43440930 CAAAAGGAGGAGATGGAAAAGGG - Intronic
1184819657 22:46900058-46900080 CCAGAGGGAGAGAAAGAGAAAGG - Intronic
1185157469 22:49202833-49202855 GCAGAGAAAGAGATGGTGAAGGG + Intergenic
949305811 3:2639384-2639406 TTTGAGGAAGAGATGGAGTTGGG - Intronic
950465360 3:13150008-13150030 CTAGAGGGAGAGTGGGAGGAGGG + Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
950611750 3:14131472-14131494 GAAGAGGAAGAAATAGAGAAGGG - Intronic
950712906 3:14826274-14826296 GGAGAGGGAGAGAGGGAGAAAGG - Intronic
951027322 3:17843852-17843874 CAAGAGCAAGAGAGAGAGAAGGG - Intronic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951331539 3:21374985-21375007 CTAGAGGTAAAGAAGGAAAAAGG + Intergenic
951739577 3:25905675-25905697 GTATAGAAAGAGATGAAGAATGG - Intergenic
951935325 3:28016575-28016597 GCAGAGTAAGAGATAGAGAAGGG - Intergenic
951966542 3:28391875-28391897 CTAGAGAAAGACAGGAAGAAAGG + Intronic
952752307 3:36834719-36834741 TGGGAGGAAGAGAGGGAGAAAGG + Intronic
953111348 3:39942792-39942814 GTAGAGGGAGAGATGAAGAGAGG - Intronic
953111490 3:39944470-39944492 AAAGAGGAAGAGCGGGAGAAAGG + Intronic
953902569 3:46851626-46851648 CCAGAGGTGGAGGTGGAGAATGG + Intergenic
954748122 3:52798512-52798534 CAAGAGGAGGGGAGGGAGAAAGG - Intronic
955139477 3:56255148-56255170 GTAGATGAAAAGATGGAGAAAGG - Intronic
955236514 3:57144340-57144362 GAGGAGGAAGAGATGGTGAACGG - Intronic
955776575 3:62440216-62440238 AAAAAGGAGGAGATGGAGAAAGG - Intronic
956046881 3:65205184-65205206 AGAGAGGAAGAGAGAGAGAAAGG + Intergenic
956493964 3:69804356-69804378 GTTGAGGAAAAGGTGGAGAAGGG - Intronic
956552873 3:70481278-70481300 TTGGAGGAAGAGAAGGAGTAGGG + Intergenic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
957085161 3:75670811-75670833 GAAGAGGGAGAGAGGGAGAAAGG + Intergenic
957723055 3:84030022-84030044 AAAGAGGAAGAAATGAAGAAAGG + Intergenic
958019325 3:87978761-87978783 CTAGAAGGAGAGAGGGAGAGAGG + Intergenic
958596455 3:96231617-96231639 CTAGATTTAAAGATGGAGAATGG - Intergenic
958816033 3:98916669-98916691 ATAGAGGAGGACATGAAGAATGG + Intergenic
959600333 3:108175720-108175742 CTAGAGCTAGAGATGGTAAATGG + Intronic
959864682 3:111252793-111252815 CTTGAGGAAGAAAGAGAGAAAGG + Intronic
960633339 3:119755509-119755531 ATGGAGGAAGAGAGGGAGAAAGG - Intronic
960656518 3:120010404-120010426 CTAAATGAAGAGATCCAGAAAGG + Intronic
961345280 3:126260095-126260117 GGAGAGGAAGAGGTGGAGAGGGG - Intergenic
961494028 3:127277634-127277656 CTTAAGGAAGAAGTGGAGAATGG - Intergenic
962037163 3:131664100-131664122 TTAGAGAAAGAGATAGAAAATGG + Intronic
962317631 3:134368670-134368692 CTACTAGAAGAGATGGAGGATGG - Intronic
962412483 3:135153310-135153332 CTAGGGGAAGAGGTGGGTAATGG - Intronic
962465757 3:135657077-135657099 CTAGAGGAAGACAGGAAGGAAGG + Intergenic
962779938 3:138703753-138703775 CTAAAGGAAGAAGTGGAGAATGG - Intronic
962810134 3:138952374-138952396 CCAGAGGAAGGGAGGGAGAAGGG + Exonic
963038830 3:141053892-141053914 GGTGAGGAAGAGGTGGAGAAGGG - Intronic
963386979 3:144610002-144610024 TTAAAGGAAGAGAGGGAGGAAGG - Intergenic
963388073 3:144622059-144622081 AAAGAGGAAGAAAGGGAGAAGGG + Intergenic
963415398 3:144989288-144989310 CTAGAGGAAGATGTGAAGAAAGG + Intergenic
963765389 3:149329645-149329667 GAAGAGGATGAGAAGGAGAATGG + Intronic
963872070 3:150427801-150427823 GGAGAGGAAGAGAAGAAGAAAGG - Intronic
964173062 3:153793742-153793764 CAGGAGGAAGAGATAAAGAAGGG - Intergenic
964570874 3:158106251-158106273 GAAGAGGAAGAGGGGGAGAAGGG + Intronic
964890395 3:161527623-161527645 CTTGAGGATAAGATGGAGAAGGG + Intergenic
965272265 3:166633326-166633348 CAAGAGGAAGAAATGAGGAAAGG + Intergenic
965303793 3:167038249-167038271 CTAGTGGAGGAGATGGAGAAAGG + Intergenic
965512471 3:169583479-169583501 CTACAGGAAGAGAAAGAGAGAGG - Intronic
965525876 3:169717668-169717690 CAAAAAGAAGAGATGGGGAAAGG + Intergenic
965634008 3:170762691-170762713 CTTAAGGAAGACATGGAAAAAGG + Intronic
966035441 3:175407633-175407655 CTAGAGGGAGAAAGTGAGAAAGG + Intronic
966266222 3:178047709-178047731 CGAAAGGAAAAGAAGGAGAAAGG + Intergenic
966889930 3:184399477-184399499 TTAGAGAAAGGGATGGATAACGG + Intronic
966917917 3:184594882-184594904 GAAGAGGAAGAGGAGGAGAAGGG + Intronic
966959031 3:184914958-184914980 CTAGAAGAAAAGAATGAGAATGG - Intronic
967135859 3:186512107-186512129 CCAGATGAAGAGAGGGAGAGAGG + Intergenic
967467098 3:189820204-189820226 CTAGAGCAAGTGATGTAGATGGG + Intronic
967501149 3:190199846-190199868 CTAGAGGAAGAGAAGGACTCAGG + Intergenic
967587675 3:191234813-191234835 ATAGAGGAAGAGGAGGAGAGAGG - Intronic
967679440 3:192342978-192343000 GAAGAGGAAGAGAGGGAGAGAGG + Intronic
967783036 3:193460165-193460187 CCAGAGGGAGAGAGGGTGAAGGG - Intronic
967853395 3:194098632-194098654 GGAGAGGAAGGGAGGGAGAAAGG + Intergenic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
968171901 3:196517543-196517565 ATAGAGGAAGATATGGTGGAGGG - Intergenic
968303031 3:197630567-197630589 ATACCGTAAGAGATGGAGAAAGG - Intergenic
968940836 4:3636780-3636802 CAAGAGGAAGAGGTGCAGCAGGG - Intergenic
969093812 4:4717519-4717541 CAAGAGGAGAAGCTGGAGAAAGG - Intergenic
969128302 4:4970921-4970943 GGAGAGGGAGAGATGGAGAAAGG - Intergenic
969623763 4:8292240-8292262 TTAGAGGCAGATCTGGAGAAGGG + Intronic
970224556 4:13844119-13844141 ATGGAGGAAGGGAGGGAGAAAGG - Intergenic
970566206 4:17334724-17334746 CGGGAGGAAGAGAGAGAGAATGG - Intergenic
970607238 4:17692170-17692192 CGAGAGGAAGAGATGGAGGGAGG + Intronic
971046794 4:22813943-22813965 TTACAGGAAGAGATAGAGATTGG - Intergenic
971061552 4:22977776-22977798 CCAAAGCATGAGATGGAGAAAGG + Intergenic
971361986 4:25946596-25946618 GGAGAAGAAGAGGTGGAGAAAGG + Intergenic
971392710 4:26201035-26201057 TAAGAGTAAGAGATGGTGAATGG - Intronic
971531566 4:27695183-27695205 CTAGAGGATTAGGTGAAGAAAGG - Intergenic
971719349 4:30225724-30225746 ATAGAGAACAAGATGGAGAATGG - Intergenic
971954867 4:33403557-33403579 CTGGAGAAAGAGAGGAAGAAAGG - Intergenic
972736242 4:41844431-41844453 CTAAAGCAAGACAGGGAGAATGG - Intergenic
972945049 4:44243789-44243811 GAAAAGGAAGAGAAGGAGAATGG + Intronic
972948797 4:44292469-44292491 CTAGAAGTAGAGAGGGAGGAAGG + Intronic
972996872 4:44891313-44891335 CTAAAGGAAGACAGGGAGGAAGG - Intergenic
973344671 4:49041783-49041805 ATAGAGGAAGGGATAAAGAAGGG + Intronic
973555482 4:52077353-52077375 AAGGAGGAAGAGATGGAGAGAGG - Intronic
973767443 4:54176059-54176081 CTAGAAGGACAGATGGAGAGAGG + Intronic
973831896 4:54769908-54769930 CTAGATGGAGAGTGGGAGAATGG - Intergenic
973930376 4:55787388-55787410 AGAGTGGGAGAGATGGAGAAAGG + Intergenic
974682709 4:65183771-65183793 CTAAAGGAAGGGAGGGAGAGAGG - Intergenic
975177557 4:71305606-71305628 CTAGTGGTAAAGATGGGGAAAGG - Intronic
975209523 4:71683173-71683195 AGAGAGGAAGAGAGGAAGAAAGG - Intergenic
975860178 4:78668753-78668775 GAAGAGGAAAAGAGGGAGAATGG + Intergenic
976206624 4:82628601-82628623 TTGGAGGAAGAGTTGGACAAAGG - Intergenic
977534180 4:98237833-98237855 GTAGAGGAAGGTATGGAGAGAGG + Intergenic
977745403 4:100541213-100541235 GTATAGGAAAAGATGAAGAAAGG + Intronic
978056326 4:104272511-104272533 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
978230818 4:106396333-106396355 CCAGAGAAAGAGAGAGAGAAAGG - Intergenic
978603377 4:110451590-110451612 GAAGAGGAAGAGAAAGAGAAGGG + Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978792570 4:112678046-112678068 CTAAATGAAGTGATGGAGCAAGG - Intergenic
979251474 4:118571137-118571159 CTAGAGTAAGAGATGGACGAAGG + Intergenic
979926780 4:126577449-126577471 ATTCAGGAAGAGGTGGAGAAGGG - Intergenic
980081879 4:128352857-128352879 AGAAAGGAAGAGATGGAAAAGGG - Intergenic
981108224 4:140905621-140905643 CTAGTGAAAGGGGTGGAGAAAGG + Intronic
981538836 4:145827291-145827313 GAAAAGGAAGAGATAGAGAAGGG + Intronic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
981968468 4:150635457-150635479 TTAGAGGCAGAGAGGGAAAATGG - Intronic
982754047 4:159197784-159197806 CTAGAGGAGGTGTGGGAGAAAGG - Intronic
982785817 4:159535372-159535394 AGAGAGGAAGAGATGAACAAAGG - Intergenic
983294992 4:165855862-165855884 GTAGAGGAAACGTTGGAGAAGGG - Intergenic
984745006 4:183206644-183206666 GTAGAGGAAGGGGTTGAGAATGG - Intronic
985112482 4:186560222-186560244 CAAGAGGAAGAGAGAGAGGAGGG + Intergenic
985669354 5:1199170-1199192 ATAGAGGCAGAGAAGGAGAGAGG - Intergenic
986008473 5:3688161-3688183 CTAGGGGGAGAGAGGGAGAAAGG - Intergenic
986015235 5:3751789-3751811 ATAGAGGAAGAGAGGAAGGAAGG + Intergenic
986259895 5:6134914-6134936 CCTGAGGAAGAGTGGGAGAAAGG + Intergenic
986426304 5:7635251-7635273 GTAGAGGATGGGTTGGAGAAGGG + Intronic
986512238 5:8519787-8519809 CCAGAGGAAGAGAATTAGAATGG - Intergenic
986859802 5:11913362-11913384 ACAGAGGAAGAAATGCAGAAGGG + Intergenic
986936647 5:12896269-12896291 CTAGAGGGAGGGAGGGAGGATGG + Intergenic
987056154 5:14194438-14194460 TTAGGTGAAGAGGTGGAGAAGGG + Intronic
987126531 5:14818293-14818315 CAAGAGGGAGAGGAGGAGAAGGG - Intronic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
987363910 5:17131234-17131256 CCAGAGTCTGAGATGGAGAAAGG - Intronic
987518612 5:18948382-18948404 GAAGAGGAAGAGATGGGTAAAGG + Intergenic
987551401 5:19386638-19386660 CAAGAGGAAGAAAAGGAGGAGGG + Intergenic
987589241 5:19902374-19902396 CAAGAGGGAGGGAGGGAGAAAGG - Intronic
987706690 5:21468346-21468368 CTGGAGGAAGAAATGCAGCACGG + Intergenic
987859895 5:23471160-23471182 ACATAGCAAGAGATGGAGAAAGG + Intergenic
988331234 5:29843291-29843313 AGAGAGGAAGAGAGAGAGAAAGG + Intergenic
989366317 5:40659626-40659648 TGAGAGGTAGAGATGGAGAGAGG + Intergenic
989774459 5:45186671-45186693 CTAGGGAAAGAGCTGGAAAATGG - Intergenic
990454873 5:55975318-55975340 CAGGAGGAAGAGAGAGAGAAAGG - Intronic
991006736 5:61835356-61835378 TTGGAGGAAGAGGTGGACAATGG + Intergenic
991036189 5:62130366-62130388 AGAGAGGAAGGGAGGGAGAAAGG + Intergenic
991250886 5:64559694-64559716 CTAGTGGAAGAAATGAAAAAAGG + Intronic
991966697 5:72098798-72098820 CAACAGGCAGAGATGGAGAAAGG - Intergenic
992981634 5:82180776-82180798 CTAGAGGCAGAAAAGGAAAATGG - Intronic
993047549 5:82885249-82885271 CCAGAGGAAGAGGAGGAGCAAGG + Intergenic
993426670 5:87773620-87773642 GTAGAGGATGAGTTGGAGAAAGG - Intergenic
994371583 5:98973390-98973412 GAAGAGGAAGAGGAGGAGAAAGG + Intergenic
994666431 5:102711010-102711032 CTAAGGGAAAAGATGGATAAAGG + Intergenic
994722823 5:103400469-103400491 CTAGAGGAAGCAATGCAGGAAGG + Intergenic
995442624 5:112208573-112208595 CTAGAGGAGGAGAGGGGGCAAGG + Intronic
995558221 5:113352724-113352746 CTATAGTAAGAGATGAGGAAGGG + Intronic
996113180 5:119589689-119589711 ATTGAGGTAGAGATGGATAAAGG - Intronic
996340573 5:122434498-122434520 CTAGAGGAAAATATGGAAATTGG + Intronic
996602344 5:125278988-125279010 ATAGTGGAAGAGATGGGGGAAGG - Intergenic
996641904 5:125764931-125764953 AGAGAGAAAGGGATGGAGAAAGG - Intergenic
997552296 5:134764005-134764027 CTAGAAGTAGAGATAGAGATAGG + Exonic
998084574 5:139308080-139308102 ACAGATTAAGAGATGGAGAAAGG + Exonic
998854868 5:146385010-146385032 CTAGAGAAAGAGTTGCAAAAAGG - Intergenic
999216302 5:149938420-149938442 CCAGAGGAAGTGCTGGTGAAGGG + Intronic
999272266 5:150303315-150303337 GTAGAGAAAGCGATGGAGAATGG + Intronic
999690287 5:154140546-154140568 CCAGAGGCAGAGATGGAGCTAGG - Intronic
1000156710 5:158559389-158559411 GCAGAGAAAGAGATGGGGAAGGG - Intergenic
1000579437 5:163017136-163017158 CTGGAGCAAGAGAACGAGAAAGG - Intergenic
1000801717 5:165736110-165736132 CTAGAAGAAGAGATGCGAAAAGG - Intergenic
1000926217 5:167197909-167197931 ATAGAGAGAGAGAGGGAGAAAGG + Intergenic
1000944239 5:167400717-167400739 TCAGTGGAAGAGATGGAGAAAGG + Intronic
1001075578 5:168625337-168625359 AGAGAGGAAGAGAGGGAGAGAGG - Intergenic
1001131982 5:169071880-169071902 TTAGAGGAAGAAGGGGAGAAAGG + Intronic
1001347168 5:170914589-170914611 GTTGAGGAAGAGTTAGAGAAGGG - Intronic
1001412601 5:171521406-171521428 CAAGAGGAAGAAATGAATAAAGG - Intergenic
1001496331 5:172189796-172189818 CGAGAGAAAGAGAGAGAGAAAGG + Intergenic
1001634319 5:173198836-173198858 GAAGAGGGAGAGAGGGAGAAAGG - Intergenic
1001839551 5:174863593-174863615 CTAGAAGGAGACAGGGAGAATGG - Intergenic
1002170154 5:177370462-177370484 CTAGAGGAAGGGATGGAGGGTGG - Intronic
1003016078 6:2468488-2468510 AGAGAGGGAGAGAGGGAGAAAGG + Intergenic
1003060892 6:2861305-2861327 AGAGAAGAAGAGAAGGAGAAGGG - Intergenic
1003136013 6:3435298-3435320 CAGGAGGAAGAGATGAGGAAGGG - Intronic
1003219459 6:4145749-4145771 CTTCACGAAGAGATGGAGGATGG - Intergenic
1003667013 6:8120883-8120905 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1003683643 6:8279800-8279822 CTGGAGGAAGAAATGCAAAAGGG + Intergenic
1003704122 6:8505438-8505460 TTAAAAGAAGAGATGGAGAATGG + Intergenic
1004154817 6:13158243-13158265 CTTGGGGAAGGGCTGGAGAAGGG - Intronic
1004859972 6:19793884-19793906 AGAAAGGAAGAGAAGGAGAAGGG + Intergenic
1005216733 6:23537487-23537509 CAAGAGGAAGAGAGAGAGATGGG + Intergenic
1005379355 6:25217791-25217813 CCAGAGGGAGAGAGGGAGACAGG + Intergenic
1005768946 6:29045271-29045293 GTAGAGGAGGAGAAGGAGGAGGG + Intergenic
1005809683 6:29506345-29506367 ATGGGGGAAGAGATGGAAAAAGG - Intergenic
1006038722 6:31235516-31235538 CCAGAGCAACAGTTGGAGAATGG - Intergenic
1007679313 6:43623578-43623600 CTATCAGAAGAGCTGGAGAACGG - Intronic
1007768025 6:44172637-44172659 GGAGAGGAAGAGAAGGAGAAGGG - Intronic
1008034739 6:46734319-46734341 AGAGAGGGAGAGAGGGAGAAGGG + Intronic
1008191890 6:48468890-48468912 CTAGAGGAAGGGAGGTAGGAGGG + Intergenic
1008271437 6:49494949-49494971 CTAGTGGAGCAGATGGAGCAGGG + Intergenic
1008384636 6:50874812-50874834 GTAGAAAAAGAGATAGAGAAAGG - Intergenic
1008577672 6:52876803-52876825 CTAGGGCAAGATATGGGGAAGGG + Intronic
1008584554 6:52936993-52937015 CCAGAGGAAGAGGAGGAGAGAGG - Intergenic
1009593641 6:65708428-65708450 AGAAAGGAAGAGAGGGAGAAAGG - Intergenic
1009949077 6:70374891-70374913 TTGGAGGAAGAGATAGAGATAGG + Intergenic
1010107521 6:72187141-72187163 GGAGAGGAAGAGAGGAAGAAAGG + Intronic
1010299281 6:74241307-74241329 CTAGAGGAAGACAGGAAGAAAGG - Intergenic
1010481719 6:76363152-76363174 CTAGAGGATGAGAAGGATAGTGG - Intergenic
1010560067 6:77338417-77338439 TTAAAGGAAGACATGGAGGAAGG - Intergenic
1010874578 6:81086585-81086607 CCAGAGGAGGTCATGGAGAAAGG - Intergenic
1011000759 6:82585519-82585541 CTGGAGGAAGAAGTAGAGAAAGG - Intergenic
1011907146 6:92385982-92386004 CTAGTGGGAGAAATGGAGGATGG - Intergenic
1013287054 6:108690822-108690844 ATAGGGAAAGAAATGGAGAAAGG + Intergenic
1013763372 6:113545088-113545110 CAAGATGAAGAGAGCGAGAAGGG - Intergenic
1014157862 6:118132949-118132971 CTAGAGGAAGGCATGGAGATGGG + Intronic
1014273912 6:119365395-119365417 AGAGAGGGAGAGAGGGAGAAAGG + Intergenic
1014420675 6:121241016-121241038 CAAGAAGAAAAGAGGGAGAAAGG + Intronic
1014474390 6:121854457-121854479 AAAGAGGATGAGAGGGAGAAGGG - Intergenic
1014737509 6:125111649-125111671 AAGGAAGAAGAGATGGAGAAAGG - Intergenic
1014739919 6:125137271-125137293 CTAGAGAAAGACAAGGAAAATGG - Intronic
1014886093 6:126783414-126783436 TGAGAGAAAGAGAAGGAGAAGGG - Intergenic
1014933245 6:127358543-127358565 ATAGAGGAAGAGAAAGAGAAAGG - Intergenic
1015300479 6:131647622-131647644 GTAGAGGAGGTTATGGAGAAAGG - Intronic
1015367518 6:132413787-132413809 TTGGAGGAAGAGAGGGAGAGAGG - Intergenic
1015614810 6:135063663-135063685 TTGGAGGCAGAGAAGGAGAAAGG + Intronic
1015841685 6:137483875-137483897 ATAGAGGAATAGAGGAAGAAAGG + Intergenic
1016416380 6:143838929-143838951 CTAGAGGCAGAGATGGTGTAGGG + Intronic
1016925761 6:149346104-149346126 ATAGATGAAGAGAGGGAGGAAGG + Intronic
1018069952 6:160155536-160155558 GTGGAGGAAGAGATAGGGAAAGG + Intronic
1018209968 6:161471166-161471188 ATAGAGGGAGAGACAGAGAAAGG + Intronic
1018424694 6:163669773-163669795 GCAGAGGAAGGGAAGGAGAAGGG + Intergenic
1018627027 6:165789956-165789978 GGAGAGGAAGAGAAAGAGAAAGG + Intronic
1018961675 6:168453867-168453889 AGAGAGACAGAGATGGAGAATGG - Intronic
1019789629 7:3002660-3002682 CGGGAGGAAGAGAGAGAGAAGGG + Intronic
1019897438 7:3993682-3993704 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
1020431605 7:8121398-8121420 CTAGAGCAAGAGACAGAAAATGG + Intronic
1020803182 7:12756954-12756976 CTTCACGAAAAGATGGAGAAAGG - Intergenic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1021150462 7:17144578-17144600 CCACACGGAGAGATGGAGAAGGG + Intergenic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022285392 7:28952192-28952214 CTAGAAAAAGAGGAGGAGAAGGG + Intergenic
1022508575 7:30921658-30921680 CTAGGAGAAGAGATGCAAAAAGG - Intronic
1022959849 7:35416005-35416027 CTCTAGGAAGAGATGGAGGCTGG - Intergenic
1023503983 7:40881066-40881088 GTGGAGGATGAGATGGTGAAGGG - Intergenic
1023507004 7:40910189-40910211 ATAGAGGAAGAGTTGGAGACAGG + Intergenic
1023673831 7:42608935-42608957 CTAGAGGAAGCCAGAGAGAAGGG + Intergenic
1023829125 7:44028977-44028999 CTAGAGAATGGGAGGGAGAACGG - Intergenic
1025299542 7:57807136-57807158 CTAGAAGCAGAGCTGGAGTAAGG - Intergenic
1026110511 7:67455399-67455421 CCAAAGGAAGGGATGGAGAAAGG + Intergenic
1026611658 7:71865306-71865328 CTGGAGGAAGAGATAGAGAGGGG - Intronic
1026629822 7:72028507-72028529 AGAGAAGAAGCGATGGAGAAGGG + Intronic
1026834832 7:73631750-73631772 AGAGAGGGAGAGAGGGAGAAGGG - Intergenic
1027795651 7:82690691-82690713 CTAGAGAAAAAGGTGGAGGAAGG - Intergenic
1028246673 7:88487374-88487396 AAAGAGGAGGAGAAGGAGAAGGG + Intergenic
1028454009 7:91018718-91018740 CAGGAGGAAGAGACAGAGAAGGG - Intronic
1029021720 7:97371310-97371332 CTAGGGGGAGTGATAGAGAAGGG + Intergenic
1029704460 7:102268786-102268808 CAGGAGGAAGAGAGAGAGAATGG + Intronic
1029739426 7:102483234-102483256 CTAGAGAATGGGAGGGAGAACGG - Exonic
1029757427 7:102582413-102582435 CTAGAGAATGGGAGGGAGAACGG - Exonic
1029775367 7:102681474-102681496 CTAGAGAATGGGAGGGAGAACGG - Intergenic
1030085749 7:105813995-105814017 ATGGAGGAAGAGAGGAAGAAAGG - Intronic
1030266583 7:107628402-107628424 GTAGAGGAGGAGAGGGAGGAGGG + Intronic
1030290611 7:107868721-107868743 GAAGAGGAAGAAATGGAGAAGGG + Intergenic
1030290617 7:107868778-107868800 GAAGAGGAAGAAATGGAGAAGGG + Intergenic
1031035221 7:116781237-116781259 CTAGAGGCAGAGAGAGAGAGGGG - Intronic
1031224822 7:119022490-119022512 GAAGGAGAAGAGATGGAGAAAGG + Intergenic
1031488114 7:122354362-122354384 ATAGATGAAGTGATGGAGCAAGG + Intronic
1031649319 7:124267104-124267126 ATAGAGGAAGAGAGAGAGTAGGG - Intergenic
1031839707 7:126723160-126723182 CTAGATGAAGAGGCAGAGAAAGG - Intronic
1031985029 7:128158637-128158659 CCAGAGGAGGAGATGGAGGATGG - Intergenic
1031985526 7:128162403-128162425 CTAGAGGAAGAGACATAGATGGG - Intergenic
1032087661 7:128892274-128892296 CTAGAAGAGGAAATGGAGCATGG + Intronic
1032246907 7:130221108-130221130 CTATTGGAAGATATGGACAATGG + Intergenic
1032516001 7:132506754-132506776 CCAGAGGGAGAGCAGGAGAAGGG - Intronic
1032625124 7:133583689-133583711 CTGAAGGGAGAGATGGGGAAAGG + Intronic
1032685723 7:134231711-134231733 AGGGAGGAAGAGAGGGAGAACGG - Intronic
1032685732 7:134231743-134231765 AGGGAGGAAGAGAGGGAGAACGG - Intronic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1033682776 7:143612095-143612117 TAAGAAGAAGAGATGAAGAAAGG - Intergenic
1033701837 7:143845548-143845570 TAAGAAGAAGAGATGAAGAAAGG + Intergenic
1033883428 7:145915929-145915951 CTAAAGGAAGAAAGGGAGAATGG + Intergenic
1034900521 7:154905610-154905632 AGAGAGAAAGAGAGGGAGAAGGG - Intergenic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035318870 7:158015466-158015488 AGAGAGGAAGAGAGGGAGAGAGG + Intronic
1035496412 7:159331171-159331193 CTAGATGCAGACATGGAGGACGG - Intergenic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1036126561 8:6068453-6068475 ATAGAGGAAGGGAGGGAGTAAGG - Intergenic
1036487235 8:9190237-9190259 CTTGAGGAAAGGATGGAGGATGG - Intergenic
1036644495 8:10603172-10603194 ATTGAGTGAGAGATGGAGAAAGG + Intergenic
1037008877 8:13816399-13816421 ATAGAAAAAGAGAGGGAGAAAGG - Intergenic
1037168574 8:15861588-15861610 CTAGGAGAAGAGATAAAGAATGG - Intergenic
1037169497 8:15874170-15874192 AGAGAGGGAGAGAGGGAGAAAGG - Intergenic
1037653740 8:20865421-20865443 AGAGAGGAAGACAGGGAGAAAGG - Intergenic
1038054223 8:23843101-23843123 AGAGAGGAAGAGAGGGAGGAGGG - Exonic
1038401913 8:27289999-27290021 TTAGAGGGAGAGGTGGACAATGG - Intronic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1039257909 8:35739316-35739338 GCAGAGGAAGAGATAGAAAAGGG + Intronic
1039343998 8:36683965-36683987 CTTTAGGAAGAGTGGGAGAAAGG - Intergenic
1039365924 8:36927929-36927951 CTAGAGGGAGGGAGGGAGGAAGG + Intronic
1039396657 8:37231610-37231632 AGAGAGGAAGGGAAGGAGAAAGG + Intergenic
1039428542 8:37506608-37506630 AGAGAGGGAGAGATGGAGAGAGG + Intergenic
1040031509 8:42829005-42829027 CCAGAAGAAGAGAGAGAGAAAGG - Intergenic
1040279276 8:46029991-46030013 ACAGAGGAAGGGAGGGAGAAAGG + Intergenic
1040709913 8:50175681-50175703 ATACATGAAGAAATGGAGAAAGG + Intronic
1040773161 8:51003952-51003974 CTATAGGAAGTAATGGACAAAGG + Intergenic
1041152127 8:54945329-54945351 CTTGATGAAGAAATGGAGAAGGG - Intergenic
1041273203 8:56129929-56129951 GAAGAGGAAGAGGAGGAGAAAGG + Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1042007023 8:64192621-64192643 CTTGAGAAAGAGATAGAAAAAGG + Intergenic
1042018043 8:64338937-64338959 ACAGAGGAGGAGATGGATAAAGG + Intergenic
1042110407 8:65375731-65375753 CTGGAGGAAGAGATGCAGCCAGG - Intergenic
1042863930 8:73340361-73340383 ATAAAGGAAGAGATGAAGAAAGG + Intergenic
1042863934 8:73340409-73340431 ATAAAGGAAGAGATGAAGAAAGG + Intergenic
1043057226 8:75454098-75454120 GGAGAGGGAGAGAGGGAGAAAGG - Intronic
1043112296 8:76201140-76201162 ATAGAGGAAGTGATGGGGATGGG + Intergenic
1043827307 8:84944699-84944721 ATAAAGGAAGAGAATGAGAATGG - Intergenic
1043859626 8:85300749-85300771 ATGGAGGAGGAGATGGAAAAGGG + Intergenic
1044467867 8:92527494-92527516 CCAGAGGAAGAGATTGACAAAGG + Intergenic
1044598747 8:93983184-93983206 CTAGAGGGAGCGATAGAGGACGG - Intergenic
1044742934 8:95345924-95345946 CAAGAGGAAGAGAGAGGGAAGGG - Intergenic
1044817784 8:96130787-96130809 AGAGAGGAAGAGATGGAGTGAGG - Intergenic
1045155299 8:99462177-99462199 CAAAAGGAAGAGATGGAGGGAGG - Intronic
1045281001 8:100749702-100749724 ATGGAGGAAGAGGAGGAGAACGG + Intergenic
1045320697 8:101079901-101079923 AAAGAGGAAGAGAGGGAGAAAGG - Intergenic
1045355659 8:101386711-101386733 CTAGAGTCAGAAAAGGAGAATGG + Intergenic
1045403516 8:101842357-101842379 GAAGAGGAAGAAAGGGAGAATGG + Intronic
1045404894 8:101856069-101856091 GAAGAGGAAAAGATGAAGAATGG + Intronic
1045537728 8:103048044-103048066 CTAGAGGCAGACATGGAATAAGG + Intronic
1045576548 8:103427786-103427808 CTAAGGGAAGAGTTGGAGATTGG + Intronic
1046826320 8:118695749-118695771 CAAGAGGAAGAGAAAGAAAAGGG + Intergenic
1046986344 8:120392149-120392171 CTAGAGTGTGAGAAGGAGAAAGG - Intronic
1047056656 8:121172295-121172317 ATAGAGGAAGGGAGGGAAAAAGG + Intergenic
1047349683 8:124061823-124061845 AGAGAGGATGAGATGAAGAAGGG - Intronic
1047614948 8:126556376-126556398 AGGGAGGAAGAGAGGGAGAAAGG + Exonic
1047622999 8:126627180-126627202 CTAAAGGAAGAGGGGAAGAATGG + Intergenic
1047623034 8:126627732-126627754 CCTGAGGAACATATGGAGAAAGG - Intergenic
1047691590 8:127360379-127360401 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048380426 8:133860508-133860530 GGAGAGGAAGAGATTGAGATGGG - Intergenic
1048451092 8:134534636-134534658 AGAGAGGGAGAGAGGGAGAAAGG + Intronic
1048452361 8:134544647-134544669 CTAGAAGAAAAGGTGGAGGAGGG + Intronic
1048467993 8:134683540-134683562 CTGGAGGAAGGAAAGGAGAAGGG + Intronic
1048573890 8:135676237-135676259 CTGGAGGAAGCCATGGAGATAGG - Intergenic
1049450134 8:142656617-142656639 ACAGTGGAAGTGATGGAGAAAGG - Intergenic
1049502906 8:142977265-142977287 CATGAGGAAGTGATGGAGATTGG + Intergenic
1050034695 9:1423163-1423185 CAAGAAGAAGAAATGGGGAAAGG - Intergenic
1050098323 9:2091305-2091327 CTATAGACAGGGATGGAGAACGG - Intronic
1050267466 9:3906000-3906022 ATGGAGCAAGATATGGAGAAAGG + Intronic
1050982479 9:12037362-12037384 CCAGAGGGAGACAGGGAGAATGG + Intergenic
1051182548 9:14426654-14426676 CTAGAGGAATGGTTGGAGGAAGG - Intergenic
1051243708 9:15086849-15086871 CTTGAGGAACAGATGTAGCAAGG - Intergenic
1051334674 9:16055093-16055115 TTAGAGAAAGAGAAGGACAAAGG + Intronic
1051388631 9:16539532-16539554 AGAGAGGAAGAGAGGGAGAGAGG + Intronic
1051525347 9:18036833-18036855 CTAAAAGAAGAGATGATGAAAGG - Intergenic
1052141090 9:24984917-24984939 CAAGAGAGAGACATGGAGAAGGG + Intergenic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1052415593 9:28172638-28172660 CTTCAGGGAAAGATGGAGAAAGG + Intronic
1052489926 9:29152645-29152667 CTATAGGAGGAAATGGGGAAAGG + Intergenic
1053103299 9:35389737-35389759 CTAGAGGAAGAGGTATAGGAAGG + Intronic
1053284294 9:36840411-36840433 CTGGAGGAAGAGAGGAAGAGGGG + Exonic
1053375422 9:37601906-37601928 CCAGATGAAGAGATAGAAAAAGG - Intronic
1053472245 9:38355179-38355201 AGAGAGGAAGAGATGGAGGGAGG + Intergenic
1054151131 9:61605935-61605957 CTAGAAGCAGAGCTGGAGTAAGG - Intergenic
1054182451 9:61920931-61920953 CTAGAAGCAGAGCTGGAGTAAGG + Intergenic
1054286248 9:63175963-63175985 TTAGAGGAAGCCTTGGAGAAAGG + Intergenic
1054388567 9:64589017-64589039 TTAGAGGAAGCCTTGGAGAAAGG - Intergenic
1054470909 9:65537047-65537069 CTAGAAGCAGAGCTGGAGTAAGG - Intergenic
1054656058 9:67667548-67667570 CTAGAAGCAGAGCTGGAGTAAGG - Intergenic
1054763471 9:69023712-69023734 ATAGAGGAACAGAAGGAAAAAGG + Intergenic
1054885194 9:70189678-70189700 CAAAAGGAAGAGAGAGAGAAAGG - Intronic
1055128291 9:72744965-72744987 CTAGAAGAAGAGAAGAAGAGAGG - Intronic
1055669667 9:78590451-78590473 GTAGAGGGAGAGAGAGAGAAAGG + Intergenic
1055870696 9:80875896-80875918 CTAAAGCAATAGATGAAGAAAGG + Intergenic
1055874152 9:80922706-80922728 CAAGAGCAAGAGAGAGAGAAAGG + Intergenic
1056106889 9:83355707-83355729 CCAGAAGAAGAGAAGGAAAATGG + Intronic
1056108541 9:83371856-83371878 AGGGAGGAAGAGAGGGAGAAAGG + Intronic
1056288847 9:85120529-85120551 CGAGAGGAAGAGAAAGAGAAAGG + Intergenic
1056545317 9:87608013-87608035 CAGGAGGAAGAGAGAGAGAAGGG + Intronic
1057241958 9:93419047-93419069 CCAGGAGAAGAGATAGAGAAAGG - Intergenic
1057435934 9:95040605-95040627 ATAGAGGAGGGGAGGGAGAAAGG - Intronic
1057489762 9:95511448-95511470 CCCGAGGAAGAGAGGGAGACGGG + Intronic
1057706536 9:97398995-97399017 CTGGAGGGGGAGATGGACAAAGG - Intergenic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1058792778 9:108467982-108468004 CTAAAGGCAGAAATAGAGAAGGG - Intergenic
1058857842 9:109083289-109083311 AGAGAGGAAGCAATGGAGAAGGG + Intronic
1059642358 9:116229751-116229773 CTAGAGGAAGGGAAGCAGCAAGG + Intronic
1059673103 9:116510266-116510288 CAAGAGCAAGAAATGGGGAAAGG - Intronic
1059853447 9:118368737-118368759 AGAGAGGAAGAGATGGGGAGAGG + Intergenic
1060171073 9:121461553-121461575 CTAGAGGAAGAGAAGGGAAAAGG + Intergenic
1060235891 9:121862465-121862487 CTAGAGGAAGAAAAGGGAAAAGG - Intronic
1060956535 9:127644922-127644944 CTAGAGGATGTGGTTGAGAAGGG + Intronic
1060987329 9:127827187-127827209 CTATGGGAAGACAGGGAGAAAGG + Intronic
1061495413 9:130971101-130971123 AGAGAGGAAGGAATGGAGAAGGG + Intergenic
1061911797 9:133728956-133728978 ATAGATGGAGAGATGGAGGACGG + Intronic
1062063865 9:134515408-134515430 CTACAAGATGAGATTGAGAAGGG - Intergenic
1185499327 X:585083-585105 AAAGAGGGAGAGGTGGAGAAGGG + Intergenic
1185596932 X:1312896-1312918 CTTGGGGAAGAGATGGAGCCAGG + Intergenic
1185683970 X:1911661-1911683 ACAGAGGAAGAGAGGAAGAAAGG - Intergenic
1185925519 X:4141681-4141703 CTAGAGGCTGAGAAGGGGAAGGG - Intergenic
1185936455 X:4262342-4262364 ATAGAGGAAGATATGGGGGAAGG + Intergenic
1186153795 X:6705160-6705182 GCAGAGGTAGAGATGTAGAAGGG + Intergenic
1186266437 X:7839242-7839264 GGAGAGGAAGAGAAGGAGAAGGG + Intergenic
1186870492 X:13766525-13766547 GTAGAGGAAAAGATAGGGAAAGG + Intronic
1186985226 X:15005825-15005847 ATAGAGGAAGAAAGGAAGAAAGG + Intergenic
1187839460 X:23471855-23471877 ATAGAGGAAGGGAGGGAGGAAGG - Intergenic
1187913754 X:24133919-24133941 CTAGAAAAAGAAAAGGAGAAAGG + Intergenic
1187915890 X:24151427-24151449 GTAGAGGTGGAGGTGGAGAAAGG + Intronic
1188402424 X:29762531-29762553 CAAAAGGAAGAGAGGGAGAGAGG + Intronic
1188563619 X:31499302-31499324 CTAGAGGAGGATATAGTGAAGGG + Intronic
1188640792 X:32501754-32501776 CTGGTGGAACAGATGGTGAATGG - Exonic
1188729339 X:33627530-33627552 CTAGAGCTAGAGATGGAAATAGG + Intergenic
1188964167 X:36530276-36530298 CTAAAGGTGGAGATGGATAAAGG + Intergenic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189110846 X:38286969-38286991 CAAGATGAGGAGAGGGAGAAGGG - Exonic
1189220106 X:39364271-39364293 CAGGAGGAAGAGAGAGAGAATGG - Intergenic
1189224413 X:39400664-39400686 AGAGAGAAAGAGAAGGAGAAGGG - Intergenic
1189977514 X:46477485-46477507 CAAGAGGAACAGATCCAGAAGGG + Intronic
1189988866 X:46576163-46576185 GAAGAGGAAGAGAGGGAGAGGGG - Intronic
1190439553 X:50463514-50463536 AGAGAGGAAGAGAGGGAGGAGGG - Intronic
1190467570 X:50741270-50741292 CTAGAGGCTGAGAAGGGGAAGGG + Intronic
1191118959 X:56882682-56882704 TAAGAGGAAGACATGAAGAAAGG - Intergenic
1191883082 X:65861540-65861562 CTTGAGGTAGAGACTGAGAAGGG + Intergenic
1191898588 X:66018801-66018823 CTAGAGGGAAAGAGAGAGAAAGG - Intergenic
1192005466 X:67207336-67207358 CTAAAGAAAGTGATGGAGAGGGG - Intergenic
1192161738 X:68793417-68793439 ATAGAGGAAGGGAGGGAGAGAGG + Intergenic
1192258913 X:69492032-69492054 GGAGGGGAAGAGAGGGAGAAAGG + Intergenic
1192261701 X:69509423-69509445 CTAGGGGGAGTGATGGAGATGGG + Intronic
1192370999 X:70512882-70512904 CTAGAATAAGAGGTGGAGGAAGG - Intergenic
1192375276 X:70553415-70553437 CTAGAGTAAGAAAAGGAAAAAGG + Intronic
1192582713 X:72298422-72298444 CTAGAGAAGGAGAGGGAGTAAGG - Intronic
1192587899 X:72334435-72334457 CTAGAGTAAGAGATACAAAAGGG + Intronic
1192667523 X:73102891-73102913 CAAGAGGAAGAGAGAGAGGAGGG - Intergenic
1193239711 X:79153535-79153557 TTAGAGAGAGAGATGGGGAACGG + Intergenic
1193547922 X:82852381-82852403 CTAGAGGAAGGGGTGGATGAGGG - Intergenic
1194258058 X:91658600-91658622 ATAGAGGAAAACAAGGAGAAAGG + Intergenic
1194460578 X:94162320-94162342 CAGGAGGAAGAGTTAGAGAAGGG - Intergenic
1194484228 X:94467369-94467391 GAGGAGGATGAGATGGAGAACGG + Intergenic
1194763920 X:97827143-97827165 GTAGAGGAGGAGCTGGTGAAGGG + Intergenic
1194825127 X:98552503-98552525 ATAGAATAAGAGAAGGAGAATGG + Intergenic
1194945337 X:100060007-100060029 TAACAGGAAGAGCTGGAGAATGG + Intergenic
1195048763 X:101078545-101078567 ACAAAGGAAGAGATGGAAAAAGG + Intergenic
1195906403 X:109848680-109848702 TTGGAGGAAGAGCTAGAGAAAGG + Intergenic
1196090418 X:111735511-111735533 GCAAAGGAAGAGATTGAGAAGGG + Intronic
1196348175 X:114693197-114693219 ATAAAGGAAGGGATAGAGAAAGG + Intronic
1196548546 X:116994878-116994900 GAGGAGGAAAAGATGGAGAAAGG + Intergenic
1196667609 X:118332799-118332821 CAAGAGGAAGAGCGAGAGAAGGG - Intergenic
1196852328 X:119949188-119949210 CTACAGGAAGAGAGGGGGAAGGG - Intergenic
1197271012 X:124424810-124424832 CAGGAGGAAGAGAGAGAGAAGGG - Intronic
1197284527 X:124580863-124580885 GGGGAGGAAGAGAGGGAGAAGGG - Intronic
1197381616 X:125749426-125749448 AACGAGGAAGAGAAGGAGAAAGG - Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197460711 X:126737133-126737155 CTAGAGCAAGAGAGAGAGAGTGG + Intergenic
1197673423 X:129303609-129303631 CAAGAGGAAGAGAGCAAGAAGGG - Intergenic
1198321211 X:135520862-135520884 CAAGAGGAAGAGGGGGAGACGGG - Exonic
1198330058 X:135614142-135614164 CAAGAGGAGGAGATGGAAAATGG + Intergenic
1198336860 X:135674852-135674874 CAAGAGGAGGAGATGGAAAATGG - Intergenic
1198569153 X:137936944-137936966 CAAGAGGAAGAGAGAGAGTAGGG - Intergenic
1198763637 X:140059484-140059506 AGAGAGGAGGAGAGGGAGAAGGG + Intergenic
1198794997 X:140385199-140385221 ATAACGGTAGAGATGGAGAAAGG - Intergenic
1199018186 X:142844916-142844938 ATAGAGGAAGAAAGGGAGAGAGG + Intergenic
1199026223 X:142942039-142942061 AGAGAGGGAGAGAGGGAGAAAGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199454803 X:148016536-148016558 CTAGAGGAAGACAGGAAGGAAGG - Intronic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1199780005 X:151049796-151049818 GAAGAGGAGGAGATGGAGGAAGG + Intergenic
1199859660 X:151789882-151789904 CTATAGACAGAGATGGACAAAGG + Intergenic
1200576821 Y:4898102-4898124 ATAGAGGAAAACAAGGAGAAAGG + Intergenic
1201548433 Y:15193086-15193108 GTAGAGGTAGAGATGTAGAAGGG + Intergenic