ID: 1095675200

View in Genome Browser
Species Human (GRCh38)
Location 12:44908642-44908664
Sequence GGATGAAATTAAAGTGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095675197_1095675200 23 Left 1095675197 12:44908596-44908618 CCACATGGACATTAAAATATTTA 0: 1
1: 0
2: 6
3: 42
4: 537
Right 1095675200 12:44908642-44908664 GGATGAAATTAAAGTGATCCAGG 0: 1
1: 0
2: 2
3: 9
4: 196
1095675196_1095675200 24 Left 1095675196 12:44908595-44908617 CCCACATGGACATTAAAATATTT 0: 1
1: 0
2: 3
3: 52
4: 508
Right 1095675200 12:44908642-44908664 GGATGAAATTAAAGTGATCCAGG 0: 1
1: 0
2: 2
3: 9
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095675200 Original CRISPR GGATGAAATTAAAGTGATCC AGG Intronic
904475177 1:30760237-30760259 GAATGACAATAAAGTGATTCAGG - Intergenic
906983652 1:50659158-50659180 AGATGAATTTAAAGTCATCATGG + Intronic
907097939 1:51798834-51798856 GGATGAAGTTAATCTGATTCTGG - Intronic
907351944 1:53839003-53839025 GGATGAAAATAAAAATATCCTGG + Intergenic
907696724 1:56738325-56738347 GGACCATATTTAAGTGATCCAGG - Intronic
909107126 1:71425531-71425553 GCATGAAATTGGAGTAATCCCGG - Intronic
911030927 1:93487311-93487333 GGATGAAAAGAAAGTGATAGGGG - Intronic
911987332 1:104644413-104644435 GAAAGAAATTAAAGTGCTGCAGG + Intergenic
912967086 1:114245606-114245628 GGATGAAACTAACTTGATCGTGG - Intergenic
913129353 1:115825849-115825871 GCATGAAATTAAAGGGACCGGGG - Intergenic
915035036 1:152915191-152915213 GGAGAAAATTTAAGTGATCTTGG - Intergenic
915415247 1:155736960-155736982 GGATGGGAATAAAGGGATCCAGG - Exonic
916015509 1:160746237-160746259 GTATAAAATGAATGTGATCCGGG - Intronic
916357581 1:163930387-163930409 GGAAGAAATTAAAATGATATTGG - Intergenic
916950515 1:169775749-169775771 GGAAGAAAGTGAAGTGGTCCTGG - Intronic
917477579 1:175382180-175382202 GAATGTAATTAATGTGAACCAGG + Intronic
923324221 1:232866599-232866621 GGATGAAATTGAAGGGAAACAGG - Intergenic
923779427 1:237009072-237009094 GGATGAAATCATAGGGATGCAGG - Intergenic
924069691 1:240263511-240263533 TGGTGAAATTAAAGTCATTCTGG - Intronic
924698513 1:246425786-246425808 GGATGGCATTAAAGTAATCAAGG - Intronic
1064036658 10:11919032-11919054 GGGTGAATTTAGAATGATCCTGG + Intergenic
1064346603 10:14538187-14538209 GGATGACATTAAAGTGAGATGGG + Intronic
1069163748 10:65123175-65123197 GGATGAGTTGAAAGTGCTCCAGG - Intergenic
1072238565 10:93474099-93474121 TGATTAAATTAAAGTGATAAGGG - Intronic
1072703494 10:97662433-97662455 ACCTGAAATTAAAGTGATACTGG - Intronic
1073836985 10:107455529-107455551 GGTTGAAAATAAAGAGATCCTGG - Intergenic
1073875036 10:107913557-107913579 GTATCAACTTAAAGTGAACCTGG - Intergenic
1075502659 10:122990122-122990144 GGTGTAAATTAAAGTAATCCGGG - Intronic
1078680443 11:13470584-13470606 GAATGAACTTAGAGGGATCCTGG - Intergenic
1081958499 11:47115171-47115193 GGATGAAACTAACTTGATCGTGG + Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1082881145 11:58039502-58039524 TGATTAAATGAAAGTGCTCCTGG - Intronic
1083125619 11:60562900-60562922 GGTTGAGTCTAAAGTGATCCAGG + Intergenic
1087379683 11:97388671-97388693 GGATGAACTTAACCTTATCCAGG + Intergenic
1091338531 11:134792747-134792769 GGAAGAAATCATAGTGACCCTGG - Intergenic
1091811353 12:3400808-3400830 GGATGAAACCAACTTGATCCTGG - Intronic
1092202187 12:6592609-6592631 GGAAGAAAGAAAAGTGATACAGG + Intronic
1093179060 12:15947570-15947592 GGATGAAAATAAAGGGATGGAGG - Intronic
1093783066 12:23159276-23159298 GGATCAAATTAAAATAATCATGG - Intergenic
1095675200 12:44908642-44908664 GGATGAAATTAAAGTGATCCAGG + Intronic
1095762327 12:45853670-45853692 GAGTGAAAGAAAAGTGATCCAGG - Intronic
1097685967 12:62691195-62691217 GGATGGAGTGAAAGTCATCCTGG + Intronic
1099060755 12:77904764-77904786 GGATAGAATTAAAGTGAATCTGG - Intronic
1099910154 12:88821194-88821216 GGATGAAATAAGACTGATCTTGG + Intergenic
1100773296 12:97947806-97947828 GGATGATATTGAAGTGATCCAGG + Intergenic
1101973219 12:109332347-109332369 GGATGAAACAAAACTGGTCCTGG - Intergenic
1102062314 12:109942394-109942416 GGCAGAAGTTACAGTGATCCAGG - Intronic
1109143143 13:58741867-58741889 GTATTACATTAAAGTGATCTCGG - Intergenic
1109984286 13:69957054-69957076 GGGTGAAGTTAAAGTTATTCAGG - Intronic
1111437413 13:88228239-88228261 GGAAGAAACTACAGTGATCTGGG - Intergenic
1113442990 13:110343777-110343799 GCATGGAATGAAAGAGATCCAGG - Intronic
1117197636 14:53356265-53356287 GGAAAAAATTAAAGTGCTGCAGG - Intergenic
1124358664 15:29018344-29018366 GGATGCAATCAAAGTCTTCCAGG - Intronic
1127362295 15:58255010-58255032 GGAGGAAAATAAACTCATCCTGG + Intronic
1128681837 15:69658055-69658077 GGAGGACATTAAAGCAATCCTGG - Intergenic
1129064632 15:72890437-72890459 GGATGAAAAAAAAGGGATACTGG + Intergenic
1130442799 15:83972474-83972496 GAGTGAAATTAAAGTGATACTGG + Intronic
1130745278 15:86646744-86646766 TGATGAAAATAATGTGATCAAGG - Intronic
1131942354 15:97581458-97581480 GGATGAAGTTAACTTGATCGTGG + Intergenic
1133053174 16:3130272-3130294 TGAAGAAAGTAAAGTGAACCTGG - Intronic
1134822586 16:17258722-17258744 GGATGAAATTATAGTGAAATCGG - Intronic
1136396014 16:29992889-29992911 GGGGGAAATTAAAGGGAACCAGG + Exonic
1137260552 16:46825190-46825212 GGAAGTCATTAAAGTAATCCTGG + Intronic
1138362330 16:56441822-56441844 GGAAGAAATTTAAGTTATCATGG - Intronic
1138524514 16:57594683-57594705 GGCTGAAATCAGAGTGATGCTGG - Intergenic
1142947027 17:3438351-3438373 GGAAGAATTGAATGTGATCCGGG - Intergenic
1144356022 17:14447165-14447187 GGAAGAAATTCAAGAGTTCCTGG + Intergenic
1145719513 17:27056963-27056985 GGGTAAAATTAAAATGATCATGG + Intergenic
1147433936 17:40394982-40395004 GGACGATATTAAAGAGGTCCAGG + Intronic
1147694171 17:42338755-42338777 AGTTGAAATCAAAGTCATCCTGG + Exonic
1149245445 17:54700211-54700233 GGATGAAAGTAAAGTGTTTCAGG - Intergenic
1149467619 17:56892209-56892231 AGATTACATTAAAGTCATCCTGG - Exonic
1151245949 17:72794738-72794760 GGAGGAAATGAAAGTCACCCTGG - Intronic
1152547266 17:81007568-81007590 AAATGAAATTAAAGGCATCCAGG - Intronic
1153573437 18:6496314-6496336 GACTTAAATTCAAGTGATCCAGG + Intergenic
1155853188 18:30798097-30798119 GAATGACAATAAAGTGAACCTGG - Intergenic
1158149124 18:54346966-54346988 AAATGAAATTATGGTGATCCTGG + Intronic
1158684372 18:59599926-59599948 GGATGGAATGGAAGTGAGCCAGG - Intronic
1159817442 18:73093470-73093492 GGATGGAGTTAAAATCATCCTGG - Intergenic
1162349779 19:10141814-10141836 GTATGAGATTCAAGTGGTCCCGG - Intronic
1164132775 19:22380731-22380753 GGATGAAACTAACTTGATCGTGG + Intergenic
1164166045 19:22676022-22676044 GGATGAAACTAACTTGATCGTGG - Intergenic
1164305350 19:24001103-24001125 GGAGGTAATGGAAGTGATCCTGG - Intergenic
1165350992 19:35275561-35275583 GGATGTAGCTAAAGTGATGCTGG - Intronic
1165659817 19:37567721-37567743 GGACCTAATTAAAGTGATCCAGG - Intronic
1166198998 19:41224185-41224207 GTATGAAAGTAAAGTGTGCCTGG + Intronic
1167563961 19:50244456-50244478 GCAGGAAATCAGAGTGATCCTGG - Intronic
928005832 2:27560807-27560829 CCATGAATTTAAAGTGGTCCTGG - Intronic
931181353 2:59904425-59904447 GGATGAAATGATAGTGATAGTGG - Intergenic
932057246 2:68458546-68458568 AGATGAAGTTAAAGTGGTCAGGG + Intergenic
932310370 2:70734684-70734706 GCATGAAATTAAAGGGAGCTTGG + Intronic
932562261 2:72883603-72883625 GGATGGCAATGAAGTGATCCTGG - Intergenic
932933747 2:76076595-76076617 GTTTGAAATTAAAGTTGTCCAGG + Intergenic
933080495 2:77978615-77978637 GGATTACAATAAAGTGATACAGG + Intergenic
935357397 2:102215420-102215442 CTATGAAATTACTGTGATCCTGG + Intronic
937342164 2:121098190-121098212 GGATGAAATCAAGGTGTTACTGG - Intergenic
941132893 2:161676058-161676080 GGGTGGATTTAAAGTGTTCCAGG + Intronic
941932283 2:170954090-170954112 GGATGAAATAGAAGAGATCTGGG + Intronic
941984020 2:171491745-171491767 GGATGGGAATAAAGGGATCCAGG - Intergenic
942122142 2:172788584-172788606 GGCTGAAATCAAGGTGCTCCTGG + Intronic
943042566 2:182820847-182820869 GGATGAAAATAAAATGATTCAGG - Intergenic
944510651 2:200461945-200461967 AAATGAAACTAATGTGATCCAGG + Intronic
944776311 2:202969272-202969294 GGAGGCTATTAAAGTAATCCAGG + Intronic
945917646 2:215720767-215720789 GGATGAAAGGAAAGAGATGCTGG + Intergenic
946340468 2:219063639-219063661 GGTTGGATTTAAAGTGCTCCAGG - Intergenic
1170537171 20:17351864-17351886 GAATGAAATAAAAGGCATCCAGG + Intronic
1171281953 20:23908673-23908695 GAATTAAAATAAAGTGATACAGG - Intergenic
1172163545 20:32885017-32885039 GGATGAAATCAAAGTGGACAAGG - Intronic
1173571977 20:44083048-44083070 GGAAGAAATTAAAGACATGCAGG - Intergenic
1179123216 21:38568071-38568093 GGAAAAAATTAAATTGACCCAGG - Intronic
1180981828 22:19881999-19882021 GGATGGAAATGAAGTCATCCTGG + Intronic
1181716248 22:24731887-24731909 AGAGGAAATGAAAGTGTTCCCGG - Intronic
1184937680 22:47736906-47736928 GGGTGAAATTAAAGCGCCCCAGG - Intergenic
949837206 3:8282013-8282035 TGAAGAATTTAAAGTGTTCCTGG + Intergenic
950165452 3:10793867-10793889 GGATGAAAGCCAAGTGATCTTGG + Intergenic
950538302 3:13594607-13594629 GGCTGTTACTAAAGTGATCCTGG + Intronic
951698660 3:25472097-25472119 GTATGAAATTAAATTAAGCCAGG + Intronic
952753011 3:36840703-36840725 GGAGGAAAGAAATGTGATCCAGG + Intronic
953598136 3:44337320-44337342 GAATGAACTTAGAGGGATCCTGG + Intergenic
958703045 3:97617562-97617584 GGCTCAAAATAAAGTGATGCAGG + Intronic
958712865 3:97739435-97739457 GGAAGAAATTAAAGTGACAAAGG + Intronic
958742685 3:98094270-98094292 GGATGAAAATAAAGGGATGGAGG - Intergenic
959978344 3:112486996-112487018 GGAGGAAACTGGAGTGATCCTGG + Intronic
960466640 3:118003894-118003916 GAATGTATTTAAAGTGCTCCTGG - Intergenic
962426597 3:135274145-135274167 GAATTAAATTAAGGTGATCAGGG + Intergenic
962955525 3:140262962-140262984 GGATGAACTTGAAATGAGCCAGG + Intronic
963745163 3:149118309-149118331 GGAAGAAATGATAGTGATCTTGG - Intergenic
965239203 3:166172983-166173005 GGATGAAATTAAAGGGAGGAAGG - Intergenic
966316342 3:178650709-178650731 GGATGAAAGCAACGTGATCACGG - Intronic
971421582 4:26478154-26478176 GAATGTAATCAAAGTGATGCCGG - Intergenic
972652165 4:41028755-41028777 TCATGAAATTAGAGTGATCCTGG - Intronic
973555277 4:52075952-52075974 GAATGAACTTAGAGGGATCCAGG + Intronic
974525880 4:63049723-63049745 GGATGGAATTGAAAAGATCCAGG - Intergenic
974899362 4:67978381-67978403 GGATGAAATGAACTTGATCATGG + Intergenic
976725570 4:88212709-88212731 GGATGTAATTATAATGATCATGG - Intronic
977230131 4:94441859-94441881 AGTTTAAATTAAAGTAATCCCGG + Intergenic
977917822 4:102613481-102613503 CGAAGCAATTGAAGTGATCCAGG + Exonic
978880423 4:113695699-113695721 GGAGGCTATTGAAGTGATCCAGG - Intronic
980196151 4:129591523-129591545 GGATGAAGTTAACGTGGTCGTGG - Intergenic
980568130 4:134572785-134572807 GGATGAAACTGACTTGATCCTGG - Intergenic
981802012 4:148668860-148668882 GGCTGCATTTAAAGTTATCCTGG + Intergenic
983391092 4:167131156-167131178 CAATGAAAATAAAGTAATCCTGG - Intronic
985248131 4:187996898-187996920 GGATGAAATGCAAATGGTCCCGG + Intronic
986110713 5:4713576-4713598 GGATGAAGCCAAAGTGATCGTGG - Intergenic
987595795 5:19997523-19997545 GAATGAAAACAAAGTGATACTGG - Intronic
989220235 5:38951020-38951042 GGATGAAATTAAAGGGAAAAAGG + Intronic
994206715 5:97043944-97043966 AGATGAAATTGAAGAAATCCTGG + Intergenic
996185585 5:120470004-120470026 GGATGAAAATAACATAATCCAGG - Intronic
999426524 5:151492087-151492109 GGTTTAAATCAAAGTGATTCTGG + Exonic
999927599 5:156396156-156396178 GCATGAAATTAAATCGTTCCAGG - Intronic
1004704864 6:18115332-18115354 GAATGAACTAAAAGTGTTCCTGG - Intergenic
1009435811 6:63617164-63617186 GCAGGAAATTAGAGGGATCCTGG - Intergenic
1010583461 6:77627964-77627986 GGCAGAAATTAAAGTGATGAAGG + Intergenic
1016347318 6:143128028-143128050 GGATGAAATAAAAGCAATTCTGG + Intronic
1021379685 7:19952552-19952574 GGCTGAAATTAAAGAGATGGAGG - Intergenic
1021827279 7:24567968-24567990 AGATGCAATTAAAGTGCTACAGG + Intergenic
1023856440 7:44187030-44187052 GGAGGAAAGTAAAGTGTTGCTGG - Intronic
1023955551 7:44884499-44884521 GGATGAGATGAAAGAAATCCAGG - Exonic
1028825395 7:95266905-95266927 GGAGGAAATTAAAGTGATCAAGG + Intronic
1029272433 7:99385254-99385276 GGATGAAGATGAAGTCATCCAGG - Intronic
1029485342 7:100836622-100836644 GGATGAAATTCCAGGGTTCCTGG - Intronic
1030244778 7:107371027-107371049 GAATGAGATTAAACTGCTCCTGG + Intronic
1031023195 7:116650573-116650595 AGATGTAATTAAAGTCATACAGG - Intergenic
1031149334 7:118035096-118035118 GGATGAACTGAGAGTGATACAGG + Intergenic
1031270885 7:119647652-119647674 AGAAGAAATTAAAGTATTCCAGG - Intergenic
1031461536 7:122056114-122056136 GGATGCTACTAAAGTGATCAGGG - Intronic
1031469887 7:122156397-122156419 GCATGGAATTACAGTGAACCAGG + Intergenic
1032117596 7:129129737-129129759 GGAGCAACTTAAAGTGATACTGG + Intergenic
1033467395 7:141607717-141607739 GGAGGGAATTTAAGTGATCTTGG - Intronic
1033804854 7:144942092-144942114 AGAAGAAATTAATGTGAACCTGG - Intergenic
1038561143 8:28581224-28581246 GCATGAAATCACAGTCATCCAGG - Intergenic
1041555459 8:59149722-59149744 GGATGAAACTTAAGTGATGCTGG - Intergenic
1042074708 8:64979371-64979393 GGATGAAATTAAACAGAGCTTGG + Intergenic
1043195262 8:77285160-77285182 GGATGTCATTAAAGTCAGCCTGG + Intergenic
1045530959 8:102985055-102985077 GAATGAAGTGAAAGTGATACAGG + Intergenic
1046109684 8:109707741-109707763 GGATGAAATTAAAAGGCTGCAGG + Intergenic
1046455136 8:114449390-114449412 GGATAAAATTAAAATGTTCATGG + Intergenic
1046610127 8:116414110-116414132 GGATGAAACTGACGTGATCATGG - Intergenic
1046612150 8:116437801-116437823 GGCTAAAATCAAAGTGATTCAGG - Intergenic
1048203106 8:132393211-132393233 GGAAGAAAATAAAGTGATGCAGG - Intronic
1048767943 8:137864880-137864902 GGAAGAAATTAAAGTCATTAGGG + Intergenic
1049086691 8:140483947-140483969 GGATGATGTGGAAGTGATCCAGG - Intergenic
1050351751 9:4746399-4746421 GGGAGAAAATAAAGTGATCATGG + Intergenic
1053204173 9:36172436-36172458 TGATTGAATTAAAGCGATCCAGG - Intergenic
1055657575 9:78467105-78467127 GGATCAAAGTAAATTCATCCTGG + Intergenic
1058254690 9:102746433-102746455 GGAAGAAATTTAAGTCATCTAGG - Intergenic
1060350752 9:122857322-122857344 AGATTAAATTAAAATCATCCTGG + Intronic
1060468906 9:123930878-123930900 GGATGAAATTGAGGTGTTCATGG - Intergenic
1186616135 X:11189996-11190018 GAATGAAACTAAAATGATCAAGG + Intronic
1186799014 X:13074587-13074609 GGATGAAATTAATTTCACCCTGG + Intergenic
1186817411 X:13251551-13251573 GGAGGAAACAGAAGTGATCCTGG + Intergenic
1188468808 X:30513968-30513990 GGAGGTAATTACTGTGATCCAGG + Intergenic
1189693206 X:43638050-43638072 GAATGAACTTAGAGGGATCCTGG + Intergenic
1189994416 X:46625361-46625383 GGATGGACTTAAGGTTATCCAGG + Intronic
1191919662 X:66241389-66241411 GGATCAAAGTAAAGTGATGGAGG + Intronic
1192259636 X:69497031-69497053 GGATGAAAGTACAGTGGTTCAGG - Intergenic
1192987630 X:76417018-76417040 GGCTGAAAATAAAGTGATGGAGG + Intergenic
1193296806 X:79842954-79842976 GGATGAAACCAAATTGATCGTGG - Intergenic
1193605688 X:83565579-83565601 GGCTGAAAATAAAGGGATACAGG - Intergenic
1197295209 X:124710547-124710569 GGATGAAATTACAGGGCTCAGGG - Intronic
1198021800 X:132666178-132666200 GGATAAAATTAAAGAGCTCAGGG + Intronic
1199230168 X:145427882-145427904 GGATGAGATTACAGTGCTACAGG + Intergenic
1199419924 X:147633341-147633363 GCATGAAATTAAAGTGATGATGG + Intergenic
1201601004 Y:15728343-15728365 GGATTAAATAAAACTGATCTGGG - Intergenic
1202270644 Y:23069980-23070002 GGATGAACTTAAAATGAAACAGG + Intergenic
1202295382 Y:23350702-23350724 GGATGAACTTAAAATGAAACAGG - Intergenic
1202423639 Y:24703724-24703746 GGATGAACTTAAAATGAAACAGG + Intergenic
1202447150 Y:24966361-24966383 GGATGAACTTAAAATGAAACAGG - Intergenic