ID: 1095680428

View in Genome Browser
Species Human (GRCh38)
Location 12:44968317-44968339
Sequence CAGTACCTGGCACTGTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095680428_1095680433 17 Left 1095680428 12:44968317-44968339 CCCAAGCACAGTGCCAGGTACTG No data
Right 1095680433 12:44968357-44968379 AAGTATTTGTTTATTGACTATGG No data
1095680428_1095680434 27 Left 1095680428 12:44968317-44968339 CCCAAGCACAGTGCCAGGTACTG No data
Right 1095680434 12:44968367-44968389 TTATTGACTATGGCATTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095680428 Original CRISPR CAGTACCTGGCACTGTGCTT GGG (reversed) Intergenic
No off target data available for this crispr