ID: 1095688999

View in Genome Browser
Species Human (GRCh38)
Location 12:45066731-45066753
Sequence GCTTATGCTTAGACCTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095688993_1095688999 21 Left 1095688993 12:45066687-45066709 CCTGTTCCAGTTCAAAAGATTCT No data
Right 1095688999 12:45066731-45066753 GCTTATGCTTAGACCTGGAGAGG No data
1095688995_1095688999 15 Left 1095688995 12:45066693-45066715 CCAGTTCAAAAGATTCTGGCAGA No data
Right 1095688999 12:45066731-45066753 GCTTATGCTTAGACCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095688999 Original CRISPR GCTTATGCTTAGACCTGGAG AGG Intergenic
No off target data available for this crispr