ID: 1095694476

View in Genome Browser
Species Human (GRCh38)
Location 12:45129192-45129214
Sequence AAGAAAAAAGAAAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095694473_1095694476 24 Left 1095694473 12:45129145-45129167 CCTCTATCAAAAGCAAAGCAAAG No data
Right 1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095694476 Original CRISPR AAGAAAAAAGAAAAGGAGGC CGG Intergenic
No off target data available for this crispr