ID: 1095707324

View in Genome Browser
Species Human (GRCh38)
Location 12:45251430-45251452
Sequence GCAAACAGTCTGATTCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095707322_1095707324 6 Left 1095707322 12:45251401-45251423 CCAGGGCTCAGCTGAGTGGTGTT 0: 1
1: 0
2: 3
3: 18
4: 187
Right 1095707324 12:45251430-45251452 GCAAACAGTCTGATTCAAGATGG 0: 1
1: 0
2: 0
3: 8
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095707324 Original CRISPR GCAAACAGTCTGATTCAAGA TGG Intronic
901876997 1:12172534-12172556 GCAGACAGTCTGACTCCACAGGG - Intronic
901967169 1:12878050-12878072 ACAACCAGTTTAATTCAAGAAGG + Intronic
901974968 1:12937187-12937209 ACAACCAGTTTAATTCAAGAAGG + Intronic
901982569 1:13048314-13048336 ACAACCAGTTTAATTCAAGAAGG + Intronic
901986453 1:13079026-13079048 ACAACCAGTTTAATTCAAGAAGG - Intergenic
901995359 1:13147741-13147763 ACAACCAGTTTAATTCAAGAAGG + Intergenic
901999518 1:13180605-13180627 ACAACCAGTTTAATTCAAGAAGG - Intergenic
902006185 1:13234174-13234196 CCAAAGAGTCTGATTACAGAGGG + Intergenic
902010206 1:13264577-13264599 ACAACCAGTTTAATTCAAGAAGG - Intergenic
902017996 1:13323736-13323758 ACAACCAGTTTAATTCAAGAAGG - Intergenic
902025342 1:13379192-13379214 CCAAAGAGTCTGATTACAGAGGG + Intergenic
904887740 1:33753894-33753916 GCAAACATTCTCATTCCAAAAGG - Intronic
904955271 1:34278458-34278480 GCAAAAAGGATTATTCAAGAAGG - Intergenic
907168031 1:52432288-52432310 GAAATCAGTCTGATACAAGAAGG + Intronic
908458869 1:64330030-64330052 GCAAACATTCTCATTCTAAAAGG - Intergenic
909375868 1:74941366-74941388 CCAAACAATCTGATTAAAAATGG - Intergenic
911994432 1:104746464-104746486 GCACACTGTCTGCTTCAAAATGG - Intergenic
912925880 1:113912553-113912575 GTAAAGAGTCTGAATCAAAAAGG + Exonic
915950803 1:160188777-160188799 ACAAAAGGTCAGATTCAAGATGG + Intergenic
916297440 1:163235383-163235405 GCAAACACTCCTATTCAAAAGGG + Intronic
917632178 1:176901352-176901374 GCAGACAGTGTGGTTCAATATGG + Intronic
917985423 1:180312649-180312671 GCAAACATTATTATTAAAGATGG - Intronic
922146017 1:222945352-222945374 TCACACAGTTTGATTCAAAATGG - Intronic
922961562 1:229651035-229651057 TCAAAGAGTCTAATACAAGATGG + Intronic
923764980 1:236884784-236884806 GCTAACAGTCTGATTTATGGTGG - Intronic
1073562445 10:104508295-104508317 GGCAACATTCTGATTCAGGATGG - Intergenic
1075615103 10:123885058-123885080 GGAAACAGCCTGAGACAAGAAGG + Intronic
1077355264 11:2113765-2113787 GAAAACCGTCTGGTTCAAGGGGG + Intergenic
1077941948 11:6852181-6852203 TGAAACATTTTGATTCAAGAGGG + Intergenic
1077947101 11:6911676-6911698 GAAAACAGTCTTATCCATGAAGG - Intergenic
1080105318 11:28505737-28505759 CCAAACAGTGAAATTCAAGATGG - Intergenic
1081010437 11:37804537-37804559 GAAAAAAGTCTAATTCAAAACGG - Intergenic
1081742155 11:45448357-45448379 GGACACAGTCTGAATCAAGCTGG + Intergenic
1081953169 11:47064154-47064176 CAAAACAGCCTGATTCAAAAAGG - Intronic
1083753151 11:64773727-64773749 GCAAACAGTTTGTTGGAAGAGGG + Intronic
1085755193 11:79196200-79196222 GAAAACAGACTAATGCAAGAGGG + Intronic
1086867805 11:92001406-92001428 GCAGAGATTCTGATTAAAGAAGG - Intergenic
1087227957 11:95625342-95625364 GTAGACTGCCTGATTCAAGAAGG - Intergenic
1087553650 11:99686782-99686804 GGAAACTGTATGATTCTAGAAGG - Intronic
1089886456 11:121829341-121829363 GCAGACAGACTGATGCAAGAGGG + Intergenic
1093306620 12:17528169-17528191 GCAAACATTATGATTCCAAAAGG - Intergenic
1095030601 12:37271089-37271111 ACAAACAGAGTGATTCAAAACGG - Intergenic
1095707324 12:45251430-45251452 GCAAACAGTCTGATTCAAGATGG + Intronic
1096289159 12:50326253-50326275 GCAATCAGTCTGATTCATTGAGG - Intronic
1100473778 12:94917106-94917128 ACAAACTGTGTGCTTCAAGAGGG - Intronic
1102531683 12:113551331-113551353 ACAAACAGTCTGAATAAATAGGG + Intergenic
1102567567 12:113806920-113806942 GCAAAGAATCTGATTCCTGAAGG + Intergenic
1106766546 13:32919169-32919191 GGAAAAAATGTGATTCAAGAAGG - Intergenic
1108467902 13:50736624-50736646 GCCAAGATTCTGTTTCAAGAAGG + Intronic
1108666930 13:52642128-52642150 GCAAACAATATGGTTTAAGAAGG - Exonic
1109095444 13:58107997-58108019 GCAAAAATTCTGATGCAAGGGGG - Intergenic
1112766145 13:102746199-102746221 GCACTGGGTCTGATTCAAGATGG + Exonic
1117896059 14:60487946-60487968 ACAAACAATCTGATTAAAAATGG - Intronic
1118121378 14:62847916-62847938 CTTAACTGTCTGATTCAAGATGG - Intronic
1120686627 14:87545371-87545393 TCAAACAGACTGATTCGACATGG + Intergenic
1120717731 14:87858212-87858234 GCAAACAATTTAACTCAAGATGG - Intronic
1120850683 14:89166397-89166419 GCATGCAGTCTGATTCTAGGTGG - Intronic
1124780513 15:32627365-32627387 GAAAACTGTCTGATTATAGATGG - Intronic
1127043362 15:55001354-55001376 GCAAACAGTCCGATTCCAAAAGG + Intergenic
1135722623 16:24830031-24830053 CCAGACAGTCTGATTTAATAGGG + Intergenic
1137245595 16:46701100-46701122 CCAAACAACCTGATTCAAAAAGG - Intergenic
1138256505 16:55568251-55568273 GCAAACATTTTGATTCATTAAGG - Intronic
1143355355 17:6323861-6323883 GCAACCACTCTGAGTCACGAGGG + Intergenic
1145108980 17:20144990-20145012 AAAAACATTCTAATTCAAGAAGG + Intronic
1145366174 17:22268562-22268584 GCAAACAGCCTCTTTCAGGAAGG + Intergenic
1149392231 17:56203557-56203579 GCAACCAGTCCGGCTCAAGATGG - Intronic
1155923606 18:31630171-31630193 GCAAAAAGTCTGACACAAGCAGG - Intronic
1155944438 18:31832277-31832299 AAAAACAATCAGATTCAAGAAGG + Intronic
1156933008 18:42668047-42668069 GCAAACAAGCTGATCCAAGAAGG + Intergenic
1157107610 18:44789434-44789456 GAAAGAAGTCAGATTCAAGAGGG - Intronic
1158040352 18:53085864-53085886 GCAAACAGAATCATTTAAGAAGG + Intronic
1158869507 18:61671053-61671075 ACAAACAGCCTGATTAAAAATGG - Intergenic
1159512805 18:69417885-69417907 ACAAACAATCTGATTAAAAATGG - Intronic
1164900095 19:31911443-31911465 GAAAGCAGTCTGATTTAATAAGG + Intergenic
1165582514 19:36880026-36880048 GCAAATATTCTTATTCAACAAGG - Intronic
927394602 2:22635714-22635736 GCAAAAAGTCTAAATCGAGAAGG + Intergenic
927691629 2:25212524-25212546 GTAAACAGTCTGACTCCAGGTGG - Intergenic
928650380 2:33397828-33397850 GCAAAAGGACTGCTTCAAGATGG - Intronic
929175339 2:38969854-38969876 GCAAACTGTCCCATTCTAGAAGG + Intronic
930240645 2:48932643-48932665 ACAAACAGTCTAATTAAGGAAGG + Intergenic
931058611 2:58501458-58501480 GTATACAGGCTGATCCAAGAAGG + Intergenic
931447128 2:62336147-62336169 GGATGCAGTCTGATTCCAGATGG - Intergenic
932448895 2:71797209-71797231 ACAAACAGTCAGAATCAAGCCGG - Intergenic
932608339 2:73178968-73178990 GCAAACAGTCTGAGTGAAAGAGG + Intergenic
933628574 2:84631109-84631131 GCAAATAGTCTGAGTCAGGTCGG - Intronic
935967136 2:108491229-108491251 ACAATCATTCTGATTCCAGATGG + Intronic
936693281 2:114918111-114918133 CCAAACAATCTCATTAAAGAAGG + Intronic
938106181 2:128531607-128531629 GAAGACAGTCTGATTAAAAATGG + Intergenic
938584748 2:132679275-132679297 TCTGACAGTCTGATTCCAGAGGG + Intronic
940739109 2:157486617-157486639 ACAAACAGTTTGATTGAATAGGG - Intronic
940923989 2:159343557-159343579 CCAAACAATCTGATTAAAAATGG + Intronic
941291142 2:163677089-163677111 CCAAACAATCTGTCTCAAGAAGG + Intronic
941471937 2:165898567-165898589 ACAGACAGTCTGATTCAACTAGG + Intronic
943414895 2:187590045-187590067 GCAAACATTCCCTTTCAAGAAGG + Intergenic
948346186 2:237300665-237300687 GCAAACAGTCTGAATTGAGTGGG - Intergenic
949024419 2:241759600-241759622 CCAAACGCTCTCATTCAAGACGG - Intronic
1169813331 20:9630866-9630888 GTAAAAATTCTGATTCAAAATGG - Intronic
1169887259 20:10413800-10413822 GCAAAAAGTATGTTCCAAGATGG + Exonic
1173627731 20:44486026-44486048 GAAAACAGTCTGAGTCTACAGGG - Intronic
1177008241 21:15700118-15700140 GCAAAGAATGTGTTTCAAGAAGG + Intergenic
1178701395 21:34836221-34836243 GCAAACAGCCTGAGTCACGCAGG + Intronic
1179594634 21:42434114-42434136 GCCCAGAGTCTGACTCAAGAGGG - Intronic
1179837233 21:44044271-44044293 GAAAAAAGTCTCATTCAAAATGG - Intronic
1180753403 22:18142208-18142230 GGAAACAATCTGATTAAAAATGG + Intronic
1181626774 22:24127477-24127499 GGAAGTAGTCTGATTCTAGATGG + Intronic
1181926666 22:26365233-26365255 GAAAACAGTCTGATGCAAGGTGG + Intronic
951290805 3:20870244-20870266 GCACACAGACTTATTCATGAGGG - Intergenic
952350887 3:32536306-32536328 GCAAAATATCTGATCCAAGAGGG + Intronic
952519820 3:34145460-34145482 GCAAACAGTCTGCATCAGGCTGG - Intergenic
954601671 3:51875254-51875276 CCATACACTCTGATTCCAGAAGG - Intronic
956018337 3:64908029-64908051 GCAAACAGTGCGATTCAATTAGG - Intergenic
958862407 3:99460246-99460268 GGAAAAAGTCTCATTCAAAAAGG + Intergenic
961433637 3:126901146-126901168 GCATACTGTCAGCTTCAAGAAGG + Intronic
962358768 3:134717614-134717636 GCCACAAGGCTGATTCAAGAGGG + Intronic
963686006 3:148434770-148434792 GCAAATAGACAGCTTCAAGAAGG - Intergenic
964539023 3:157758319-157758341 GAAAACAGTCTGACCCAGGAGGG + Intergenic
964595850 3:158427042-158427064 GGAAAAAGTCTGATTGCAGAGGG - Intronic
964780900 3:160336751-160336773 TCAAACAGTCTTATTGTAGATGG + Intronic
966481638 3:180415835-180415857 CCAAACAGTCTGAGTATAGATGG - Intergenic
968357160 3:198118177-198118199 GCAAACAGTTAGCCTCAAGATGG + Intergenic
972438590 4:39060615-39060637 GCAAACAGTGTTATAAAAGAGGG + Intronic
974151312 4:58013466-58013488 GCAGATAGTCTCATTCAATAAGG - Intergenic
976815383 4:89141489-89141511 GCAAACTGTCTCTTTAAAGAAGG - Intergenic
979321277 4:119327956-119327978 TTAAAGTGTCTGATTCAAGAAGG + Intergenic
979638246 4:122980823-122980845 ACAAACAATCTGATTAAAAATGG - Intronic
979646555 4:123076700-123076722 GCAAAAAGTCTCCTTTAAGAGGG - Intronic
981399773 4:144300786-144300808 ACAAACACACTCATTCAAGAAGG + Intergenic
983321030 4:166197142-166197164 GAAAACAGTGTGATACAATATGG + Intergenic
983439695 4:167765684-167765706 GCAGTCAGTCTGCTTTAAGATGG - Intergenic
984010488 4:174365473-174365495 GCTAACAGTCTGAGACGAGATGG + Intergenic
985982635 5:3484755-3484777 CCAAACTTTCTGATTTAAGATGG - Intergenic
989757279 5:44970706-44970728 GCAAACAATCTGATTAAAAATGG + Intergenic
990084744 5:51961415-51961437 GCTAACAATCTGATTGCAGACGG + Intergenic
991218056 5:64178897-64178919 GCAGACATTTTGATTCAAGCAGG + Intronic
993152290 5:84175850-84175872 GCAAAAATTCTGATTCAACAGGG + Intronic
993230106 5:85224902-85224924 GGAAAGTGTCTGATTCAAGAAGG - Intergenic
993423944 5:87738705-87738727 GGAAAAAGTCAGATTCAAGTAGG + Intergenic
998975777 5:147645142-147645164 GCAAACAGTCTGTTAAATGAAGG - Intronic
1001866158 5:175107288-175107310 CCAACCACTCTGATTGAAGAAGG - Intergenic
1002817902 6:695961-695983 GGAAAAAGTCTGTTTTAAGATGG + Intergenic
1004769878 6:18769868-18769890 GAAAGAAGCCTGATTCAAGAAGG + Intergenic
1005635394 6:27748548-27748570 TCTAACAATCTGATTTAAGAAGG - Intergenic
1005966112 6:30727830-30727852 TCAAACAGTCTGATTTAATTAGG + Exonic
1006876851 6:37305164-37305186 GCAAAGAGTCAGATGTAAGATGG - Intronic
1008249517 6:49222395-49222417 GCAAGGAGTCTGTTTCTAGAGGG + Intergenic
1008816629 6:55576303-55576325 GCAAACACTGTGGTTCCAGAGGG + Intronic
1009601087 6:65800701-65800723 GCAAAGAGTATGAATCCAGAAGG - Intergenic
1013568927 6:111400544-111400566 GCAAACAGTCCAATTAAAAATGG - Intronic
1013679709 6:112510756-112510778 AAAAACAGCATGATTCAAGATGG - Intergenic
1020931241 7:14397979-14398001 GCAAAAAATCTGATTTCAGATGG + Intronic
1021665420 7:22972798-22972820 TCAATCAGTCTGAATCAGGAAGG + Intronic
1022783492 7:33611040-33611062 GCAAGCTGTCAGATTGAAGAGGG + Intergenic
1025314913 7:58009665-58009687 GCAAAAAGAGTGATTCAAAACGG - Intergenic
1028042075 7:86064934-86064956 GAAAACAGACTAATACAAGAAGG + Intergenic
1028356227 7:89913274-89913296 GTATACAGTCTGATTGAAGTAGG + Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1033356383 7:140603446-140603468 ACAAATTGTCTGATTCAAGTGGG + Intronic
1037171392 8:15896343-15896365 GCAAATAATCTGATTGATGAAGG - Intergenic
1037397830 8:18461396-18461418 GCTAACAAGATGATTCAAGAGGG + Intergenic
1040027308 8:42793663-42793685 ACAAACAATCTGATTAAAAATGG - Intronic
1041017550 8:53606967-53606989 GCAATCTGGCTGATACAAGATGG - Intergenic
1043837326 8:85062729-85062751 GAAACCAGTCAGAATCAAGATGG - Intergenic
1044710974 8:95057471-95057493 GCAAACAGGCTGTTTCAATCAGG - Intronic
1045353417 8:101363092-101363114 GCCAAAAATCTGATTCATGAAGG - Intergenic
1048037883 8:130694148-130694170 GCAAACACTGTGGTTGAAGAGGG - Intergenic
1048820680 8:138377935-138377957 GCAAACAATCTTATTAGAGATGG + Intronic
1051874152 9:21772997-21773019 GCATACAGTCTATTTCAAAAAGG + Intergenic
1051948849 9:22606009-22606031 TCAAAAATTCTGATTGAAGAGGG - Intergenic
1058162509 9:101585075-101585097 GACAAAAGTCTGATTGAAGAGGG - Intronic
1058208803 9:102141514-102141536 ACAAAGAGTCTGATTAATGATGG + Intergenic
1189552560 X:42108527-42108549 GGAAACAGTGGGATTGAAGAAGG - Intergenic
1193626816 X:83832518-83832540 TCAAACAGCCTCATTCAATAAGG + Intergenic
1195964076 X:110414320-110414342 CCAGACAGTCTGACTCCAGAGGG - Intronic
1197111304 X:122778359-122778381 GCCACCACTCTGATTGAAGAAGG + Intergenic