ID: 1095709466

View in Genome Browser
Species Human (GRCh38)
Location 12:45273116-45273138
Sequence GAGAATAGAACAGTGATTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 2, 2: 6, 3: 67, 4: 396}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095709464_1095709466 16 Left 1095709464 12:45273077-45273099 CCTCACTTACATGTGAAATCTAA 0: 2
1: 19
2: 63
3: 127
4: 500
Right 1095709466 12:45273116-45273138 GAGAATAGAACAGTGATTGCCGG 0: 1
1: 2
2: 6
3: 67
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095709466 Original CRISPR GAGAATAGAACAGTGATTGC CGG Intronic
900616045 1:3566137-3566159 AAGAACAGGACAGTGACTGCAGG - Intronic
903519796 1:23938288-23938310 GAAAATAGAATGGTGGTTGCAGG + Intergenic
903599138 1:24521883-24521905 GAAAATAGAATATTGGTTGCTGG + Intronic
905237804 1:36562007-36562029 CAGAATAGGACTGTGATTCCAGG - Intergenic
905499949 1:38428292-38428314 GAGAACAGAACAGTGAGTTGTGG - Intergenic
905605247 1:39292421-39292443 GAAGATAGAACAGTGACTGAAGG - Intronic
906027946 1:42690965-42690987 CAGAAAAGAATAGTGATGGCTGG + Intronic
906809710 1:48813481-48813503 GAGAAGAGAGAAGTGATTCCAGG + Intronic
908603723 1:65770193-65770215 GAAAATAGTACAGTAATTGCTGG + Intergenic
909321257 1:74288585-74288607 GAGAGTAGAATGGTGGTTGCCGG + Intronic
909434780 1:75628388-75628410 CAGAATAGAATATTGATTACAGG + Intergenic
909872648 1:80762797-80762819 GAGTATAGAACAGAGATATCAGG - Intergenic
910305401 1:85757021-85757043 GAAAGTAGAACGGTGGTTGCAGG + Intronic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
911729629 1:101279452-101279474 CAGAATAGAAAAGTCATTCCTGG - Intergenic
912224778 1:107721006-107721028 GAGAAGAGATCAGTGTTTACAGG + Intronic
913524954 1:119682156-119682178 TAGAAAAGAACAGTGAAGGCAGG - Intronic
914503042 1:148264383-148264405 GAAAATACATCATTGATTGCTGG + Intergenic
916083143 1:161249076-161249098 GAGAAGAGATCAATGGTTGCTGG + Intergenic
916244569 1:162674628-162674650 AAAAATAAAACAGAGATTGCTGG - Intronic
916296339 1:163224229-163224251 GATAGTAGAACAGTGGTTACTGG - Intronic
918252797 1:182718707-182718729 GAGAACAGAACACTGTTTTCTGG + Intergenic
918553004 1:185765816-185765838 TAGATTAGAACACAGATTGCTGG - Intronic
921261034 1:213385246-213385268 AAGAACACAACAGTGTTTGCAGG + Intergenic
921428615 1:215035747-215035769 GAAAATAGAAGTGAGATTGCTGG + Intronic
921696965 1:218222685-218222707 TAGAATAGAAGAATGATTTCAGG - Intergenic
921879445 1:220237745-220237767 AAGAATAGAAGAGTGATGACAGG - Intronic
921917606 1:220629624-220629646 TATAATAGAATGGTGATTGCTGG - Intronic
922343439 1:224676314-224676336 GAGAACAGATTAGTGGTTGCTGG + Intronic
923639658 1:235742076-235742098 GAAAGTAGAATAGTGATTACTGG + Intronic
1063019259 10:2110392-2110414 CAGATTAGAGCAGTAATTGCAGG + Intergenic
1064376236 10:14798973-14798995 GAGGGTAGAAAAGTGGTTGCTGG + Intergenic
1064529043 10:16288422-16288444 GATTAAAGAACAGTCATTGCAGG + Intergenic
1066054085 10:31664138-31664160 GAGGACAGATCAGTGGTTGCTGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1067747908 10:48950223-48950245 GAAAGTAGAACAGTGGTTGCTGG - Intronic
1068311825 10:55288545-55288567 GAGAATAGACTGGTGGTTGCTGG - Intronic
1068317098 10:55359955-55359977 GAGAGTAGAAAGGTGATTACCGG + Intronic
1069164844 10:65141357-65141379 CAGAATAAAATGGTGATTGCCGG + Intergenic
1069555705 10:69396518-69396540 GAGAGTAGAATGGTGGTTGCTGG - Intronic
1071362257 10:84860415-84860437 GAGAACAAAACAGTGATTACCGG - Intergenic
1072081877 10:92041006-92041028 GAGAATAGATTCGTGGTTGCCGG + Intergenic
1072677917 10:97482495-97482517 GAAAGTAGATTAGTGATTGCTGG + Intronic
1072918049 10:99552168-99552190 GAGAGTACAACAGTGGTTACCGG + Intergenic
1073189148 10:101637872-101637894 GAGTATAAAATAGTGATTACGGG - Intronic
1073530518 10:104227800-104227822 TAGAATAGAGGAGTGATTCCAGG - Intronic
1074272511 10:111968771-111968793 GAAAATAGATTAGTGGTTGCCGG + Intergenic
1077637587 11:3854549-3854571 GAGAAGAGAACAGGAAGTGCAGG + Intronic
1078141369 11:8695572-8695594 GGGAAGAGAACAGTCATTGGAGG + Intronic
1078311996 11:10253174-10253196 GAGAAAAGAAAAATGATAGCAGG + Intronic
1078585742 11:12587059-12587081 GAGTATAGAAATGTGATTTCTGG - Intergenic
1079176376 11:18145253-18145275 GAAAATAGATCAGTGATTAAAGG - Intronic
1079263188 11:18903881-18903903 AAGAATAGAACAGTGATTAGAGG + Intergenic
1079267644 11:18949777-18949799 AAGAATAGATCAGTGATTAGAGG + Intergenic
1079269071 11:18965476-18965498 AAGAATAGATCAGTGATTAGAGG + Intergenic
1080275163 11:30495485-30495507 GAATATAAAATAGTGATTGCTGG - Exonic
1080342211 11:31278480-31278502 GAGAGTAGAATGGTGATTACAGG + Intronic
1080464217 11:32481693-32481715 GAAAATGGAAGAGTCATTGCCGG - Intergenic
1080533366 11:33198180-33198202 GAAAGTAGAACAGTGGTTACTGG - Intergenic
1080687985 11:34531499-34531521 GAGAATAGAATGGTAGTTGCTGG + Intergenic
1081960851 11:47136188-47136210 GAAAAGAGAAGAGTGATTTCTGG - Intronic
1084374033 11:68763969-68763991 GAGAATAGAAAAGGGAGGGCAGG + Intronic
1086182241 11:83966907-83966929 GAGGATAAAACAGTGGTTACAGG - Intronic
1086463056 11:87024791-87024813 GAGAATGGCAGAATGATTGCTGG + Intergenic
1087900791 11:103638177-103638199 GAGAAAAGAATAGGGATTTCAGG - Intergenic
1089393383 11:118117276-118117298 GAGACCAGAACAGAGACTGCTGG - Intronic
1089479970 11:118796665-118796687 GAAAATACAACTGTGATTGTAGG + Intergenic
1089978640 11:122754381-122754403 GAACATAGAACAGTAATTGGAGG + Intronic
1090084173 11:123636676-123636698 CAGAATAGAACAGAGAATGGAGG - Intronic
1090814711 11:130282323-130282345 GAAAGTAGAACAGTGACTACAGG - Intronic
1092017893 12:5174439-5174461 GAGAAAAGATCATTGGTTGCCGG - Intergenic
1092071284 12:5633502-5633524 GACAATGGAAAAGTGTTTGCTGG - Intronic
1092106844 12:5927405-5927427 GAGAAAAGAACAGAGACTGAAGG + Intronic
1092473458 12:8798427-8798449 GAGAGTAGAATGGTGGTTGCAGG - Intergenic
1093713797 12:22357737-22357759 GAGAATAAAACAGTGGTTACTGG - Intronic
1093857430 12:24123047-24123069 GAGAGCAGAACAGTCATGGCAGG + Intergenic
1095286811 12:40422536-40422558 GAGAACAAAACAGTGGTTACAGG - Intronic
1095682215 12:44991317-44991339 GAGAATAGAATGGTGGTTACCGG + Intergenic
1095709466 12:45273116-45273138 GAGAATAGAACAGTGATTGCCGG + Intronic
1095766150 12:45898245-45898267 GAAAGTAGAACAGTGGTTACTGG + Intronic
1096395790 12:51265676-51265698 GAAAATAGAACGGTGTTTGCAGG + Intronic
1097536576 12:60878928-60878950 GAGAATGAAACAGTAATTGTGGG - Intergenic
1097699687 12:62807472-62807494 GAGGAAAGAACAATGATTACAGG + Intronic
1098085256 12:66835715-66835737 GTAAAAAGAACAGTGATTGTTGG + Intergenic
1098090186 12:66893086-66893108 GAGAACAGATCAGTGGTTGTTGG - Intergenic
1098174478 12:67776692-67776714 GAGAGTAGAATGGTGATTACTGG + Intergenic
1098846032 12:75537074-75537096 GACAATAAAACAATGATTTCAGG + Intergenic
1099256121 12:80315041-80315063 GAGAATAGAATGGTGGTTACTGG + Intronic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101090296 12:101278546-101278568 GAGGATAGAGAAGTGGTTGCTGG - Intergenic
1102073091 12:110037741-110037763 GAGAAGGGACCAGGGATTGCAGG + Exonic
1102262109 12:111449440-111449462 TAGAACAGAACACTGATTGTGGG - Exonic
1102329740 12:112018958-112018980 GAAAATAGATGAGTGGTTGCTGG + Intronic
1102364827 12:112323620-112323642 GAGAATAGATCAATGGTTACCGG + Intronic
1103346243 12:120252248-120252270 GAGAACAGCACAGTGCTTGGTGG + Intronic
1103739701 12:123082890-123082912 GACAGTAGAACAGTGAGTGCTGG - Intronic
1103839692 12:123852114-123852136 AAGAATAGATCAGGGGTTGCAGG - Intronic
1104046120 12:125164297-125164319 GATAATAGATCTGTGATTACTGG - Intergenic
1104056625 12:125235638-125235660 GAGAGCGGATCAGTGATTGCTGG - Intronic
1104742259 12:131186908-131186930 GAGAATAGAATAGTGCTTGCCGG + Intergenic
1105347971 13:19591161-19591183 GAGAATAGAGCAGGGAGTGCTGG - Intergenic
1105425783 13:20293641-20293663 GAGAACAGATGAGTGACTGCGGG - Intergenic
1105835221 13:24204623-24204645 GAAAGTAGAACAGTAATTTCTGG - Intronic
1107036800 13:35910748-35910770 GAGAACAGACCAGAAATTGCTGG + Intronic
1107216552 13:37927168-37927190 GAAAATTGCACAGTGATTACAGG - Intergenic
1107480354 13:40780977-40780999 GAGAGTAGAGCAGGGAGTGCTGG - Intergenic
1107725484 13:43294937-43294959 GAAAACAGAGCAGTGGTTGCTGG + Intronic
1108300576 13:49070723-49070745 GAGAATAGAATCGTGGTTACTGG - Intronic
1108960056 13:56215364-56215386 GAAAGTAGAATAGTGGTTGCTGG + Intergenic
1109213935 13:59566046-59566068 GAGAATAGAACAAGGAAAGCTGG + Intergenic
1109594547 13:64532972-64532994 GACAGTAAAACAGTGATGGCTGG - Intergenic
1111156520 13:84334896-84334918 GAGAGTACAATAGTGGTTGCAGG + Intergenic
1111221660 13:85212572-85212594 CAGAATAGAATAGTGGTTTCTGG + Intergenic
1111781039 13:92724682-92724704 GAAAATTGAACAGTATTTGCAGG + Intronic
1112830443 13:103443349-103443371 GAAAATAGAATAGTGGTTACGGG - Intergenic
1112909010 13:104458934-104458956 GGGAATAACACAGTCATTGCCGG + Intergenic
1112910857 13:104481777-104481799 GAAAATAGAATGGTGATTTCTGG - Intergenic
1113428909 13:110232077-110232099 GAGAAGCTAACAGTGATTCCTGG - Intronic
1113776681 13:112951630-112951652 GAGAATAGTTCAGTGGTTGTGGG + Intronic
1115103390 14:29730820-29730842 GAGAGTAGAACAGTGGTTACTGG + Intronic
1116015940 14:39407473-39407495 GAGAATAAAATGGTGATTGCTGG - Intronic
1116391761 14:44400282-44400304 GAGAATAGAAGAATGGTTACTGG + Intergenic
1118069186 14:62226546-62226568 GAAAACAGATCAGTGGTTGCCGG - Intergenic
1118497364 14:66321559-66321581 GAGAGTAGAACAGTGGTTGCTGG + Intergenic
1119190893 14:72680973-72680995 GAGTATAGAACAGTGATGAAAGG - Intronic
1119708766 14:76806094-76806116 GAGAATAGAATAGGGAATGTGGG + Intronic
1120794917 14:88622052-88622074 GAGAGTAGAATAGTGGTTACTGG - Exonic
1121372984 14:93377501-93377523 GAAAATAAAATAGTGATTACCGG + Intronic
1122191590 14:100048906-100048928 GAGAACAGATCAGTGGTTGCTGG + Intronic
1123972816 15:25524954-25524976 GAGAATAGATTAGTGGTTTCAGG + Intergenic
1125662331 15:41403939-41403961 GAGAATAGAAGAGTCAGTGATGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126721173 15:51581634-51581656 GAAATTAGAACAGTGTTTGTGGG - Intronic
1127034255 15:54897254-54897276 GAAAACAAAACAGTGATTGAAGG + Intergenic
1127496030 15:59512989-59513011 AAGAAGAGAACAGATATTGCAGG + Intronic
1127755798 15:62090627-62090649 GAGAAAAGATCAGTAATTGCCGG - Intergenic
1128596251 15:68952929-68952951 GAGAACAGAATAGTGATTACCGG - Intronic
1129039896 15:72676776-72676798 GAGAATAGATTAGTGGCTGCAGG + Intronic
1129430551 15:75498355-75498377 GAGAATAGATTAGTGGTTGCAGG + Intronic
1132034824 15:98473683-98473705 GAGAACAGACCCGTGGTTGCTGG + Intronic
1132268113 15:100496492-100496514 GAAAATAGATTAGTGATTGCTGG + Intronic
1133383350 16:5349254-5349276 CAGAGTAGAATATTGATTGCCGG + Intergenic
1134030277 16:10986563-10986585 GAGAGGAGAATGGTGATTGCTGG - Intronic
1134031017 16:10992307-10992329 GAGAGGAGAACAGTGGTTACAGG - Intronic
1134120637 16:11581903-11581925 GAGAAAAGAACTGTGGTTACTGG + Intronic
1135108868 16:19674733-19674755 GAGAGTAGAATGGTGGTTGCAGG - Intronic
1135423243 16:22318440-22318462 GAGCAGAGCACAGTGATTGAGGG + Intronic
1135696946 16:24596653-24596675 GAAAATAGAATGGTGATTGATGG - Intergenic
1135977569 16:27119578-27119600 GAGAGTAGAACAGTAGTTACTGG - Intergenic
1136280285 16:29204516-29204538 GAGAGTAGAGCCGTGGTTGCCGG - Intergenic
1136858846 16:33683015-33683037 GAAAACAGAATGGTGATTGCAGG + Intergenic
1137390529 16:48077560-48077582 GAAAGTAGAATAGTGGTTGCAGG + Intergenic
1137992665 16:53175329-53175351 CAGAATAGAACAGGGAGTGCAGG - Intronic
1138716785 16:59032816-59032838 GAGAATTTAACACTGATTGATGG - Intergenic
1139456641 16:67084472-67084494 GACAGTAGAATAGTGGTTGCCGG + Intronic
1140295900 16:73709594-73709616 GAGAGTAGAATGGTGATTACTGG + Intergenic
1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG + Intergenic
1142084645 16:88170458-88170480 GAGAGTAGAGCCGTGGTTGCTGG - Intergenic
1203120420 16_KI270728v1_random:1531509-1531531 GAAAACAGAATGGTGATTGCAGG + Intergenic
1143244896 17:5475894-5475916 GAAAATAGAATGGTGATGGCTGG + Intronic
1143248433 17:5504653-5504675 TAGAATAAAACACTGACTGCTGG + Intronic
1143809247 17:9457384-9457406 GAGACTCGAGCAGTCATTGCTGG - Intronic
1146286290 17:31576242-31576264 GAAAATAGAACAGTGAATTGAGG + Intergenic
1146593546 17:34150204-34150226 GAGAGTAGAATGGTGATTACTGG + Intronic
1147648481 17:42048647-42048669 TAGAAGAGAACAGGGATTGAAGG - Intronic
1148996046 17:51710611-51710633 GAGAAAAGAAGAGTGATTAAAGG + Intronic
1149042013 17:52201517-52201539 GAGAATATAAGAGTGTTTCCAGG + Intergenic
1149084924 17:52704909-52704931 CAGAATAGATCAGTGATTATGGG - Intergenic
1149098667 17:52876171-52876193 GAAAATAGATCAGTTGTTGCAGG + Intronic
1150538247 17:66067907-66067929 GAGGATAGAACGGTGCTTGTGGG - Intronic
1151009956 17:70483294-70483316 GAGAATAGAATAGTGGTAACCGG + Intergenic
1151051906 17:70987755-70987777 GGAAAAAGAACAGTGACTGCAGG - Intergenic
1151861308 17:76764426-76764448 GAGAGTAGCATAGTGGTTGCCGG - Intronic
1151924949 17:77188321-77188343 GAAAACAGAAGAGTGGTTGCCGG - Intronic
1152705336 17:81840772-81840794 GAGCCTAAAACAGTGATTGCTGG - Intergenic
1153612720 18:6903113-6903135 CAGAATAGAATGGTGGTTGCTGG + Intronic
1154055832 18:11013280-11013302 AAGACTAGACCAGTCATTGCTGG + Intronic
1154126608 18:11697795-11697817 GAGAAGAGAACAGTGAGCTCCGG + Intronic
1154237701 18:12621674-12621696 GAAAGTAGATTAGTGATTGCTGG + Intronic
1155263357 18:24066956-24066978 GTGAATAGAATAGTGAGTGCTGG + Intronic
1155263495 18:24068285-24068307 GTGAATAGAATAGTGAGTGCTGG + Intronic
1155275895 18:24187204-24187226 GAGAGTAGAATGGTGGTTGCCGG + Intronic
1155772357 18:29717932-29717954 GAGAATATAATAGTGGTTTCCGG - Intergenic
1155879014 18:31120755-31120777 GAGAGTAGAACAGTGGTTTCAGG - Intergenic
1155885332 18:31200734-31200756 GAGAATAGAATGGTGGTTACAGG - Intergenic
1156317079 18:35979996-35980018 GAGGATATAATAGTGATTACTGG + Intergenic
1156549238 18:37998121-37998143 GAGATAATAACAGTGTTTGCAGG - Intergenic
1157105069 18:44766506-44766528 CAGAATAGAATAGTGGTTTCAGG + Intronic
1157516213 18:48313494-48313516 GGAACTAGAGCAGTGATTGCAGG - Intronic
1158051315 18:53224361-53224383 TAGAATAGAAGACGGATTGCTGG + Intronic
1158150715 18:54366307-54366329 GAGAGTAGAATAGTGGTTACCGG - Intronic
1158326247 18:56316493-56316515 GAGAATAGAACAGAGATGATTGG - Intergenic
1159688609 18:71457135-71457157 AAGAATGGATCAGCGATTGCTGG - Intergenic
1159933574 18:74340819-74340841 GAGAGTAGAATAGTGCTTACCGG + Intronic
1160137586 18:76285811-76285833 GAGAAAAGAGCAGTCACTGCAGG + Intergenic
1160245736 18:77158149-77158171 GAAAATAGTACAGAGATTTCTGG + Intergenic
1162860229 19:13500995-13501017 GAGAACAGATCAGTGGTTGAAGG + Intronic
1163228878 19:15985348-15985370 GAGAGTAGAACAGTGGTTACTGG + Intergenic
1164427982 19:28160265-28160287 GAGAATAGAATAGTGATTTGGGG - Intergenic
1167235999 19:48315676-48315698 GAAAACAGATGAGTGATTGCTGG - Intronic
1168495310 19:56842914-56842936 GAGAAGAGACCACTGATGGCAGG - Intergenic
926136166 2:10338148-10338170 GAAAATAGATTCGTGATTGCAGG + Intronic
930327544 2:49939208-49939230 GAGAAAAAAATTGTGATTGCTGG - Intronic
931028613 2:58144212-58144234 GAGCATAGAACAGTATTTGTCGG + Intronic
932595470 2:73090708-73090730 GTGAAAAGATCAGTGGTTGCTGG + Intronic
932713494 2:74084958-74084980 GAAAGTAGAACAGTGGTTTCAGG + Intronic
933360495 2:81276768-81276790 GAGAGTAGAATGGTGGTTGCTGG + Intergenic
933935068 2:87196890-87196912 GAGAATAGAGCAGGGGTTGCTGG + Intergenic
936358076 2:111769008-111769030 GAGAATAGAGCAGGGGTTGCTGG - Exonic
937235569 2:120429955-120429977 GAGTCTTGAACAGTGAGTGCAGG - Intergenic
938568809 2:132543803-132543825 GAGAAAAGAGCATTTATTGCAGG + Intronic
939989807 2:148866844-148866866 GACAATATGAAAGTGATTGCAGG + Intergenic
940861846 2:158778858-158778880 GAGAACAGATTAGTTATTGCTGG + Intergenic
940863500 2:158793688-158793710 GAAATTGGATCAGTGATTGCTGG - Intergenic
941145502 2:161839275-161839297 GAGACCAGATCAGTGGTTGCTGG + Intronic
941680214 2:168390126-168390148 GAGAGTAGAACAGTGGTTACCGG + Intergenic
941949257 2:171136284-171136306 GAAAGTAGAATAGTGGTTGCTGG + Intronic
943277961 2:185892433-185892455 GAGAATAAAACAGACACTGCGGG + Intergenic
943492490 2:188572824-188572846 GAGAGTAGACTAGTGGTTGCTGG + Intronic
943887226 2:193234709-193234731 GAGAATAAAATGGTGGTTGCTGG + Intergenic
943892814 2:193312120-193312142 TATAAGAGAAAAGTGATTGCTGG + Intergenic
943960089 2:194253542-194253564 AAGAATAGAATAATGGTTGCCGG - Intergenic
944753546 2:202736316-202736338 GATGAGAGGACAGTGATTGCTGG + Intronic
944768829 2:202891879-202891901 CAGAGTACAACAGTGGTTGCCGG + Intronic
945159941 2:206879282-206879304 GAGAACAAAACAGTGGTTGCAGG - Intergenic
945789417 2:214286142-214286164 GAGAGTAGAATGGTGGTTGCTGG + Intronic
946147532 2:217742231-217742253 GAAAATAGAACAGTGACTATTGG - Intronic
947246938 2:228058969-228058991 GGGAACAGATCAGTGATTGCTGG - Intronic
947469793 2:230390450-230390472 CAGAATGGAACAGTCATTCCTGG - Intronic
1168751730 20:286838-286860 GAGAGCAGATTAGTGATTGCAGG - Intronic
1168941693 20:1718253-1718275 GAGAATAGACCAGTAAATGATGG - Intergenic
1169107373 20:3008449-3008471 GAAAGTAGAATAGTGGTTGCTGG + Intronic
1170238763 20:14138591-14138613 CAGCATGGAATAGTGATTGCCGG + Intronic
1172234906 20:33365231-33365253 GAGAATAGTATAATGAATGCTGG - Intronic
1174706937 20:52666587-52666609 GAGAGTAGAACAGTGTTTACGGG - Intergenic
1174852812 20:54012211-54012233 GAGAACAGACTAGTGGTTGCAGG + Intronic
1174934131 20:54849242-54849264 AAGGATAGAAAAGTGTTTGCAGG - Intergenic
1175072102 20:56343501-56343523 GAGAAGTGAAAAGTGATTTCTGG - Intergenic
1176961547 21:15164445-15164467 GCGAATAAAACAGTGGTTGCCGG - Intergenic
1177221317 21:18196796-18196818 GAGACTAGAATGGTGGTTGCTGG + Intronic
1178433709 21:32538561-32538583 GTGAATAGAACAGTGGTTACAGG + Intergenic
1178749625 21:35288563-35288585 GTGAATAGAACAGTGGTTCCTGG + Intronic
1178758407 21:35376019-35376041 GAGAGTAGAAAGGTGGTTGCCGG - Intronic
1178968381 21:37146665-37146687 GAAAGTAGACCAGTGATTGCTGG + Intronic
1179403234 21:41103295-41103317 AAGAAAAGAATAGTGGTTGCTGG - Intergenic
1179417873 21:41212813-41212835 GAGAAGACAGCAGAGATTGCTGG - Intronic
1180763405 22:18226187-18226209 GAGAACAGAATGGTGGTTGCTGG + Intergenic
1180772240 22:18398357-18398379 GAGAACAGAATGGTGGTTGCTGG - Intergenic
1180803619 22:18647973-18647995 GAGAACAGAATGGTGGTTGCTGG - Intergenic
1180807146 22:18721474-18721496 GAGAACAGAATGGTGGTTGCTGG + Intergenic
1180902360 22:19383962-19383984 GAGAATAGAATGGTGAATACTGG - Intronic
1180950871 22:19719971-19719993 GAGAACAGAACAGTGGGAGCTGG - Intronic
1181218100 22:21347291-21347313 GAGAACAGAATGGTGGTTGCTGG + Intergenic
1182426000 22:30273050-30273072 GAGAATACACCAGTGGCTGCTGG + Intergenic
1183206168 22:36420547-36420569 GAGAACAGAACAGCTGTTGCTGG + Intergenic
1183949203 22:41343355-41343377 CAGAATTGAAGAGTGATGGCTGG - Intronic
1184905477 22:47482763-47482785 GAGAGTACATTAGTGATTGCTGG + Intronic
1203234079 22_KI270731v1_random:139346-139368 GAGAACAGAATGGTGGTTGCTGG - Intergenic
949397863 3:3634463-3634485 GAGAATAAGACAGAGTTTGCTGG + Intergenic
949529183 3:4937123-4937145 GAGAAGAGAACAGAGGTGGCAGG - Intergenic
949843586 3:8348495-8348517 GAAAGCAGACCAGTGATTGCTGG + Intergenic
950159518 3:10749591-10749613 GAGATTAGAACAGTGGTTCATGG + Intergenic
950225598 3:11231026-11231048 GAGAACAGATTAGTGGTTGCCGG - Intronic
951815883 3:26754237-26754259 AAGAGTAGAATGGTGATTGCTGG + Intergenic
952373524 3:32746156-32746178 GAAATCAGAACAGTGGTTGCGGG + Intronic
952567442 3:34676024-34676046 GAGAAGAGGAAAGAGATTGCTGG + Intergenic
955045460 3:55355183-55355205 GAAAGTAGAATAGTGGTTGCTGG - Intergenic
955144041 3:56298675-56298697 GAGAATAAATTAGTGATTGCTGG + Intronic
955718481 3:61856325-61856347 GAAAGTAGATCAGTGGTTGCCGG - Intronic
956087965 3:65633536-65633558 GAGAAAAGAACAGAGAAGGCAGG - Intronic
956384561 3:68703022-68703044 AAGAATGGCACAGTGAATGCAGG + Intergenic
956525746 3:70158229-70158251 GAAAATAGATTAGTGGTTGCTGG - Intergenic
957718695 3:83967422-83967444 GAGAGTAGAACAGTAATTACCGG + Intergenic
958627789 3:96648302-96648324 GCAAATAGATCAGTGATTTCAGG + Intergenic
958909598 3:99978909-99978931 GGGAGTAGAACAGTGATTACTGG + Intronic
959401635 3:105909340-105909362 GAGAATAGAAGAATGTTTACCGG - Intergenic
959450530 3:106493676-106493698 TAGAATAGGAAAGTGATTACAGG + Intergenic
959535304 3:107478058-107478080 GAGAATAAAACAGAGGTTACTGG + Intergenic
960469625 3:118046582-118046604 GAGAATAGAATGGTGGTTGCCGG + Intergenic
962750196 3:138429218-138429240 GAAAATAGAATGGTGGTTGCGGG + Intergenic
964356511 3:155855970-155855992 CAGAAAAGAACAGTGTTGGCCGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
967302515 3:188029502-188029524 GAGAACATATCAGTGGTTGCTGG + Intergenic
968499849 4:944335-944357 GAAAACAGATCAGTGGTTGCTGG + Intronic
969205846 4:5644703-5644725 CAGAATAGAATAGTGGTTACTGG - Intronic
969228356 4:5813505-5813527 GACAATATAAAAGTGATTTCTGG - Exonic
969990646 4:11259013-11259035 GAGAATAGAATGGTGGCTGCTGG + Intergenic
970402805 4:15734153-15734175 GAGAGCAGACCAGTGATTGTGGG + Intronic
971024535 4:22575665-22575687 GAGAATACAACTGGGATTGGTGG + Intergenic
971475606 4:27069015-27069037 GAGAATTGAACAGAGATTAATGG + Intergenic
971619965 4:28843875-28843897 GAGAACAGAAAAGTGGTTGGAGG - Intergenic
972464294 4:39338931-39338953 GAGAATGCAACAGTGGTTGCAGG - Intronic
972614049 4:40681270-40681292 GAGGATAGAAAAGTGCTTACTGG + Intergenic
972957432 4:44409809-44409831 GAGGTTAGAATAGTGATTACAGG + Intronic
973193319 4:47411462-47411484 GAGAACAGATTAGTGGTTGCCGG + Intronic
973687641 4:53389121-53389143 GAAAGCAGAACAGTGTTTGCCGG - Intronic
974097592 4:57381577-57381599 GAGAGTAGAAGGGTGATTGTTGG + Intergenic
974279495 4:59774326-59774348 GAGAATAGAAAATTGATAGATGG + Intergenic
974399945 4:61390849-61390871 GAGAACAGACCAGTGGCTGCCGG - Intronic
975678331 4:76850353-76850375 GGGAATAAAACGGTGATTCCTGG - Intergenic
976043530 4:80916705-80916727 GAAAACAGAACAATTATTGCAGG + Intronic
976436360 4:85023041-85023063 GAGACTAGAAAAGTGACTGAAGG - Intergenic
976868996 4:89767919-89767941 TAGAATAAAACAGTGGTTACCGG - Intronic
977902308 4:102436778-102436800 GAGAATAGAGAGGTGGTTGCCGG + Intergenic
978180866 4:105794223-105794245 GTGAAAAGATCAGTGGTTGCCGG + Intronic
978210163 4:106125672-106125694 GAGAGTAGAACAGTAGTTGCTGG + Intronic
978396761 4:108289011-108289033 GAGAATGGAACAATCACTGCAGG - Intergenic
979317755 4:119285101-119285123 TAGAACAGAACAGTAATTGATGG + Intronic
980256292 4:130384002-130384024 GAGAATAGAACAGTGATTACTGG - Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
981006058 4:139876533-139876555 GCGAATAGAAGGGTGATTGAAGG - Intronic
981490114 4:145330634-145330656 GAGAGCAGAACAGTTGTTGCTGG + Intergenic
981600628 4:146484524-146484546 GAGAAAAAAACAGTGGTTACTGG + Intronic
981603637 4:146520378-146520400 GAGAATAAAGCAGTTATTCCTGG - Intronic
983627553 4:169817113-169817135 TAAAACAGAACAGTGGTTGCCGG + Intergenic
983978094 4:173961354-173961376 CAGAATAGAATAGTGGTAGCCGG - Intergenic
985023624 4:185717294-185717316 AAGAAAAGGGCAGTGATTGCTGG + Intronic
985108803 4:186526240-186526262 TAGAATAGAACAGCGTTTGTTGG + Intronic
985113114 4:186566101-186566123 GGGAATAAAACAGTGGTTGCCGG + Intergenic
985863836 5:2495814-2495836 AAGAATAGAACAGCAATTGTTGG + Intergenic
986202878 5:5594654-5594676 GAGAGTAGAATGGTGGTTGCTGG + Intergenic
986969801 5:13319185-13319207 GAGAATAGAATAGTGGTTACTGG - Intergenic
988339382 5:29950107-29950129 AAGAATAGATTAATGATTGCAGG - Intergenic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
988830075 5:34978524-34978546 AAAAATAGATCAGTGATTGCTGG + Intergenic
990457772 5:56004730-56004752 GAGAGTAGATCAGGGAGTGCGGG + Intergenic
991528577 5:67591363-67591385 GAGAATTGAAGAGTGACTGGGGG + Intergenic
992994677 5:82320988-82321010 GAGAATAGAATAGTGACTTTTGG + Intronic
993807323 5:92427069-92427091 CAGAATAGATTAGTGGTTGCTGG - Intergenic
993905415 5:93618206-93618228 GAGAAAAGAACAGTTATTAAAGG + Exonic
994302558 5:98163053-98163075 GAGAGTAGAAAGCTGATTGCAGG + Intergenic
994654579 5:102574895-102574917 GAGAATAGAATGGTGGTTACTGG - Intergenic
994770980 5:103981344-103981366 GTAAAGAGATCAGTGATTGCTGG + Intergenic
995975254 5:118027595-118027617 GTCAATAGAACAGAGATTACTGG + Intergenic
998858388 5:146418496-146418518 GAAATCAGATCAGTGATTGCTGG + Intergenic
999345382 5:150814170-150814192 GAGAATAGAAAAGCAATTGAGGG + Intergenic
999696788 5:154194285-154194307 GAGAAAAAAACATTGATTTCTGG - Intronic
1000053691 5:157584351-157584373 TAAAATAGACCAGTGATTCCAGG - Intergenic
1000165162 5:158641219-158641241 GAGATGAGAACAGTCAGTGCTGG + Intergenic
1000174690 5:158739901-158739923 GAGCTTAGAACAGCAATTGCCGG + Intronic
1000574024 5:162953529-162953551 TAGAATAAAACAGGGCTTGCTGG - Intergenic
1001752006 5:174138443-174138465 GAGAATACCATAGTGGTTGCCGG - Intronic
1001954697 5:175841136-175841158 GAGTCTAAGACAGTGATTGCTGG + Intronic
1003010888 6:2426567-2426589 GAGAGTAGAATAGTGGTTACCGG - Intergenic
1003410830 6:5861541-5861563 GAGAGTAGAATAGTGGTTACTGG + Intergenic
1003553444 6:7119602-7119624 GAGAAAAGCACAGTGTTTGGAGG + Intronic
1003869777 6:10392366-10392388 GAGGAAAGAAAAGTGATTTCAGG - Intergenic
1004579608 6:16937140-16937162 GAAAGTAGATTAGTGATTGCTGG + Intergenic
1005561204 6:27043398-27043420 GAGAGTAGAACAGTGGTTGCCGG + Intergenic
1006827989 6:36950213-36950235 GAAAATAGAATGGTGATTGCCGG - Intronic
1007635458 6:43297396-43297418 GAGAATAAACCAGACATTGCTGG + Intronic
1009966558 6:70584419-70584441 GAGAACAGATCAATGGTTGCTGG - Intronic
1011029163 6:82902581-82902603 AAGGACAGAGCAGTGATTGCAGG + Intronic
1011121243 6:83955674-83955696 GAGCAGAGAACACTGACTGCTGG - Intronic
1011501230 6:87992348-87992370 AAAAATAGAACCGTGATTTCAGG + Intergenic
1011854745 6:91675668-91675690 GTGAATAAAACAGTAAGTGCAGG - Intergenic
1011987790 6:93472156-93472178 CAATATAGAACAGTGATTGATGG - Intergenic
1012763583 6:103334019-103334041 AAAAAAAGACCAGTGATTGCTGG + Intergenic
1013068142 6:106703652-106703674 GAGAATAAAGCAGTGATGGTGGG + Intergenic
1013245967 6:108287543-108287565 GAGAATAAAACGGTGGTTACTGG + Intergenic
1013578906 6:111512527-111512549 GAAAATAGTTCAGTGATTGCTGG + Intergenic
1014296633 6:119626598-119626620 GAGAGTAGAACAGTGGTTCCAGG + Intergenic
1014711898 6:124816249-124816271 GTAAAAAGATCAGTGATTGCCGG + Intronic
1015237394 6:130986913-130986935 GAAAGTAGATTAGTGATTGCTGG - Intronic
1016371059 6:143374666-143374688 CAGAATAAAATAGTGATTTCAGG + Intergenic
1017541948 6:155412268-155412290 GAGAAGAGAACATTGATCACTGG - Intronic
1017931006 6:158955450-158955472 GAAAGTAGAACGGTGATTGCTGG - Intergenic
1018911747 6:168104961-168104983 GGGAAAAGATCAGTGGTTGCCGG + Intergenic
1019007628 6:168814622-168814644 GAGAATAGAATTTTGATAGCAGG + Intergenic
1019956624 7:4420160-4420182 GAGAATAAATTAGTGGTTGCTGG - Intergenic
1020352473 7:7236352-7236374 ATGGATAGAACAGTGAATGCAGG - Intronic
1020442902 7:8237612-8237634 GAAACTAGAATAGTGGTTGCTGG - Intronic
1021258769 7:18427908-18427930 AAGAACAGAATAGTGATTCCAGG - Intronic
1021630501 7:22640489-22640511 GAGAGTAAAACGGTGGTTGCCGG - Intergenic
1022172876 7:27846135-27846157 GGGAATAAAACAGTGGTTGTGGG - Intronic
1022437202 7:30399840-30399862 GAGAACACATCAGTGGTTGCTGG - Intronic
1023089489 7:36604447-36604469 AATAATAGAACAGTGATAGTTGG + Intronic
1023220866 7:37919241-37919263 AAGAGTAGAACAGTGGTTCCTGG - Intronic
1023877884 7:44299350-44299372 GAAAGTAGAACAGAGGTTGCTGG + Intronic
1024014688 7:45301994-45302016 GAGACTAGAATGGTGGTTGCTGG + Intergenic
1024625608 7:51206837-51206859 GAGAACAGAAGAGTGGTTGCAGG + Intronic
1025008141 7:55371195-55371217 GAGAACAAAACAGTTATTACCGG - Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027714126 7:81648010-81648032 GTGAAAAGAGCAGTGGTTGCAGG + Intergenic
1028469954 7:91195025-91195047 GAGCAAAGAACAGTGGTTGCAGG - Intronic
1028878164 7:95847304-95847326 GAGAAAAGATCTGTGATTGATGG - Intronic
1029216399 7:98953615-98953637 GAAAGTAGAATAGAGATTGCGGG + Intronic
1030021891 7:105283581-105283603 GAAAGTAGATTAGTGATTGCGGG + Intronic
1030597372 7:111556134-111556156 GAGAATAAAACAGTGATCCCAGG + Intronic
1030635653 7:111945480-111945502 CAAAGTATAACAGTGATTGCGGG - Intronic
1030772364 7:113490066-113490088 CAGAATAGAATAGTGGTTGTGGG + Intergenic
1031775119 7:125899244-125899266 GAGAATAGAACAGTGATTACCGG - Intergenic
1032161916 7:129517332-129517354 GAGAAGGGAACGGTGACTGCAGG + Intergenic
1032652889 7:133898034-133898056 GAGGGTAGAACAGCGGTTGCTGG - Intronic
1034093100 7:148382112-148382134 GAGAATGGAAAAGTGAGAGCAGG + Intronic
1035155037 7:156905454-156905476 GAGAATAGAACTGAGACTGAAGG - Intergenic
1035550137 8:516729-516751 ATAAATAGAACCGTGATTGCCGG - Intronic
1035936725 8:3849588-3849610 GGGAAAAGAACAGTGATTCCTGG + Intronic
1036066142 8:5383761-5383783 GAGAATAGAATGCTCATTGCCGG - Intergenic
1036570941 8:9979450-9979472 GAGAATAGAACAGAGGAGGCTGG - Intergenic
1037108627 8:15139785-15139807 AACAATAAAACAGTAATTGCAGG - Intronic
1037787781 8:21912668-21912690 GAGAAGAGGACAGTGACTGCAGG + Intronic
1038197806 8:25384246-25384268 GAAAGTAGATCAGTGGTTGCTGG + Intronic
1038842467 8:31197788-31197810 GAGAACAGATTAGTGGTTGCCGG - Intergenic
1039140281 8:34379722-34379744 GAGAATAAAACAATGATTACTGG + Intergenic
1039481803 8:37879419-37879441 GAAAGTAGAATGGTGATTGCCGG + Intronic
1039831056 8:41215353-41215375 GAGAACAGGTCAGTGATTGTGGG + Intergenic
1040027037 8:42791260-42791282 TAGAATAGAATAGTGGTTACTGG - Intronic
1040995935 8:53402367-53402389 GACAGTAGAACAGAGATTGCAGG - Intergenic
1041759914 8:61354787-61354809 AAGAACAGATCAGTGATTACAGG + Intronic
1042103702 8:65301293-65301315 GAGAATAGAACAATGATACCAGG + Intergenic
1042106226 8:65329178-65329200 GGGAACAGATTAGTGATTGCTGG - Intergenic
1042343089 8:67700799-67700821 CAAAATAGAACTGTGAATGCTGG - Intronic
1042618004 8:70670949-70670971 GAGGATGGAACAGTAATTTCTGG + Intronic
1043608363 8:82030516-82030538 GAGAATGAAACAGTGGTTACTGG - Intergenic
1044297803 8:90548663-90548685 GAGAATAGAAGGATGGTTGCTGG + Intergenic
1044358054 8:91248403-91248425 GAGAATAGAAATCTGATTTCTGG - Intronic
1044865882 8:96570884-96570906 GAAATTAGAACAGTGGTTACCGG + Intronic
1045603388 8:103745200-103745222 GAAAGTAGATTAGTGATTGCAGG - Intronic
1046267058 8:111845065-111845087 GTGAATAGAACAGTGGTTACAGG - Intergenic
1046696099 8:117341260-117341282 GAGAATAGAAAGGTGGTTACCGG + Intergenic
1048386065 8:133913604-133913626 CAGAATAGACCTGTGAGTGCTGG - Intergenic
1048394278 8:133998954-133998976 GAAAGTAGAACAGTGGTTGCTGG - Intergenic
1048514587 8:135094394-135094416 AAGAAAAGAACATTGAGTGCAGG - Intergenic
1048887740 8:138922176-138922198 TAGAAGAGAAAAGTGATGGCCGG - Intergenic
1050409269 9:5345300-5345322 GAGAATAGAACAGTGGTTACTGG + Intergenic
1051387951 9:16530375-16530397 GAGAAATGTACAGTGATTTCTGG - Intronic
1051723463 9:20064284-20064306 GAGAGTAGATCAATGGTTGCTGG + Intergenic
1052648340 9:31268066-31268088 GAGAATAATAAAGTGATTGAGGG + Intergenic
1052862450 9:33445474-33445496 GAGCAAAGATCAGAGATTGCAGG + Intronic
1052959163 9:34279986-34280008 TAGAATAGAACAGTGCCGGCCGG + Intronic
1053831618 9:42088137-42088159 GAAAGTAGAACAGTGATAGGTGG + Intronic
1054598928 9:67099311-67099333 GAAAGTAGAACAGTGATAGGTGG - Intergenic
1054766936 9:69049820-69049842 GAAAGTAGATTAGTGATTGCTGG - Intronic
1056788759 9:89611631-89611653 CAGAATAGAACAGTGTTTCTGGG + Intergenic
1057755007 9:97826813-97826835 GTAAAAAGACCAGTGATTGCCGG + Intergenic
1059246445 9:112853684-112853706 GAGAGTAGAACGGTGGTTGCCGG + Intronic
1059547759 9:115195784-115195806 GAGAACAAAACAGTGGTTACTGG - Intronic
1060028797 9:120196215-120196237 GAGAGTAGAATAGTGGTTACAGG + Intergenic
1061491395 9:130946682-130946704 GAAATCAGAACAGTGATTGCAGG - Intergenic
1061573993 9:131494943-131494965 GAGAAGAGAATAGTGCGTGCAGG - Intronic
1061704878 9:132445267-132445289 GAAAATAGAACAGTGAGGCCAGG - Intronic
1062222975 9:135429102-135429124 GAGAGTAGAACGGTGATTGTGGG + Intergenic
1186387047 X:9120591-9120613 GAGAAAAGCACAGTGATTCACGG + Intronic
1187658606 X:21511659-21511681 GAGAAAAGCACAGTGTTTGAAGG + Intronic
1187660009 X:21534114-21534136 GAGAGTAGAACTGTGGTTACTGG - Intronic
1187715900 X:22102240-22102262 GAGAATAGAAGGGTGGTTACTGG - Intronic
1187840450 X:23481547-23481569 GAGAATAGAATGGTGGTTGCCGG - Intergenic
1188249175 X:27870917-27870939 GAGAATAAAATAGTGGTTACTGG - Intergenic
1188646299 X:32571728-32571750 GAGAATAGAAGAGGAATTGCTGG - Intronic
1189215948 X:39323926-39323948 GTGAATAGAACAGTGGTTACCGG + Intergenic
1189387323 X:40548061-40548083 GAGCATACAACAGTGAGTGTTGG + Intergenic
1190434884 X:50414174-50414196 GAGAATAGAATGGTGGTTGAGGG + Intronic
1190905484 X:54723013-54723035 GATAAAAGAACAGTGACTGCTGG - Intergenic
1191836246 X:65466177-65466199 GAGAGTAGAAGAGTGGTTACTGG - Intronic
1192246671 X:69378757-69378779 GAGAAGAGAAGAGTGAGGGCTGG - Intergenic
1193146540 X:78082079-78082101 GAATGTAGAACAGTGATTACCGG - Intronic
1194412748 X:93577660-93577682 GAGACTTGAACAGTGGTAGCAGG + Intergenic
1194634743 X:96331394-96331416 GAGAGTAGAATGGTGGTTGCTGG - Intergenic
1194682745 X:96873474-96873496 GAGAATAGGTTAGTGGTTGCTGG + Intronic
1195012607 X:100747914-100747936 GAGAGTAGAATAGTGGTTGTTGG - Intergenic
1195214442 X:102684777-102684799 GATAACAGAACAGAGATTTCAGG - Intergenic
1195542071 X:106074349-106074371 GAGAGTAGAAAAATGATTACTGG + Intergenic
1197239741 X:124110393-124110415 GAGTGTCGAACAGTGAGTGCAGG - Intronic
1197686816 X:129448834-129448856 GAGAACAGATCAATGGTTGCCGG + Intronic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1199609631 X:149601443-149601465 GAGAACAGATCAGTGTTTGCCGG - Intronic
1199629485 X:149767911-149767933 GAGAACAGATCAGTGTTTGCCGG + Intergenic
1200329452 X:155281183-155281205 AAGAATAGAGCAGTGATTACCGG + Intronic
1200342899 X:155417947-155417969 GAGAATAGAATAGTGTTTGCTGG + Intergenic
1200753696 Y:6970142-6970164 GAGACTGGAATAGTGGTTGCTGG - Intronic
1201592087 Y:15626714-15626736 GAAAAATGAACAGTGAGTGCTGG - Intergenic