ID: 1095710167

View in Genome Browser
Species Human (GRCh38)
Location 12:45279626-45279648
Sequence GTGTCCTAAACACTGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095710167_1095710174 20 Left 1095710167 12:45279626-45279648 CCCTGGGTCAGTGTTTAGGACAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1095710174 12:45279669-45279691 TGCTACAAACTCTTTAATCCTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1095710167_1095710175 21 Left 1095710167 12:45279626-45279648 CCCTGGGTCAGTGTTTAGGACAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1095710175 12:45279670-45279692 GCTACAAACTCTTTAATCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095710167 Original CRISPR GTGTCCTAAACACTGACCCA GGG (reversed) Intronic
900802309 1:4744995-4745017 GTGGCCTAACCACTGGCCCCAGG - Intronic
903184509 1:21621848-21621870 GTCACATAAACACTGACACATGG + Intronic
903811999 1:26039760-26039782 GTGTCCCAAGCACTCACCAATGG + Exonic
903948143 1:26977162-26977184 GTGTCATTACCCCTGACCCAGGG - Intergenic
909267033 1:73573429-73573451 GTGTCCTGACTTCTGACCCATGG - Intergenic
910094010 1:83499308-83499330 GTGAGCTAAACCCTGCCCCAAGG + Intergenic
910592660 1:88943885-88943907 ATGTGCTAGACACTGACCTAGGG - Intronic
917980116 1:180263877-180263899 GTGTCCTAACCAGAGATCCAAGG - Intronic
918066907 1:181107641-181107663 GTGTCCTGAACACTGAGCAGAGG + Intergenic
919887243 1:201943719-201943741 GTGTCATAAACACTCAGTCAAGG - Intronic
921115053 1:212082194-212082216 GAGGCCTAAAAACTGACCAATGG + Intronic
921139733 1:212295776-212295798 GTTGCCTAAAGACTAACCCACGG - Intronic
922324698 1:224517209-224517231 GTGTGCTCAGCACTGCCCCATGG - Intronic
1062975692 10:1680812-1680834 GTGTCCTGAAAACTCACCCCAGG - Intronic
1065860598 10:29869566-29869588 GTCTTCTAAAAACTGACCCTTGG - Intergenic
1067209110 10:44243621-44243643 TTGTCCTCAACACATACCCAGGG + Intergenic
1069633158 10:69909871-69909893 GAGTTCTAACCACTGAGCCATGG - Intronic
1071226965 10:83541820-83541842 GTGTTTGAAAGACTGACCCAAGG + Intergenic
1076208517 10:128622605-128622627 GTGACCTCACCACTCACCCAGGG + Intergenic
1077867199 11:6233027-6233049 GGTTCCTAAACACTGGACCAAGG - Intronic
1080261121 11:30350758-30350780 GATGCCTAAACACTGACCCTGGG - Intergenic
1081637420 11:44729715-44729737 GTGTCCTAAACCCAACCCCAAGG - Intronic
1081785795 11:45746184-45746206 GTGTCCCCAGCACTGACACATGG - Intergenic
1083698561 11:64458646-64458668 GTGTCATAATTACTGAGCCAAGG + Intergenic
1091983908 12:4891989-4892011 GTTTCTTCAACACTGGCCCACGG + Intergenic
1095710167 12:45279626-45279648 GTGTCCTAAACACTGACCCAGGG - Intronic
1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG + Intronic
1100322623 12:93510100-93510122 GTGTCCTCCCCACTGACCCCCGG + Exonic
1100783798 12:98057729-98057751 GGTTCCTAATCACTGACTCACGG - Intergenic
1102687313 12:114735004-114735026 GTGTCCTCAGCACTTACACAAGG - Intergenic
1104753536 12:131254834-131254856 GTGTCCAGAACAGGGACCCAGGG + Intergenic
1106074455 13:26445766-26445788 GTGTCCGAGGCACTGTCCCAAGG - Intergenic
1108864132 13:54901819-54901841 GTGTGCTAAACCATGACCAAGGG + Intergenic
1110370490 13:74734655-74734677 GTTTGCTGACCACTGACCCAGGG + Intergenic
1112077741 13:95931591-95931613 GGGTCCCAAGCCCTGACCCAGGG + Intronic
1113067181 13:106384473-106384495 GTGACCTACTCAGTGACCCACGG - Intergenic
1114333010 14:21657265-21657287 ATGTCCCAAAGAGTGACCCAGGG - Intergenic
1117770590 14:59130229-59130251 GTGTCCTAAGCAATCATCCAAGG - Intergenic
1119357015 14:74016003-74016025 GTGTTCTAAACAATGAAACAAGG + Intronic
1120477217 14:85003709-85003731 GTGTCCTTTACTCTGACCCTGGG + Intergenic
1121300665 14:92868059-92868081 GTGTCCTAATCACCTCCCCAGGG + Intergenic
1122118269 14:99538259-99538281 GGGTCCTAAAGACTGACCTGTGG - Intronic
1123939571 15:25210341-25210363 CTGTCCTAAAGACTGACCCTTGG - Intergenic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1126657016 15:50989612-50989634 GTGTCCCAAACAGGGACCAAAGG + Intronic
1127013908 15:54661197-54661219 GTTTCCTAGACACTTTCCCATGG - Intergenic
1127886759 15:63208207-63208229 GAATCCTAAACTCTAACCCAGGG + Intronic
1129006809 15:72380654-72380676 GTGTGCTAGACACTGTTCCAGGG - Intergenic
1131022610 15:89112093-89112115 GTGACCTCAACACTGATCCCTGG - Intronic
1133429460 16:5724202-5724224 GTGTCCTGAGCAAAGACCCAAGG + Intergenic
1138553903 16:57761315-57761337 GTGTCCTAAGCACGCACCCTTGG - Intronic
1141764467 16:86049355-86049377 GTGTCATCACCACGGACCCAGGG - Intergenic
1143025491 17:3939301-3939323 CAGTCCTTAACCCTGACCCATGG - Intronic
1144340403 17:14304950-14304972 GTGGCCTAACCAGTAACCCAGGG + Intronic
1146257913 17:31402269-31402291 AAGTCCTAAGCACAGACCCAGGG + Intronic
1150577737 17:66445085-66445107 ATGTCCTTGACATTGACCCAGGG + Intronic
1150959004 17:69893883-69893905 GTTTGCTTAGCACTGACCCAAGG + Intergenic
1151817235 17:76477335-76477357 CTGTCCCAAACACTGCCCCCCGG + Intronic
1152614065 17:81329881-81329903 GTGTCCTCCGCACTGACCCCAGG + Intronic
1154496665 18:14966269-14966291 GTCACCTAAACATTGGCCCATGG + Intergenic
1157325725 18:46667629-46667651 GTGCCCTCAACACTGCCCAAAGG + Intergenic
1157349580 18:46872637-46872659 GTGTCCTAAATACTTAACCTTGG - Intronic
1158403982 18:57145107-57145129 GTGCCCTAAACCCTGATCCAAGG + Intergenic
1159769760 18:72536056-72536078 GTCTCCTAATCACAGAGCCAAGG + Intergenic
1166761048 19:45224672-45224694 GCTTCCCAAACACTGAGCCATGG + Intronic
928738735 2:34324116-34324138 GTGGACTAAATACTGATCCATGG - Intergenic
929349851 2:40937416-40937438 TTTGCCTAAACACTGACCAAAGG - Intergenic
932623525 2:73281348-73281370 GTGTCCAAATCACTTGCCCAAGG + Intronic
934984556 2:98874854-98874876 GTGTCACAAACACAGACCCTCGG + Intronic
935543168 2:104373450-104373472 GTGTCCTGTGCACTGGCCCATGG - Intergenic
936912072 2:117603628-117603650 GTGTCAGTAACACTGACACACGG + Intergenic
939366732 2:141242797-141242819 GTGTCCTAACCACTCACTGAAGG - Intronic
939526923 2:143306902-143306924 GTGTCCAGAATCCTGACCCATGG - Intronic
940410237 2:153354441-153354463 GTGTCCTAATAACTGACTGAAGG + Intergenic
947649200 2:231770513-231770535 GTGACTTAAACACTGAGACAAGG + Intronic
1169058290 20:2641693-2641715 GTGTCCTAAACTGTATCCCATGG - Exonic
1172921161 20:38483597-38483619 ATTTCCTAAACATTCACCCAAGG - Intronic
1174272930 20:49382609-49382631 GTGTTCTAAAAACTGACTTAGGG + Intronic
1175428052 20:58882569-58882591 GTGTCCAAAACTCAGCCCCATGG + Intronic
1177925615 21:27210979-27211001 ATGTTCTAAACACTGCCACATGG - Intergenic
1178410876 21:32362803-32362825 GTGTCCTTACCCCTCACCCATGG - Intronic
1178876743 21:36419831-36419853 CTGTCCTACACACACACCCAAGG - Intergenic
1181140706 22:20802904-20802926 GTGCCCCAAACACTTAGCCAGGG - Intronic
952166588 3:30756581-30756603 GTGTGCTAAATTCTGACCCAAGG + Intronic
954228689 3:49199646-49199668 GTATCCTGAACCCAGACCCACGG - Intronic
955935243 3:64096699-64096721 GTGGCCTAAAAACTGACACATGG - Exonic
956332262 3:68124616-68124638 GTGTCTTAAACACTGTACTATGG + Intronic
957741888 3:84281211-84281233 TTGTCCTAAAAACTCACTCATGG + Intergenic
961461203 3:127051493-127051515 GTGTGCTGAGCACTGTCCCAAGG - Intergenic
963582248 3:147140371-147140393 GTGTTCCAAGCACTGACACAGGG + Intergenic
965195961 3:165594806-165594828 GTGTCCTCAAAACTGTTCCAGGG - Intergenic
965549395 3:169948648-169948670 GTCTCCTACTCACTGCCCCAAGG + Intergenic
969670686 4:8588401-8588423 AAGTCCTCAACACTGTCCCATGG - Intronic
970740469 4:19231331-19231353 GAGTCCAAAAGTCTGACCCAGGG - Intergenic
971174209 4:24265268-24265290 GTTTCCTATTCACTGAACCAAGG + Intergenic
976517824 4:85991348-85991370 ATGTGCTAAACATTTACCCAAGG + Intronic
987614730 5:20258961-20258983 GTGTCCAAACTCCTGACCCAAGG + Intronic
988502541 5:31795644-31795666 GTGTGCAAAACATTGACTCAGGG - Intronic
989091390 5:37736743-37736765 GTGTGCAAAACAATCACCCAGGG - Intronic
990140869 5:52702407-52702429 GTGTCCTAAACTCGGAGCCCAGG - Intergenic
991225642 5:64268036-64268058 GTTTCTTAAACTGTGACCCATGG - Intronic
991302524 5:65143205-65143227 GTGTCTTACAAACTGACCCAAGG - Intergenic
995039915 5:107576032-107576054 TTGTATTAAACACTCACCCAAGG + Intronic
998960714 5:147483616-147483638 GTGTCCTTACCACTGCCACAGGG - Intronic
999770410 5:154771208-154771230 GTGTCCTAAAATCTGCCTCATGG + Intronic
1002767617 6:256198-256220 TTCTCCAAAACACTGAGCCAGGG - Intergenic
1006445943 6:34079869-34079891 GTGGCCTCCACACTGGCCCAGGG + Intronic
1007228842 6:40334085-40334107 GTGTCCTCAAAGCTGAGCCATGG - Intergenic
1013634543 6:112016550-112016572 TTTCCCTAAACACTGACACAGGG + Intergenic
1014093901 6:117438978-117439000 GTGCCTTAAATTCTGACCCATGG - Intronic
1017657741 6:156646019-156646041 GTGCCCCAAACACTCATCCATGG - Intergenic
1023853378 7:44163360-44163382 ATGTCTTAAACTCTGACCCAAGG - Intronic
1026233411 7:68505297-68505319 GTGCCCCAAACGCTGACCAAGGG + Intergenic
1044639111 8:94360004-94360026 GTGTCCTAGAGCCTGACCCATGG - Intergenic
1046764700 8:118056972-118056994 GTTTCCTAAACACAGGCCCTGGG + Intronic
1051503133 9:17800032-17800054 GTGTACTATACACAGCCCCAGGG - Intergenic
1059363637 9:113768115-113768137 GTGTCCTAAGGACTGAGCTATGG - Intergenic
1060872803 9:127056244-127056266 GTGTCCTAAGGGCTGAGCCAGGG + Intronic
1061532328 9:131224453-131224475 GTGTCCTGCCCACTTACCCAGGG - Intronic
1194603533 X:95953652-95953674 GTGTGCTAAACACAGTCACATGG - Intergenic
1196277224 X:113780778-113780800 GTGTCCAAAGCACTCCCCCAAGG + Intergenic